CDS GC%: 43.9% tRNA GC%: 58.1% rRNA GC%: 52.7%

IGS#	Up stream Locus	Up stream Product	Down Stream Locus	Down Stream Product	Gene Dir type	Start	End	IGS Len	GC%	IS NT	IS AA	NR	PT-Pair	Intra Spp. IGS	Inter Spp. IGS	Conserved Inter-spp IGS Start	Conserved Inter-spp IGS End	Blast Result	Conserved IGS Seq
1	AA00004	conserved hypothetical protein (possible methyltransferase)	AA00007	superoxide dismutase [Cu-Zn] precursor	->->	4356	4542	187	21.4%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
4	AA00015	malate dehydrogenase	AA00017	hypothetical protein	->->	8394	8498	105	23.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
6	AA00020	conserved hypothetical protein	AA00021	DNA helicase IV	->->	14547	14769	223	31.4%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
7	AA00022	conserved hypothetical protein	AA00024	transcriptional regulatory protein	->->	18945	19150	206	30.1%	0	0	0	+: 0/6/0 \| -: 0/3/0	1	0	0	0	Result
8	AA00026	conserved hypothetical protein	AA00028	conserved hypothetical protein (possible type III restriction-modification system restriction subunit)	->->	20603	20734	132	34.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
9	AA00030	hypothetical protein	AA00031	conserved hypothetical protein	->->	25229	25420	192	35.4%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
10	AA00037	conserved hypothetical protein	AA00038	conserved hypothetical protein	->->	29967	30080	114	22.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
11	AA00042	hypothetical protein	AA00043	formate dependent nitrite reductase, transmembrane protein	->->	34316	34517	202	36.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
12	AA00047	formate dependent nitrite reductase, cytochrome c552	AA00048	conserved hypothetical protein	->->	38414	38992	579	29.2%	0	0	0	+: 0/1/0 \| -: 1/2/1	1	0	0	0	Result
13	AA00049	conserved hypothetical protein	AA00050	cytochrome c-type biogenesis protein precursor (reductase)	->->	39925	40058	134	33.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
14	AA00061	cytochrome c-type biogenesis ATP-binding protein	AA00062	bicyclomycin resistance protein (Sulfonamide resistance protein)	->->	46855	47028	174	34.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
16	AA00066	NADP-dependent malic enzyme (NADP-ME)	AA00068	manganese superoxide dismutase	->->	51404	51549	146	30.8%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
17	AA00068	manganese superoxide dismutase	AA00069	conserved hypothetical protein	->->	52192	52604	413	35.6%	0	0	0	+: 2/1/2 \| -: 0/3/0	1	0	0	0	Result
18	AA00069	conserved hypothetical protein	AA00071	conserved hypothetical protein (possible zinc protease)	->->	53394	53602	209	40.2%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
19	AA00071	conserved hypothetical protein (possible zinc protease)	AA00072	conserved hypothetical protein	->->	54428	54566	139	32.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
20	AA00076	dihydroneopterin aldolase	AA00077	conserved hypothetical protein (possible periplasmic binding transport protein)	->->	56144	56250	107	33.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
21	AA00080	Na+/H+ antiporter protein	AA00081	fatty acid metabolism regulator protein	->->	59905	60098	194	26.3%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
22	AA00084	aminotransferase	AA00085	menaquinone-specific isochorismate; isochorismate mutase	->->	62166	62281	116	29.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
23	AA00088	30S ribosomal protein S15	AA00089	S-adenosylmethionine synthase; methionine adenosyltransferase	->->	66448	66657	210	34.3%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
24	AA00091	short-patch reverse transcription protein	AA00092	serine transporter	->->	68379	68537	159	25.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
25	AA00093	L-serine dehydratase (L-serine deaminase)	AA00096	L-asparaginase II precursor	->->	71234	71419	186	36.6%	0	0	0	+: 0/3/0 \| -: 0/3/0	1	0	0	0	Result
26	AA00096	L-asparaginase II precursor	AA00099	conserved hypothetical protein	->->	72467	72760	294	40.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
27	AA00101	fimbrial biogenesis and twitching motility protein	AA00105	conserved hypothetical protein	->->	74471	74616	146	40.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
28	AA00112	uracil permease	AA00113	uracil phosphoribosyltransferase	->->	81300	81425	126	38.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
29	AA00113	uracil phosphoribosyltransferase	AA00114	peptidyl-prolyl cis-trans isomerase D (PPIase D) (rotamase D)	->->	82050	82186	137	34.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
30	AA00114	peptidyl-prolyl cis-trans isomerase D (PPIase D) (rotamase D)	AA00115	glutamate--cysteine ligase (gamma-glutamylcysteine synthetase) (gamma-ECS)	->->	84032	84166	135	29.6%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
31	AA00115	glutamate--cysteine ligase (gamma-glutamylcysteine synthetase) (gamma-ECS)	AA00116	conserved hypothetical protein	->->	86438	86668	231	27.3%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
32	AA00116	conserved hypothetical protein	AA00117	hypothetical protein	->->	88268	88385	118	39.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
33	AA00125	conserved hypothetical protein (possible phage-related protein)	AA00126	conserved hypothetical protein	->->	91074	91192	119	32.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
34	AA00135	S-adenosylmethionine: 2-demethylmenaquinone methyltransferase (menaquinone biosynthesis protein)	AA00136	sodium/sulphate transporter	->->	96941	97131	191	29.8%	0	0	0	+: 1/2/1 \| -: 0/1/0	1	0	0	0	Result
35	AA00139	antibiotic maturation factor	AA00140	hypothetical protein	->->	100597	100785	189	30.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	1	15	162	Result	taaatgataataattcttattgacaacaattaaaactctgctaacataagccacatctgttaagtattgcaatgaagatgaacggtagtcattggaagtctgcatagtactccaaacaggtagagtagaaagtaaattcgttagggta
38	AA00148	ATP-dependent RNA helicase	AA00150	conserved hypothetical protein (possible TPR domain protein)	->->	107904	108017	114	36%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
39	AA00151	polynucleotide phosphorylase	AA00153	conserved hypothetical protein	->->	111132	111424	293	33.1%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
40	AA00166	conserved hypothetical protein (possible acetyltransferase)	AA00167	possible amino-acid transporter (sodium-alanine symporters)	->->	117980	118378	399	44.6%	0	0	0	+: 1/3/0 \| -: 0/0/0	1	3	58	288	Result	gttcggacgaaggtagctggagagcggggaatcgaccccacgccgacgaggtaaaatctttcaggcgcgatggcagggactgttactggacgaacccttggagagatccaaggtacttttaaagcgtttactttcaaggtaacgactttttaagtgctaatggacgccgaaggcgcaaagaagcttgattccatcaggcttttcaaacgctcaggcaaaaggacaggggca
41	AA00167	possible amino-acid transporter (sodium-alanine symporters)	AA00168	possible sigma 54 modulation protein	->->	119750	119979	230	32.6%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
42	AA00168	possible sigma 54 modulation protein	AA00169	conserved hypothetical protein	->->	120301	120451	151	35.1%	0	0	0	+: 1/0/0 \| -: 0/2/0	1	0	0	0	Result
43	AA00169	conserved hypothetical protein	AA00170	hypothetical protein	->->	121004	121377	374	39%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
44	AA00170	hypothetical protein	AA00171	DNA-binding protein	->->	121468	121624	157	40.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
45	AA00172	conserved hypothetical protein (possible regulator protein / nitrogen fixation protein)	AA00173	hypothetical protein	->->	122965	123107	143	25.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
47	AA00180	conserved hypothetical protein	AA00181	hypothetical protein	->->	128129	128708	580	34.5%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
48	AA00185	3-dehydroquinate dehydratase II	AA00186	o-succinylbenzoate-CoA synthase; OSB synthase	->->	131406	131506	101	34.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
49	AA00189	dihydroxynaphthoic acid synthase (naphthoate synthas)	AA00190	triosephosphate isomerase	->->	134114	134227	114	37.7%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
50	AA00190	triosephosphate isomerase	AA00191	conserved hypothetical protein (possible acetyltransferase, GNAT family)	->->	134993	135158	166	27.1%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
51	AA00196	conserved hypothetical protein	AA00198	conserved hypothetical protein (Cytosine deaminase-related enzyme)	->->	138076	138178	103	41.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
52	AA00199	hypothetical protein	AA00200	thymidylate synthase	->->	138805	139031	227	47.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	2	0	0	0	Result
53	AA00204	(di)nucleoside polyphosphate hydrolase; possible invasion protein	AA00205	ribose ABC transporter protein / high affinity D-ribose transport protein	->->	142083	142301	219	36.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
54	AA00212	ribokinase	AA00213	cold shock protein (negative regulator of cspA transcription)	->->	147108	147210	103	34%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
58	AA00218	argininosuccinate lyase	AA00221	NADP-specific glutamate dehydrogenase	->->	152272	152575	304	29.9%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
59	AA00221	NADP-specific glutamate dehydrogenase	AA00223	catalase (hydroperoxidase; iron heme axial ligand)	->->	153926	154416	491	33.8%	0	0	0	+: 0/3/0 \| -: 0/2/0	1	0	0	0	Result
60	AA00223	catalase (hydroperoxidase; iron heme axial ligand)	AA00226	hypothetical protein	->->	155869	156415	547	35.1%	0	0	5	+: 1/0/0 \| -: 0/2/0	1	0	0	0	Result
62	AA00229	DNA polymerase III, alpha subunit	AA00231	long-chain-fatty-acid--CoA ligase	->->	160372	160674	303	39.9%	0	1	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
63	AA00233	hypothetical protein	AA00234	collagen adhesin	->->	162593	162806	214	26.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
64	AA00235	hypothetical protein	AA00236	anaerobic ribonucleoside-triphosphate reductase	->->	168829	168957	129	27.9%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
65	AA00237	hypothetical protein	AA00239	hypothetical protein	->->	171230	171352	123	36.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
67	AA00249	cysteinyl-tRNA synthetase (cysteine--tRNA ligase)	AA00250	lipoate biosynthesis protein A	->->	175483	175635	153	37.3%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
68	AA00254	penicillin-binding protein 5	AA00256	rare lipoprotein A precursor	->->	178835	178939	105	37.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
69	AA00265	transcription termination factor	AA00266	conserved hypothetical protein (probable metabolite transport protein)	->->	186644	186773	130	36.9%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
70	AA00268	acyl carrier protein (ACP)	AA00269	3-oxoacyl-(acyl-carrier-protein) reductase/short-chain alcohol dehydrogenase	->->	188472	188747	276	37.3%	0	0	0	+: 0/0/0 \| -: 2/2/2	1	0	0	0	Result
71	AA00280	adenosylmethionine-8-amino-7-oxononanoate; 7,8-diamino-perlargonic acid ATase	AA00281	phosphatidylserine decarboxylase proenzyme	->->	197857	198078	222	33.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
72	AA00305	conserved hypothetical protein	AA00306	nitrogen regulatory protein p-II	->->	207922	208062	141	38.3%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
73	AA00308	glycerol-3-phosphate regulon repressor	AA00309	3-hydroxyisobutyrate dehydrogenase; 2-hydroxy-3-oxopropionate reductase	->->	209233	209424	192	26%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
74	AA00314	conserved hypothetical protein (possible Kmt1 protein)	AA00316	conserved hypothetical protein	->->	214387	214584	198	40.4%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
75	AA00316	conserved hypothetical protein	AA00317	DNA mismatch repair protein	->->	215401	215611	211	39.8%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
76	AA00317	DNA mismatch repair protein	AA00318	hypothetical protein	->->	218171	218296	126	27.8%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
77	AA00321	hypothetical protein	AA00323	conserved hypothetical protein (possible SAM-dependent methyltransferase)	->->	219413	219526	114	31.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
78	AA00327	conserved hypothetical protein	AA00329	molybdopterin-guanine dinucleotide biosynthesis protein	->->	222743	222876	134	44.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
79	AA00329	molybdopterin-guanine dinucleotide biosynthesis protein	AA00330	conserved hypothetical protein	->->	223408	223508	101	38.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
80	AA00330	conserved hypothetical protein	AA00332	PTS system, fructose-specific IIA/FPr component (diphosphoryl transfer protein)	->->	224037	224150	114	36%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
81	AA00335	PTS fructose-specific IIBC component	AA00337	conserved hypothetical protein	->->	228291	228403	113	38.9%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
82	AA00343	conserved hypothetical protein (possible cytosolic protein)	AA00344	preprotein translocase secE subunit	->->	230714	231157	444	34.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
83	AA00345	transcription antitermination protein	AA00347	50S ribosomal protein L11	->->	232119	232276	158	39.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
84	AA00349	hypothetical protein	AA00350	50S ribosomal protein L10	->->	233588	233760	173	43.4%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	4	8	173	Result	attcaagccccgtccaagaccgtaggggagcaatcttaattatcctacgtagatggtgaacagaataagaattttcttgcttctgtgcaccgagttcgtcctaatagcagttttattaggtatctaaattccgagcaatcggagtgtattcaggagctaacagcca
85	AA00351	50S ribosomal protein L7/L12	AA00354	hypothetical protein	->->	234673	234829	157	35.7%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
86	AA00355	DNA-directed RNA polymerase beta chain (transcriptase beta chain)	AA00356	DNA-directed RNA polymerase, beta' chain	->->	238972	239076	105	42.9%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
89	AA00370	30S ribosomal protein S10	AA00371	transcriptional regulator	->->	249069	249320	252	36.1%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	3	1	174	Result	tagaccagagctccaataaatttagctaataaaaaactaacaccatcacaattcttacatcaaaacaacaagaaaaggaggtgaaagctacctgttatatagtccccaaatcggagacattgttagtattacctatcgtaatacccgtttaataaatgattacactaaacggct
90	AA00371	transcriptional regulator	AA00372	acetate CoA-transferase (alpha subunit)	->->	250215	250487	273	38.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
91	AA00377	acetyl-CoA acetyltransferase (Beta-ketothiolase,3-ketoacyl-CoA thiolase)	AA00378	leucine-responsive regulatory protein (transcription regulator)	->->	254361	254463	103	37.9%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
92	AA00379	possible membrane protein	AA00380	carbamate kinase	->->	256549	256667	119	38.7%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
93	AA00381	ornithine carbamoyltransferase	AA00382	hypothetical protein	->->	258612	258732	121	33.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
95	AA00388	uridine phosphorylase; possible 5'-methylthioadenosine phosphorylase; purine nucleoside phosphorylase	AA00390	permease	->->	263687	263828	142	39.4%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
96	AA00391	arsenate reductase	AA00395	conserved hypothetical protein	->->	265309	265417	109	42.2%	0	0	0	+: 0/3/0 \| -: 0/0/0	1	0	0	0	Result
97	AA00396	conserved hypothetical protein	AA00397	Fe-S oxidoreductase; MiaB-like RNA modifying enzyme (2-methylthioadenine synthetase)	->->	266013	266208	196	35.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
98	AA00398	protein-tyrosine-phosphatase (PTPase)	AA00399	conserved hypothetical protein	->->	268079	268207	129	36.4%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
99	AA00406	large-conductance mechanosensitive channel	AA00407	trk system potassium uptake protein	->->	270884	270995	112	29.5%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
106	AA00413	conserved hypothetical protein	AA00414	possible histidinol-phosphatase	->->	280615	281038	424	37.3%	0	0	0	+: 0/1/0 \| -: 0/2/0	3	0	0	0	Result
107	AA00414	possible histidinol-phosphatase	AA00415	D-methionine ABC transporter, ATP-binding protein	->->	281594	281789	196	29.6%	0	0	0	+: 0/0/0 \| -: 2/0/0	1	0	0	0	Result
108	AA00417	outer membrane lipoprotein precursor (probable D-methionine-binding lipoprotein)	AA00419	conserved hypothetical protein (possible phosphatidylethanolamine-binding protein)	->->	284369	284476	108	39.8%	0	0	0	+: 1/2/0 \| -: 0/0/0	1	0	0	0	Result
109	AA00419	conserved hypothetical protein (possible phosphatidylethanolamine-binding protein)	AA00420	tRNA/rRNA methyltransferase	->->	284972	285092	121	41.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
110	AA00420	tRNA/rRNA methyltransferase	AA00422	LapB membrane protein	->->	285567	285667	101	33.7%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
111	AA00422	LapB membrane protein	AA00423	GTP-binding protein	->->	286541	286672	132	31.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
112	AA00426	conserved hypothetical protein	AA00427	hypothetical protein	->->	288266	288369	104	28.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
113	AA00428	hypothetical protein	AA00429	conserved hypothetical protein	->->	290107	290706	600	29.3%	0	0	0	+: 0/1/0 \| -: 2/1/0	1	0	0	0	Result
115	AA00432	conserved hypothetical protein; possible methyltransferase	AA00434	VgrG-like protein (Rhs accessory genetic element)	->->	294694	294964	271	32.5%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
116	AA00435	hypothetical protein	AA00436	hypothetical protein	->->	301457	301877	421	31.6%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
117	AA00436	hypothetical protein	AA00437	conserved hypothetical protein; possible parB-like nuclease	->->	302160	302283	124	33.9%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
118	AA00440	hypothetical protein	AA00442	conserved hypothetical protein (possible zinc finger protein)	->->	305846	306328	483	28.2%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
119	AA00447	conserved hypothetical protein	AA00448	C-terminal region of competence protein M	->->	312282	312407	126	27.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
120	AA00452	phosphomannomutase; phosphoglucomutase	AA00453	phosphoglyceromutase	->->	317084	317388	305	32.8%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
121	AA00461	heat shock protein; protease	AA00463	class B acid phosphatase	->->	323040	323253	214	36.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
122	AA00464	conserved hypothetical protein	AA00465	hypothetical protein	->->	324166	324345	180	32.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
123	AA00468	tryptophan-specific transport protein / tyrosine-specific transport protein	AA00469	inorganic pyrophosphatase, chain A	->->	326185	326345	161	32.9%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
124	AA00470	conserved hypothetical protein (possible Zn-dependent protease with chaperone function)	AA00471	3,4-dihydroxy-2-butanone 4-phosphate synthase; GTP cyclohydrase II	->->	327720	328401	682	39%	0	0	0	+: 0/3/0 \| -: 0/2/0	1	2	390	588	Result	tttgcgctatactaggcgcgcattctcagggcagggtgaaagtccctaccggtggtaagcatgaaggaatgtttcaatgcaagcccacgagcgtttatcgacaaaagtgcggtcgtttttgacggcgttttttcgataaagtcagcagatttggtgcgaatccaaagccgacagtgacagtctggatgaaagagaataa
125	AA00473	tryptophanyl-tRNA synthetase	AA00474	cell division protein Y (GTP-binding signal recognition particle)	->->	330138	330314	177	32.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
126	AA00475	conserved hypothetical protein (possible N6-adenine-specific methylase)	AA00478	mannose-specific phosphotransferase element	->->	332343	332631	289	34.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
127	AA00480	mannose-specific phosphotransferase system IID	AA00482	hydrolase (haloacid dehalogenase-like) (HAD superfamily)	->->	335260	335371	112	43.8%	0	0	0	+: 0/0/0 \| -: 0/3/0	1	0	0	0	Result
128	AA00485	hypothetical protein	AA00486	nucleoside transporter	->->	336769	336922	154	30.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
129	AA00486	nucleoside transporter	AA00488	purine nucleoside phosphorylase	->->	338087	338214	128	38.3%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
130	AA00489	hypothetical protein	AA00490	possible outer membrane protein (hemin-binding protein / haemin storage protein)	->->	339093	339200	108	21.3%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
132	AA00497	hexose phosphate transport system regulatory protein; regulator of uhpT expression	AA00499	pyridoxamine-5'-phosphate oxidase	->->	346540	346709	170	34.7%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
134	AA00504	ATPase	AA00505	hypothetical protein	->->	351348	351700	353	36.3%	0	0	0	+: 0/1/0 \| -: 1/1/1	1	0	0	0	Result
135	AA00512	conserved hypothetical protein	AA00513	pseudouridylate synthase (pseudouridine synthase)	->->	354710	355089	380	40.5%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
136	AA00516	autoinducer-2 production protein	AA00518	conserved hypothetical protein	->->	356575	356790	216	28.2%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
137	AA00521	phosphatase	AA00523	conserved hypothetical protein	->->	358385	358611	227	39.6%	0	0	1	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
138	AA00528	conserved hypothetical protein	AA00529	outer membrane protein, Omp 18/16	->->	361764	361869	106	52.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
139	AA00534	hypothetical protein	AA00535	hypothetical protein	->->	365655	365834	180	48.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
140	AA00535	hypothetical protein	AA00536	5'-nucleotidase precursor	->->	366180	366290	111	39.6%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
141	AA00537	conserved hypothetical protein	AA00538	hypothetical protein	->->	368840	369045	206	30.1%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
142	AA00543	ADP-heptose--LPS heptosyltransferase II	AA00544	glutathionylspermidine synthetase;amidase	->->	372468	372587	120	39.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
143	AA00550	ferredoxin-type protein	AA00551	hypothetical protein	->->	377262	377364	103	51.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
144	AA00559	conserved hypothetical protein	AA00560	RNA polymerase sigma-32 factor	->->	383619	383805	187	26.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
145	AA00562	hypothetical protein	AA00563	elongation factor Tu	->->	385521	386646	1126	34.4%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
146	AA00564	elongation factor G	AA00565	30S ribosomal protein S7	->->	389995	390111	117	27.4%	0	0	0	+: 0/0/0 \| -: 1/1/1	1	0	0	0	Result
147	AA00565	30S ribosomal protein S7	AA00566	30S ribosomal protein S12 (streptomycin resistance protein)	->->	390580	390734	155	34.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
148	AA00569	ketol-acid reductoisomerase	AA00570	hypothetical protein	->->	391643	391752	110	39.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
149	AA00570	hypothetical protein	AA00573	chloramphenicol-sensitive protein RarD	->->	391846	392104	259	39%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
151	AA00578	DNA topoisomerase	AA00579	probable DNA recombination protein	->->	395262	395404	143	46.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
153	AA00590	outer membrane substrate binding protein; TonB-dependent outer membrane receptor	AA00591	ABC transporter, ATP-binding protein	->->	403158	403752	595	34.5%	0	0	4	+: 0/4/0 \| -: 0/6/0	1	0	0	0	Result
154	AA00591	ABC transporter, ATP-binding protein	AA00592	conserved hypothetical protein (membrane/transport protein)	->->	405568	405675	108	27.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
156	AA00602	1-deoxy-D-xylulose 5-phosphate reductoisomerase	AA00603	undecaprenyl pyrophosphate synthetase (UPPS)	->->	410312	410422	111	45.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
157	AA00608	protective surface antigen D-15, 85 -kilodalton outermembrane protein	AA00609	outer membrane protein	->->	415710	415814	105	37.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
158	AA00618	molybdopterin biosynthesis protein	AA00619	hypothetical protein	->->	423703	424270	568	31.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
165	AA00622	conserved hypothetical protein	AA00623	hypothetical protein	->->	430165	430596	432	37.7%	0	0	0	+: 0/0/0 \| -: 0/1/0	3	0	0	0	Result
166	AA00628	biotin operon repressor; biotin acetyl coenzyme A carboxylase synthetase	AA00629	inosine 5' monophosphate dehydrogenase (IMP dehydrogenase)	->->	431925	432065	141	31.9%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
167	AA00629	inosine 5' monophosphate dehydrogenase (IMP dehydrogenase)	AA00631	hypothetical protein	->->	433530	433817	288	37.8%	0	0	0	+: 0/0/0 \| -: 0/1/0	4	0	0	0	Result
168	AA00631	hypothetical protein	AA00632	inner membrane protein ImpA	->->	433989	434266	278	35.6%	0	0	0	+: 0/2/0 \| -: 0/2/0	2	0	0	0	Result
169	AA00632	inner membrane protein ImpA	AA00633	hypothetical protein	->->	434714	435110	397	30.5%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
170	AA00634	DNA polymerase IV (Pol IV)	AA00635	dihydropteroate synthase	->->	435892	436036	145	39.3%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
171	AA00637	phosphohistidine phosphatase	AA00640	hypothetical protein	->->	438735	438932	198	22.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
172	AA00643	hypothetical protein	AA00644	lipoprotein	->->	440755	440924	170	34.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
173	AA00644	lipoprotein	AA00646	2-dehydro-3-deoxyphosphooctonate aldolase	->->	441432	441613	182	23.6%	0	0	0	+: 1/2/0 \| -: 1/3/3	1	0	0	0	Result
174	AA00649	peptide chain release factor 1 (RF-1)	AA00650	15 kDa peptidoglycan-associated protein	->->	444416	444637	222	35.1%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
175	AA00651	conserved hypothetical protein	AA00652	arginyl-tRNA synthetase (arginine--tRNA ligase)	->->	445720	445857	138	31.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
176	AA00652	arginyl-tRNA synthetase (arginine--tRNA ligase)	AA00653	hypothetical protein	->->	447547	447821	275	34.9%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
177	AA00657	heat shock protein 70	AA00658	hypothetical protein	->->	451527	451757	231	36.8%	0	0	0	+: 1/0/0 \| -: 0/3/0	1	0	0	0	Result
178	AA00660	hypothetical protein	AA00661	outer membrane protein	->->	453396	453541	146	30.8%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
179	AA00661	outer membrane protein	AA00662	cystathionine beta-lyase	->->	454592	454807	216	28.7%	0	0	0	+: 0/1/0 \| -: 1/1/0	1	0	0	0	Result
180	AA00663	cystathionine beta-lyase	AA00664	phosphatidylglycerophosphate synthase (CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase)	->->	455995	456249	255	32.9%	0	0	0	+: 1/0/0 \| -: 2/1/0	1	0	0	0	Result
182	AA00666	hypothetical protein	AA00667	cytolethal distending toxin protein C	->->	457715	458082	368	30.4%	0	0	0	+: 0/3/0 \| -: 0/1/0	1	0	0	0	Result
183	AA00673	hypothetical protein	AA00674	nicotinate-nucleotide-dimethylbenzimidazole phosphoribosyltransferase	->->	461356	461949	594	40.2%	0	0	3	+: 0/0/0 \| -: 1/1/1	1	0	0	0	Result
184	AA00675	glutaredoxin 2	AA00679	cytoplasmic axial filament (Ribonuclease G)	->->	463309	463427	119	46.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
185	AA00679	cytoplasmic axial filament (Ribonuclease G)	AA00680	sodium/proline symporter (proline permease)	->->	464901	465038	138	36.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
186	AA00688	curved DNA-binding protein	AA00689	GTP-binding protein	->->	470286	470572	287	33.4%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
187	AA00691	conserved hypothetical protein (possible multidrug/sugar efflux transporter)	AA00692	conserved hypothetical protein	->->	473216	473375	160	45%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
188	AA00695	uridine kinase	AA00696	iron(III) ABC transporter, periplasmic iron-compound-binding protein	->->	475821	476128	308	30.8%	0	0	0	+: 0/0/0 \| -: 1/1/1	1	0	0	0	Result
189	AA00700	iron(III) ABC transporter, ATP-binding protein	AA00702	conserved hypothetical protein	->->	481519	481799	281	37.4%	0	0	0	+: 0/2/0 \| -: 0/4/0	1	0	0	0	Result
190	AA00709	metallocluster assembly (NifU protein)	AA00711	conserved hypothetical protein	->->	487899	488032	134	32.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
191	AA00716	conserved hypothetical protein	AA00717	methionyl-tRNA synthetase	->->	491305	491443	139	37.4%	0	0	0	+: 0/3/0 \| -: 0/1/0	1	0	0	0	Result
192	AA00717	methionyl-tRNA synthetase	AA00718	ABC-related ATP-binding protein; MRP protein	->->	493502	493673	172	30.2%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
193	AA00721	probable beta-N-acetylhexosaminidase (lacto-N-biosidase); dispersin B	AA00722	nucleoside diphosphate kinase	->->	496022	496159	138	29%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
194	AA00726	apolipoprotein N-acyltransferase, copper	AA00729	possible hemolysin (TlyC-like)	->->	499947	500343	397	46.3%	0	0	0	+: 0/0/0 \| -: 0/1/0	4	0	0	0	Result
195	AA00741	possible 2-oxoglutarate/malate transporter	AA00742	hypothetical protein	->->	508137	508324	188	37.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
197	AA00747	UTP--hexose-1-phosphate uridylyltransferase / UDPglucose-hexose-1-phosphate uridylyltransferas	AA00748	hypothetical protein	->->	513565	513757	193	32.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
198	AA00749	galactose operon repressor (gal repressor)	AA00750	periplasmic D-galactose-binding ABC transport protein	->->	514827	515043	217	28.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
199	AA00759	3-oxoacyl-[acyl-carrier-protein] synthase I	AA00760	conserved hypothetical protein (possible peptidase)	->->	521961	522129	169	34.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
200	AA00761	conserved hypothetical protein (possible peptidase)	AA00762	hemoglobin binding protein A	->->	524147	524338	192	29.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
201	AA00764	hemoglobin binding protein A	AA00766	heat shock protein B25.3 (HSP-70 cofactor)	->->	527408	527523	116	37.9%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
202	AA00776	conserved hypothetical protein	AA00777	soluble lytic murein transglycosylase	->->	533930	534458	529	42%	0	0	0	+: 0/0/0 \| -: 0/3/0	6	0	0	0	Result
203	AA00780	monofunctional biosynthetic peptidoglycan transglycosylase	AA00781	hypothetical protein	->->	537765	538026	262	29.4%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
204	AA00781	hypothetical protein	AA00782	conserved hypothetical protein	->->	538279	538862	584	39.4%	0	0	0	+: 0/3/0 \| -: 1/2/1	1	0	0	0	Result
206	AA00807	fumarate reductase 13 kD hydrophobic protein	AA00809	possible oxidoreductase	->->	553249	553350	102	39.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
207	AA00809	possible oxidoreductase	AA00810	alcohol dehydrogenase	->->	555496	555765	270	30%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
208	AA00811	conserved hypothetical protein	AA00812	ATPase (PP-loop superfamily), confers aluminum resistance	->->	558088	558214	127	21.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
209	AA00813	hypothetical protein	AA00814	conserved hypothetical protein	->->	559082	559264	183	37.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
210	AA00815	conserved hypothetical protein	AA00816	lacZ expression regulator	->->	560524	561039	516	35.3%	0	0	1	+: 0/2/0 \| -: 0/2/0	1	0	0	0	Result
211	AA00817	MutT-family protein	AA00819	D-alanyl-D-alanine carboxypeptidase	->->	562536	562783	248	34.3%	0	0	0	+: 0/2/0 \| -: 0/2/0	1	0	0	0	Result
212	AA00820	succinyl-diaminopimelate desuccinylase	AA00822	conserved hypothetical protein (possible arsenate reductase)	->->	564597	564735	139	48.9%	0	0	0	+: 1/2/1 \| -: 0/1/0	1	0	0	0	Result
213	AA00825	P-protein (chorismate mutase/prephenate dehydratase)	AA00826	UDP-3-O-acyl-GlcNAc deacetylase	->->	568318	568517	200	26%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
215	AA00847	S-adenosyl-dependent methyltransferase	AA00849	MraZ cell division protein	->->	586066	586177	112	37.5%	0	0	0	+: 0/2/0 \| -: 0/2/0	1	0	0	0	Result
216	AA00851	carbon starvation protein	AA00852	hypothetical protein	->->	588496	588677	182	33.5%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
217	AA00853	hypothetical protein	AA00854	arginine transport system permease protein	->->	588920	589037	118	33.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
218	AA00858	arginine ABC transporter, ATP-binding protein	AA00860	phosphoheptose isomerase	->->	591863	592005	143	25.9%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
219	AA00860	phosphoheptose isomerase	AA00861	transcription repair coupling factor	->->	592588	592691	104	38.5%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
220	AA00861	transcription repair coupling factor	AA00862	conserved hypothetical protein	->->	596211	596604	394	44.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	5	0	0	0	Result
221	AA00864	conserved hypothetical protein	AA00865	conserved hypothetical protein	->->	599444	599612	169	36.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
222	AA00866	conserved hypothetical protein	AA00867	fimbrial protein Flp precursor	->->	600311	600781	471	26.5%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
225	AA00882	hypothetical protein	AA00883	hypothetical protein	->->	613706	614437	732	36.9%	0	0	0	+: 1/1/1 \| -: 0/1/0	1	0	0	0	Result
226	AA00884	sodium-dependent transporter	AA00885	ribosomal large subunit pseudouridine synthase c	->->	616032	616446	415	26.3%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
227	AA00900	conserved hypothetical protein	AA00902	RNA polymerase sigma-E factor sigma-24	->->	623834	623968	135	30.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
228	AA00914	aminoacyl-histidine dipeptidase; Beta-alanyl-histidine dipeptidase	AA00915	xanthine-guanine phosphoribosyltransferase	->->	629636	629749	114	38.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
229	AA00920	DNA-3-methyladenine glycosylase I	AA00921	conserved hypothetical protein	->->	633274	633471	198	22.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
231	AA00932	ribose ABC transporter, periplasmic protein	AA00933	ribose ABC transporter, ATP-binding protein	->->	644256	644417	162	32.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
233	AA00937	L-xylulokinase	AA00938	L-xylulokinase	->->	647586	647695	110	46.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
234	AA00939	transcription accessory protein (toxin expression)	AA00940	probable transcriptional regulator (LysR family)	->->	650785	651003	219	33.3%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
235	AA00940	probable transcriptional regulator (LysR family)	AA00941	symporter transmembrane protein	->->	651889	651997	109	26.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
236	AA00942	related to phosphoglycerate mutase	AA00943	conserved hypothetical protein	->->	654076	654470	395	31.1%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
238	AA00948	probable ECF-family RNA polymerase sigma factor	AA00949	hypothetical protein	->->	656184	656359	176	26.1%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
239	AA00949	hypothetical protein	AA00950	conserved hypothetical protein	->->	656639	657061	423	35.2%	0	0	7	+: 0/3/0 \| -: 0/0/0	1	0	0	0	Result
240	AA00957	porphobilinogen deaminase (hydroxymethylbilane synthase)	AA00958	adenylate cyclase	->->	662004	662257	254	37.8%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
241	AA00964	phosphoenolpyruvate carboxykinase/carboxylase	AA00965	hypothetical protein	->->	674429	674537	109	25.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
242	AA00967	conserved hypothetical protein	AA00969	conserved hypothetical protein (possible NADH pyrophosphatase)	->->	675328	675468	141	28.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
243	AA00971	conserved hypothetical protein	AA00972	DNA-binding protein HU-ALPHA	->->	677936	678104	169	31.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
244	AA00972	DNA-binding protein HU-ALPHA	AA00973	transcriptional regulator, DeoR family	->->	678375	678502	128	34.4%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
245	AA00974	glucosamine-fructose-6-phosphate	AA00976	conserved hypothetical protein	->->	681188	681345	158	38.6%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
246	AA00976	conserved hypothetical protein	AA00977	transcriptional regulator (LysR family)	->->	682339	682506	168	33.9%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
247	AA00977	transcriptional regulator (LysR family)	AA00978	conserved hypothetical protein	->->	683395	683538	144	43.8%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
248	AA00978	conserved hypothetical protein	AA00979	type B carboxylesterase; p-nitrobenzyl esterase	->->	684646	684784	139	47.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
249	AA00981	carboxylesterase	AA00982	aldo-keto reductase	->->	686438	686665	228	38.6%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
250	AA00983	aldo-keto reductase	AA00985	transcriptional regulator (LysR family)	->->	688553	688910	358	44.7%	0	0	0	+: 0/5/0 \| -: 1/1/0	2	0	0	0	Result
251	AA00987	tetracenomycin polyketide synthesis O-methyltransferase	AA00988	conserved hypothetical protein	->->	690647	691037	391	43.2%	0	0	0	+: 0/1/0 \| -: 1/0/0	2	0	0	0	Result
253	AA00993	possible D-tyrosyl-tRNA(Tyr) deacylase	AA00994	sodium/glutamate symport carrier protein (glutamate permease)	->->	695060	695227	168	35.1%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
254	AA00995	sensory transduction protein for cpxR/basR	AA00997	response regulatory protein	->->	697737	697927	191	27.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
255	AA01001	conserved hypothetical protein	AA01003	conserved hypothetical protein	->->	700035	700259	225	36%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
256	AA01005	conserved hypothetical protein	AA01006	conserved hypothetical protein (possible cytosine deaminas)	->->	702259	702519	261	33.7%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
258	AA01008	mazG beta-lactamase regulatory protein homolog	AA01009	universal stress protein A	->->	704474	704582	109	31.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
259	AA01009	universal stress protein A	AA01010	hypothetical protein	->->	705006	705178	173	32.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
260	AA01011	alanyl-tRNA synthetase (alanine--tRNA ligase)	AA01012	probable carbon storage regulator homolog	->->	707830	707954	125	29.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
261	AA01014	UTP-glucose-1-phosphate uridylyltransferase	AA01015	met repressor	->->	710494	710650	157	35%	0	0	0	+: 1/1/0 \| -: 0/1/0	1	0	0	0	Result
263	AA01021	hypothetical protein	AA01022	tRNA (5-methylaminomethyl-2-thiouridylate) methyltransferase	->->	714337	714828	492	41.5%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
264	AA01022	tRNA (5-methylaminomethyl-2-thiouridylate) methyltransferase	AA01023	conserved hypothetical protein	->->	715978	716240	263	32.7%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
266	AA01039	transcriptional regulator (possible murein gene regulator)	AA01040	possible lipoprotein	->->	724313	724415	103	33%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
268	AA01044	A/G-specific adenine glycosylase	AA01045	S-adenosylmethionine-dependent methyltransferase	->->	728039	728203	165	41.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
269	AA01046	conserved hypothetical protein	AA01048	iron binding protein afuA, periplasmic protein	->->	729341	729561	221	24.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
270	AA01062	ribonuclease PH (RNase PH)	AA01063	conserved hypothetical protein	->->	736560	736676	117	34.2%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
271	AA01069	translation elongation factor (EF-Ts)	AA01070	DNA repair protein	->->	740761	741059	299	41.8%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
272	AA01070	DNA repair protein	AA01071	RNA methyltransferase	->->	741744	741846	103	46.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
273	AA01075	hypothetical protein	AA01076	hypothetical protein	->->	746129	746304	176	37.5%	0	0	0	+: 1/0/0 \| -: 0/1/0	4	0	0	0	Result
274	AA01086	hypothetical protein	AA01087	DNA polymerase III, delta subunit	->->	751652	752008	357	26.3%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
275	AA01102	pyrimidine operon regulatory protein	AA01104	conserved hypothetical protein	->->	761154	761294	141	37.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
276	AA01104	conserved hypothetical protein	AA01106	conserved hypothetical protein	->->	761703	761814	112	40.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
277	AA01109	oxidoreductase (possible short-chain alcohol dehydrogenase)	AA01111	conserved hypothetical protein	->->	764786	764904	119	34.5%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
278	AA01113	transcriptional regulator (merR family)	AA01114	alcohol dehydrogenase, class III; glutathione-dependent formaldehyde dehydrogenase	->->	765310	765446	137	34.3%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
279	AA01114	alcohol dehydrogenase, class III; glutathione-dependent formaldehyde dehydrogenase	AA01115	carboxylesterase	->->	766569	766684	116	39.7%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
280	AA01115	carboxylesterase	AA01116	hypothetical protein	->->	767414	767768	355	42.3%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
281	AA01116	hypothetical protein	AA01117	signal recognition particle protein 54 (GTP-binding export factor)	->->	767901	768058	158	38%	0	0	0	+: 0/1/0 \| -: 0/3/0	1	0	0	0	Result
282	AA01123	possible hemolysin; membrane protein	AA01124	biopolymer transport protein	->->	771718	771894	177	29.4%	0	0	0	+: 1/2/0 \| -: 0/0/0	1	0	0	0	Result
283	AA01127	energy transducer protein	AA01128	hypothetical protein	->->	773581	774169	589	36%	0	0	1	+: 0/3/0 \| -: 0/2/0	1	0	0	0	Result
284	AA01128	hypothetical protein	AA01129	hypothetical protein	->->	774263	774752	490	36.1%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
286	AA01132	possible cell filamentation protein	AA01133	conserved hypothetical protein	->->	775968	776662	695	31.7%	0	0	3	+: 1/4/3 \| -: 1/3/0	2	0	0	0	Result
287	AA01134	conserved hypothetical protein	AA01135	possible cell filamentation protein	->->	777348	777520	173	27.2%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
288	AA01135	possible cell filamentation protein	AA01136	hypothetical protein	->->	777725	778424	700	36.7%	0	1	3	+: 2/5/6 \| -: 1/0/0	1	0	0	0	Result
289	AA01136	hypothetical protein	AA01137	anaerobic dimethyl sulfoxide reductase, chain A	->->	778563	778699	137	33.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
290	AA01146	conserved hypothetical protein	AA01147	nucleotidyltransferase	->->	784831	784999	169	36.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
291	AA01149	glycyl-tRNA synthetase beta subunit	AA01151	porphobilinogen synthase (delta-aminolevulinic acid dehydratase)	->->	788246	788462	217	39.2%	0	0	0	+: 0/3/0 \| -: 0/2/0	1	0	0	0	Result
292	AA01154	sec-independent protein translocase protein	AA01155	hypothetical protein	->->	791194	791366	173	38.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
293	AA01155	hypothetical protein	AA01156	chaperonin heat shock protein 33 homolog	->->	791472	791598	127	43.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
294	AA01162	conserved hypothetical protein (possible transmembrane protein)	AA01164	conserved hypothetical protein (possible integral membrane protein)	->->	795837	796129	293	28.3%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
295	AA01167	glucose-6-phosphate 1-dehydrogenase	AA01168	6-phosphogluconolactonase	->->	801128	801382	255	50.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	4	0	0	0	Result
296	AA01169	hypothetical protein	AA01170	hypothetical protein	->->	802290	802603	314	34.4%	0	0	2	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
297	AA01170	hypothetical protein	AA01171	LysA activator protein	->->	802700	802950	251	32.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
298	AA01173	VapD-homolog	AA01174	hypothetical protein	->->	804446	804839	394	44.9%	0	0	0	+: 0/0/0 \| -: 0/1/0	5	0	0	0	Result
299	AA01176	hypothetical protein	AA01177	beta-ketoacyl-ACP synthase IV	->->	806578	806871	294	31%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
300	AA01199	conserved hypothetical protein	AA01201	phosphatase; hydrolase	->->	822547	822652	106	41.5%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
302	AA01212	hypothetical protein	AA01213	competence related protein	->->	829874	830006	133	31.6%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
303	AA01215	aspartate-semialdehyde dehydrogenase	AA01216	conserved hypothetical protein	->->	831774	831959	186	32.3%	0	0	0	+: 0/0/0 \| -: 1/2/0	1	0	0	0	Result
304	AA01220	competence protein F; amidophosphoribosyltransferase	AA01221	transformation locus protein orfG homolog	->->	833599	833717	119	34.5%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
305	AA01222	hypothetical protein	AA01223	branched-chain amino acid carrier protein	->->	834447	834801	355	38.3%	0	1	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
306	AA01223	branched-chain amino acid carrier protein	AA01224	CTP synthase	->->	836215	836360	146	37.7%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
309	AA01227	hypothetical protein	AA01228	50S ribosomal protein L14	->->	838906	839036	131	45.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	2	28	131	Result	taggttcgtcccgcaagggtggttttttaatttaacggagcactaatatgatccaagaacagactatgctggatgttgctgataactcaggggctcgtagcgta
310	AA01238	50S ribosomal protein L36	AA01239	30S ribosomal protein S13	->->	844499	844642	144	35.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	5	5	119	Result	tgatatttttcttgcaaagaacaggttgggtagatatactgcctagctcatttatttccttgacactctgtttgagtatcctgaaaacgggcttttcaagatcagagtgtcaact
313	AA01250	nadAB transcriptional regulator	AA01251	hypothetical protein	->->	851841	851964	124	37.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
314	AA01251	hypothetical protein	AA01252	conserved hypothetical protein (probable SirA homolog)	->->	852055	852162	108	32.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
322	AA01263	hypothetical protein	AA01264	conserved hypothetical protein	->->	861147	862002	856	33.9%	0	0	9	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
323	AA01271	hypothetical protein	AA01272	hypothetical protein	->->	864042	864178	137	37.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
324	AA01272	hypothetical protein	AA01273	hypothetical protein	->->	864272	864501	230	41.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
325	AA01276	heptosyltransferase III	AA01277	aspartate ammonia-lyase	->->	865905	866088	184	38.6%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
327	AA01280	groES chaperonin	AA01284	heat shock protein (hsp60)	->->	868591	868713	123	39.8%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
329	AA01288	hypothetical protein	AA01289	hypothetical protein	->->	872349	872524	176	37.5%	0	0	0	+: 0/1/0 \| -: 1/0/0	4	0	0	0	Result
330	AA01292	single-stranded DNA binding protein	AA01294	DNA adenine methylase	->->	876444	876554	111	34.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
331	AA01296	shikimate kinase (shikimic acid kinase I)	AA01297	competence protein E precursor	->->	879013	879264	252	32.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
332	AA01303	competence protein A	AA01304	penicillin-binding protein 1A	->->	882943	883075	133	29.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
333	AA01306	glutathione reductase	AA01308	cyclic AMP receptor protein	->->	888046	888183	138	34.8%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
334	AA01317	probable DNA repair protein	AA01318	hypothetical protein	->->	891800	892221	422	35.8%	0	0	0	+: 0/4/0 \| -: 0/4/0	1	0	0	0	Result
335	AA01318	hypothetical protein	AA01319	transcriptional regulatory protein	->->	892474	892591	118	33.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
336	AA01320	hypothetical protein	AA01321	DNA repair protein	->->	893600	893713	114	33.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
337	AA01321	DNA repair protein	AA01323	50S ribosomal protein L28	->->	894176	894386	211	36%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	5	55	211	Result	atttaggcttgagaatacaagataaagtgagtataatgcacgacctttaatatagtacgcgggtcgggttgcgacctgacgaggtcactctcaaaagttatttttgaagtattccgaaccgtaagctcgagcttatatttcattattggagattaat
338	AA01331	50S ribosomal protein L31	AA01332	galactosyltransferase II	->->	898782	899014	233	41.2%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
339	AA01334	HtrL protein involved in lipopolysaccharide biosynthesis (ADP-L-glycero-D-mannoheptose-6-epimerase)	AA01335	primosomal protein N'	->->	901747	902132	386	44.3%	0	1	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
340	AA01341	acriflavine resistance protein	AA01342	conserved hypotheticl protein (possible ribosomal RNA adenine dimethylase)	->->	910192	910347	156	36.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
341	AA01342	conserved hypotheticl protein (possible ribosomal RNA adenine dimethylase)	AA01344	magnesium and cobalt transport protein	->->	911146	911800	655	42%	0	0	0	+: 1/6/2 \| -: 1/1/0	1	0	0	0	Result
342	AA01351	probable sulfatase	AA01354	conserved hypothetical protein	->->	916454	916628	175	40%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
343	AA01355	large subunit pseudouridylate synthase D	AA01356	lipooligosaccharide galactosyltransferase II (comL related)	->->	918340	918445	106	29.2%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
344	AA01357	5-formyltetrahydrofolate cyclo-ligase-family protein	AA01358	conserved hypothetical protein	->->	919846	920141	296	41.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	1	47	215	Result	gtccttgaaccctacggttcaagggaattagttgaaatcatttttaggcttcttagtcgagctaagcctgcacaccaatgacaggaaaccaattcataagattaaaagtatcggctcagggacgtaacccactggcgaacacctcaggaaattcttttacttaatacta
345	AA01358	conserved hypothetical protein	AA01359	conserved hypothetical protein	->->	920448	920623	176	41.5%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
346	AA01360	XAA-pro aminopeptidase (X-pro aminopeptidase)	AA01363	hypothetical protein	->->	922486	922644	159	35.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
347	AA01368	50S ribosomal protein L19	AA01369	rod shape-determining protein	->->	924973	925087	115	32.2%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
348	AA01371	rod shape-determining protein	AA01372	ribonuclease r, virulence associated protein	->->	927772	928020	249	33.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
349	AA01378	glycerol-3-phosphatase transporter	AA01379	glycerophosphoryl diester phosphodiesterase (protein D)	->->	932933	933168	236	47.5%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
350	AA01390	LexA repressor	AA01391	glycerol-3-phosphate acyltransferase	->->	937820	938026	207	30%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
352	AA01394	transcriptional regulator (mtr efflux pump)	AA01395	conserved hypothetical protein	->->	943272	943458	187	32.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
353	AA01395	conserved hypothetical protein	AA01396	saccharide biosynthesis regulatory protein	->->	943798	943899	102	37.3%	0	0	0	+: 0/0/0 \| -: 0/4/0	1	0	0	0	Result
354	AA01402	beta 1-4 glucosyltransferase	AA01404	hypothetical protein	->->	948443	948717	275	38.5%	0	0	1	+: 0/1/0 \| -: 0/1/0	3	0	0	0	Result
355	AA01404	hypothetical protein	AA01407	outer membrane antigenic lipoprotein b precursor	->->	948895	949144	250	40.8%	0	0	0	+: 0/2/0 \| -: 0/1/0	2	0	0	0	Result
356	AA01418	conserved hypothetical protein	AA01419	D-ribulose-phosphate-3 epimerase	->->	954367	954517	151	39.7%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
357	AA01421	phosphoglycolate phosphatase	AA01422	cell division protein E, ABC system ATP-binding protein	->->	955867	956148	282	47.5%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
358	AA01423	cell division protein X, ABC system permease	AA01424	threonine deaminase (dehydratase)	->->	957741	957879	139	44.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
359	AA01426	threonine deaminase (dehydratase)	AA01428	acetolactate synthase	->->	958716	958827	112	50%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
360	AA01429	conserved hypothetical protein	AA01431	conserved hypothetical protein (possible hydrolase)	->->	959853	959995	143	25.9%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
362	AA01441	tRNA/rRNA methylase	AA01442	phosphatidylserine synthetase	->->	967704	967888	185	33%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
364	AA01445	hypothetical protein	AA01446	conserved hypothetical protein	->->	970168	970290	123	42.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
367	AA01453	D-xylose isomerase	AA01455	D-xylose ABC transporter, periplasmic-binding protein	->->	974914	975170	257	37%	0	0	0	+: 1/1/0 \| -: 0/0/0	1	0	0	0	Result
368	AA01464	hypothetical protein	AA01465	mannose-specific phosphotransferase element	->->	984464	984611	148	33.1%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
369	AA01467	mannose-specific phosphotransferase system IID	AA01471	type I restriction enzyme M (modification chain)	->->	987275	987460	186	39.8%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
370	AA01473	type I restriction-modification system S (specificity subunit)	AA01474	hypothetical protein	->->	990293	990398	106	35.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
371	AA01477	type I restriction enzyme R protein	AA01478	hypothetical protein	->->	994540	994690	151	30.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
372	AA01491	conserved hypothetical protein	AA01492	glucose inhibited division protein B	->->	1002832	1002945	114	27.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
373	AA01494	conserved hypothetical protein	AA01495	probable oxidoreductase	->->	1003982	1004231	250	29.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
374	AA01495	probable oxidoreductase	AA01496	glucose inhibited division protein A	->->	1004988	1005264	277	39%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
375	AA01496	glucose inhibited division protein A	AA01497	MioC protein	->->	1007152	1007596	445	30.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
376	AA01498	conserved hypothetical protein	AA01499	fructose 1,6-bisphosphatase protein	->->	1008313	1008496	184	25.5%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
377	AA01499	fructose 1,6-bisphosphatase protein	AA01500	hypothetical protein	->->	1009508	1009855	348	33.6%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
378	AA01507	conserved hypothetical protein	AA01508	anaerobic C4-dicarboxylate transporter	->->	1013071	1013337	267	26.2%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
379	AA01508	anaerobic C4-dicarboxylate transporter	AA01509	ABC system transport protein, ATP binding/permease	->->	1014658	1014831	174	27.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
380	AA01510	ABC transporter, ATP-binding protein/permease	AA01511	probable transcriptional regulator	->->	1018226	1018342	117	31.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
381	AA01513	hydrogen peroxide-inducible activator	AA01514	peroxiredoxin 2 family protein/glutaredoxin	->->	1019872	1020029	158	27.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
382	AA01528	probable oxidoreductase	AA01530	conserved hypothetical protein	->->	1027321	1027447	127	38.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
383	AA01534	conserved hypothetical protein (possible GTP pyrophosphokinase)	AA01537	possible glucokinase regulatory protein	->->	1030639	1030755	117	38.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
384	AA01544	conserved hypothetical protein	AA01546	deoxyribose operon repressor	->->	1035494	1035633	140	35.7%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
385	AA01547	deoxyribose-phosphate aldolase	AA01549	hypothetical protein	->->	1037080	1037583	504	37.5%	0	0	1	+: 0/2/0 \| -: 0/0/0	3	0	0	0	Result
386	AA01549	hypothetical protein	AA01550	hypothetical protein	->->	1037941	1038175	235	31.5%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
387	AA01551	hypothetical protein	AA01552	hypothetical protein	->->	1038435	1039132	698	43.3%	0	0	2	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
389	AA01556	ABC transporter ATP-binding protein	AA01557	recombinase A	->->	1044820	1045050	231	35.1%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
390	AA01563	transketolase isozyme 1	AA01564	transaldolase B	->->	1049104	1049238	135	36.3%	0	0	0	+: 0/0/0 \| -: 1/1/1	1	0	0	0	Result
398	AA01573	peptide transport periplasmic protein	AA01575	conserved hypothetical protein	->->	1061515	1061803	289	36%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
399	AA01584	host factor-I protein	AA01585	tRNA delta(2)-isopentenylpyrophosphate	->->	1066026	1066146	121	32.2%	0	0	0	+: 0/0/0 \| -: 1/2/0	1	0	0	0	Result
403	AA01598	conserved hypothetical protein	AA01599	phosphocarrier protein HPr	->->	1080027	1080249	223	24.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
404	AA01599	phosphocarrier protein HPr	AA01600	phosphotransferase system enzyme I	->->	1080505	1080620	116	32.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
405	AA01601	PTS system, glucose-specific IIA componen	AA01603	oligopeptidase A	->->	1082907	1083037	131	36.6%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
406	AA01603	oligopeptidase A	AA01604	conserved hypothetical protein	->->	1085075	1085185	111	25.2%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
407	AA01607	oligopeptide transporter, periplasmic-binding protein	AA01608	conserved hypothetical protein	->->	1087173	1087452	280	31.1%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
408	AA01611	anthranilate synthase component II	AA01614	D-isomer specific 2-hydroxyacid dehydrogenase family protein	->->	1089680	1089837	158	39.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
409	AA01614	D-isomer specific 2-hydroxyacid dehydrogenase family protein	AA01615	lipoprotein releasing system transmembrane	->->	1090780	1091325	546	37.2%	0	0	0	+: 1/1/0 \| -: 0/2/0	1	0	0	0	Result
410	AA01618	lipoprotein releasing system transmembrane protein	AA01619	phospho-2-dehydro-3-deoxyheptonate aldolase (DAHP synthase)	->->	1094459	1094561	103	29.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
411	AA01624	glucose-6-phosphate isomerase	AA01625	riboflavin synthase, beta chain	->->	1099962	1100103	142	36.6%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
412	AA01631	dihydrodipicolinate reductase	AA01633	probable ferredoxin-like protein	->->	1103976	1104147	172	39.5%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
413	AA01635	ribonucleoside diphosphate reductase, beta chain	AA01636	conserved hypothetical protein	->->	1105883	1106086	204	30.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
414	AA01637	ribonucleoside diphosphate reductase	AA01639	hypothetical protein	->->	1109065	1109275	211	25.1%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
415	AA01654	periplasmic maltose-binding protein precursor	AA01655	hypothetical protein	->->	1121224	1121326	103	47.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
416	AA01655	hypothetical protein	AA01656	maltose/maltodextrin transport ATP-binding protein	->->	1121447	1121679	233	28.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
417	AA01660	hypothetical protein	AA01661	molybdopterin biosynthesis protein	->->	1125343	1125523	181	40.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
418	AA01662	molybdopterin biosynthesis protein	AA01663	GTP cyclohydrolase I	->->	1127483	1127610	128	31.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
419	AA01663	GTP cyclohydrolase I	AA01666	penicillin-binding protein 4; D-alanyl-D-alanine carboxypeptidase; D-alanyl-D-alanine-endopeptidase	->->	1128265	1128370	106	34.9%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
420	AA01666	penicillin-binding protein 4; D-alanyl-D-alanine carboxypeptidase; D-alanyl-D-alanine-endopeptidase	AA01668	transcription elongation factor	->->	1129682	1129969	288	41.3%	0	0	0	+: 1/1/0 \| -: 0/1/0	1	0	0	0	Result
421	AA01670	conserved hypothetical protein	AA01671	conserved hypothetical protein	->->	1130822	1130988	167	28.7%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
422	AA01675	probable multidrug resistance protein; multidrug-efflux transporter	AA01678	possible transcriptional regulator	->->	1133650	1133958	309	35%	0	0	0	+: 0/0/0 \| -: 0/0/0	2	0	0	0	Result
423	AA01689	conserved hypothetical protein (possible inner membrane protein)	AA01690	penicillin-binding protein 1C	->->	1146726	1146847	122	25.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
424	AA01690	penicillin-binding protein 1C	AA01692	hexulose-6-phosphate synthase	->->	1149203	1149317	115	37.4%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
425	AA01695	carbohydrate transport protein	AA01696	conserved hypothetical protein	->->	1152355	1152701	347	23.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
426	AA01704	tyrosine-specific transport protein	AA01705	beta-galactosidase	->->	1157522	1157782	261	35.2%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
427	AA01705	beta-galactosidase	AA01708	glutaredoxin	->->	1158041	1158275	235	39.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
428	AA01715	conserved hypothetical protein	AA01717	fumarate hydratase, class II	->->	1161223	1161328	106	32.1%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
429	AA01717	fumarate hydratase, class II	AA01718	DNA polymerase III, chi subunit	->->	1162721	1162929	209	34.4%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
430	AA01722	conserved hypothetical protein	AA01723	conserved hypothetical protein	->->	1163700	1163908	209	22.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
431	AA01723	conserved hypothetical protein	AA01724	valyl-tRNA synthetase	->->	1164335	1164585	251	44.2%	0	1	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
432	AA01730	conserved hypothetical protein (possible transcriptional regulator)	AA01731	multidrug resistance protein B	->->	1169144	1169289	146	24.7%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
433	AA01733	hypothetical protein	AA01734	DNA-binding protein; DPS family protein	->->	1172052	1172182	131	28.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
434	AA01739	conserved hypothetical protein	AA01740	conserved hypothetical protein	->->	1176573	1176697	125	32.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
435	AA01741	6-pyruvoyl tetrahydrobiopterin synthase	AA01743	lysyl-tRNA synthetase	->->	1177756	1177947	192	34.9%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
436	AA01743	lysyl-tRNA synthetase	AA01744	peptide chain release factor RF-2	->->	1179412	1179512	101	31.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
438	AA01750	MTA/SAH nucleosidase [Includes: 5'-methylthioadenosine nucleosidase; S-adenosylhomocysteine nucleosidase]	AA01751	conserved hypothetical protein	->->	1184580	1184759	180	36.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
440	AA01763	conserved hypothetical protein (possible transcriptional regulatory protein)	AA01764	hypothetical protein	->->	1190879	1191665	787	32.3%	0	0	1	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
442	AA01770	hypothetical protein	AA01772	shikimate 5-dehydrogenase protein	->->	1193458	1194189	732	30.9%	0	0	0	+: 0/2/0 \| -: 1/1/0	1	0	0	0	Result
443	AA01774	5,10-methylenetetrahydrofolate reductase	AA01775	hypothetical protein	->->	1196037	1196140	104	28.8%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
444	AA01777	conserved hypothetical protein	AA01778	aminopeptidase A/I; cytosol aminopeptidase; leucyl aminopeptidase	->->	1198402	1198537	136	27.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
445	AA01778	aminopeptidase A/I; cytosol aminopeptidase; leucyl aminopeptidase	AA01779	molybdenum ABC transporter, ATP-binding protein	->->	1200026	1200175	150	38.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
446	AA01781	molybdenum ABC transporter, periplasmic substrate-binding	AA01782	molybdenum transport protein; transcriptional regulator	->->	1202793	1203018	226	32.7%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
447	AA01782	molybdenum transport protein; transcriptional regulator	AA01784	sodium-dependent transporter	->->	1203796	1203964	169	33.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
449	AA01794	glycine cleavage system transcription activator	AA01796	branched-chain amino acid aminotransferase	->->	1210751	1211211	461	31.2%	0	0	0	+: 1/1/0 \| -: 0/0/0	1	0	0	0	Result
450	AA01798	hypothetical protein	AA01799	polysacharide biosynthesis protein (Orf14 of cluster)	->->	1212396	1212598	203	25.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
452	AA01804	sugar nucleotide epimerase; cell division inhibitor	AA01805	electron transport complex protein	->->	1216062	1216254	193	36.3%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
453	AA01813	electron transport complex protein	AA01814	endonuclease III	->->	1221872	1222020	149	29.5%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
454	AA01816	hypothetical protein	AA01817	hypothetical protein	->->	1224195	1224364	170	37.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
455	AA01818	high-affinity zinc uptake system membrane protein	AA01820	high-affinity zinc uptake system ATP-binding protein	->->	1225139	1225242	104	46.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
456	AA01820	high-affinity zinc uptake system ATP-binding protein	AA01822	lysostaphin precursor	->->	1226014	1226201	188	27.1%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
457	AA01832	formate dehydrogenase formation protein E	AA01834	hypothetical protein	->->	1234664	1234779	116	36.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
458	AA01835	conserved hypothetical protein	AA01837	transcriptional regulatory protein	->->	1235450	1235589	140	37.1%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
459	AA01841	conserved hypothetical protein	AA01842	conserved hypothetical protein	->->	1237924	1238410	487	37.4%	0	0	1	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
460	AA01845	gamma-glutamyltranspeptidase precursor	AA01846	conserved hypothetical protein	->->	1241748	1241982	235	31.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
461	AA01846	conserved hypothetical protein	AA01848	argininosuccinate synthetase	->->	1242226	1242417	192	38.5%	0	0	0	+: 0/0/0 \| -: 1/1/1	1	0	0	0	Result
462	AA01850	conserved hypothetical protein; possible enzyme of sugar metabolism	AA01851	hypothetical protein	->->	1244675	1244862	188	31.9%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
463	AA01857	glutamate-ammonia-ligase adenylyltransferase	AA01858	conserved hypothetical protein	->->	1250418	1250838	421	42.8%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
464	AA01858	conserved hypothetical protein	AA01859	hypothetical protein	->->	1251598	1251857	260	39.6%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
465	AA01868	biotin synthetase	AA01869	periplasmic serine protease do; hhoA-like precursor; heat shock protein	->->	1256687	1256789	103	40.8%	0	0	0	+: 0/3/0 \| -: 0/0/0	1	0	0	0	Result
466	AA01869	periplasmic serine protease do; hhoA-like precursor; heat shock protein	AA01871	conserved hypothetical protein	->->	1258170	1258362	193	32.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
467	AA01871	conserved hypothetical protein	AA01872	conserved hypothetical protein	->->	1258771	1258943	173	30.6%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
468	AA01873	mannose-6-phosphate isomerase	AA01874	conserved hypothetical protein	->->	1262001	1262175	175	39.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
469	AA01874	conserved hypothetical protein	AA01875	PTS system, glucose-specific enzyme II, A component	->->	1262512	1262702	191	28.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
470	AA01878	hydroxyacylglutathione hydrolase	AA01879	glutamyl-tRNA reductase	->->	1265670	1265856	187	33.7%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
473	AA01881	adenylate kinase	AA01883	recycling protein; permease	->->	1269826	1269960	135	37.8%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
474	AA01886	UDP-glucose-4-epimerase	AA01887	conserved hypothetical protein (possible cytochrome	->->	1272618	1272810	193	33.7%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
475	AA01893	acetyl-coenzyme-A carboxylase subunit A	AA01894	conserved hypothetical protein (possible transthyretin-like periplasmic protein)	->->	1277933	1279106	1174	31.8%	0	0	6	+: 1/0/0 \| -: 0/3/0	1	0	0	0	Result
476	AA01894	conserved hypothetical protein (possible transthyretin-like periplasmic protein)	AA01895	hypothetical protein	->->	1279518	1279713	196	32.7%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
477	AA01895	hypothetical protein	AA01896	hypothetical protein	->->	1280662	1281100	439	31.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
480	AA01902	conserved hypothetical protein	AA01903	hypothetical protein	->->	1283677	1284122	446	41%	0	0	0	+: 0/2/0 \| -: 1/4/0	1	0	0	0	Result
481	AA01903	hypothetical protein	AA01904	hypothetical protein	->->	1284276	1284587	312	40.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	1	179	308	Result	caaattgtctaaaattcaaaacaggttactgatgagtgcctttctttatgcttgtaaggctcaagccctcttgtatgcgactacagcgaggaatataatgctctctgcgactacaatttaatcagaggaa
482	AA01904	hypothetical protein	AA01905	hypothetical protein	->->	1285110	1285445	336	30.7%	0	0	0	+: 0/0/0 \| -: 1/2/1	1	0	0	0	Result
483	AA01906	repressor protein CI	AA01908	conserved hypothetical protein	->->	1287108	1287207	100	24%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
484	AA01909	hypothetical protein	AA01911	hypothetical protein	->->	1287807	1287930	124	34.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
485	AA01911	hypothetical protein	AA01913	GMP synthase	->->	1288345	1288674	330	33.3%	0	0	33	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
488	AA01922	translation initiation factor IF2	AA01923	type III restriction-modification system methylation subunit	->->	1297340	1297626	287	34.5%	0	0	4	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
489	AA01923	type III restriction-modification system methylation subunit	AA01925	conserved hypothetical protein	->->	1299997	1300100	104	45.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
490	AA01928	ATP-dependent RNA helicase	AA01930	ribosome-binding factor A	->->	1304748	1304851	104	33.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
491	AA01934	conserved hypothetical protein	AA01936	tyrosyl-tRNA synthetase	->->	1307054	1307182	129	44.2%	0	0	0	+: 0/3/0 \| -: 0/0/0	1	0	0	0	Result
492	AA01936	tyrosyl-tRNA synthetase	AA01937	sugar fermentation stimulation protein	->->	1308368	1308617	250	32.8%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
493	AA01937	sugar fermentation stimulation protein	AA01938	NAD(P) transhydrogenase subunit alpha	->->	1309395	1309632	238	29.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
494	AA01943	conserved hypothetical protein	AA01944	conserved hypothetical protein	->->	1313149	1313615	467	30.2%	0	0	1	+: 0/0/0 \| -: 1/1/1	1	0	0	0	Result
495	AA01944	conserved hypothetical protein	AA01945	selenophosphate synthase	->->	1314462	1315005	544	31.4%	0	0	0	+: 1/1/1 \| -: 0/0/0	1	0	0	0	Result
496	AA01945	selenophosphate synthase	AA01947	iron(III)-transport ATP-binding protein	->->	1316083	1316529	447	39.6%	0	18	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
497	AA01953	hypothetical protein	AA01954	excinuclease ABC, subunit C	->->	1320410	1320607	198	39.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
498	AA01954	excinuclease ABC, subunit C	AA01956	3-deoxy-manno-octulosonate cytidylyltransferase	->->	1322375	1322575	201	35.8%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
499	AA01962	recombination protein rec2	AA01963	dnaK suppressor protein	->->	1328767	1329063	297	34.3%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
500	AA01963	dnaK suppressor protein	AA01965	poly(A) polymerase	->->	1329499	1329617	119	27.7%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
501	AA01969	hypothetical protein	AA01972	phosphotransacetylase	->->	1332226	1332358	133	27.1%	0	0	0	+: 0/2/0 \| -: 0/2/0	1	0	0	0	Result
502	AA01973	acetate kinase	AA01974	conserved hypothetical protein	->->	1335794	1336030	237	36.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
503	AA01974	conserved hypothetical protein	AA01976	colicin V production protein	->->	1336472	1336652	181	32.6%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
504	AA01981	4-alpha-glucanotransferase	AA01982	maltodextrin phosphorylase	->->	1339415	1339526	112	44.6%	0	0	0	+: 0/3/0 \| -: 0/0/0	1	0	0	0	Result
505	AA01982	maltodextrin phosphorylase	AA01983	maltose regulon positive regulatory protein	->->	1341915	1342086	172	33.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
506	AA01983	maltose regulon positive regulatory protein	AA01984	tellurite resistance protein; hemagglutinin homolog	->->	1344799	1344956	158	34.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
507	AA01984	tellurite resistance protein; hemagglutinin homolog	AA01985	pyruvate dehydrogenase, E1 component	->->	1345815	1346206	392	26.5%	0	0	0	+: 1/1/1 \| -: 1/0/0	1	0	0	0	Result
508	AA01988	dihydrolipoamide dehydrogenase; lipoamide dehydrogenase	AA01989	hypothetical protein	->->	1352079	1352178	100	27%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
509	AA01989	hypothetical protein	AA01991	conserved hypothetical protein (possible nitroreductase)	->->	1352302	1352511	210	37.1%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
510	AA01991	conserved hypothetical protein (possible nitroreductase)	AA01992	protease IV; signal peptide peptidase; Endopeptidase IV	->->	1353064	1353168	105	36.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
511	AA02000	2,3,4,5-tetrahydropyridine-2-carboxylate	AA02001	conserved hypothetical protein	->->	1359862	1359981	120	29.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
512	AA02002	hypothetical protein	AA02003	purine nucleotide synthesis repressor protein	->->	1360468	1360772	305	34.4%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
513	AA02003	purine nucleotide synthesis repressor protein	AA02004	homoserine O-acetyltransferase	->->	1361769	1362076	308	35.1%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
514	AA02004	homoserine O-acetyltransferase	AA02005	vancomycin sensitivity; SanA protein	->->	1363178	1363282	105	41.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
515	AA02006	PEP--fructosephosphotransferase system repressor, DeoR family	AA02007	hypothetical protein	->->	1365054	1365887	834	28.4%	0	0	5	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
516	AA02008	conserved hypothetical protein	AA02010	peptide methionine sulfoxide reductase; cytochrome C-TYPE biogenesis protein; transcriptional regulator	->->	1366535	1367319	785	29.6%	0	0	7	+: 0/2/0 \| -: 2/2/0	1	0	0	0	Result
517	AA02012	peptide methionine sulfoxide reductase	AA02013	carbonic anhydrase	->->	1369530	1369744	215	28.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
518	AA02013	carbonic anhydrase	AA02014	probable hemolysin	->->	1370435	1370545	111	37.8%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
519	AA02014	probable hemolysin	AA02015	phosphoheptose isomerase	->->	1371038	1371198	161	46%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
520	AA02020	conserved hypothetical protein (possible tetrapyrrole methylase family protein)	AA02021	anaerobic glycerol-3-phosphate dehydrogenase	->->	1374803	1375074	272	34.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
521	AA02023	NADH dehydrogenase	AA02024	acyl carrier protein phosphodiesterase	->->	1378176	1378283	108	26.9%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
522	AA02025	hypothetical protein	AA02026	probable serine proteinase	->->	1378912	1379063	152	27.6%	0	0	0	+: 0/0/0 \| -: 0/3/0	1	0	0	0	Result
524	AA02030	threonyl-tRNA synthetase	AA02031	type III site-specific deoxyribonuclease	->->	1384240	1384477	238	31.9%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
525	AA02034	ferredoxin NADP+ reductase	AA02035	translation initiation factor IF-3	->->	1386115	1386488	374	30.7%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
528	AA02062	conserved hypothetical protein (probable membrane protein)	AA02063	23S rRNA psedouridine synthase, Rlu family protein	->->	1404473	1404590	118	42.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
529	AA02071	conserved hypothetical protein	AA02072	conserved hypothetical protein	->->	1408342	1408740	399	30.1%	0	0	3	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
530	AA02072	conserved hypothetical protein	AA02074	hypothetical protein	->->	1409164	1409479	316	30.7%	0	0	0	+: 0/0/0 \| -: 0/3/0	1	0	0	0	Result
531	AA02076	conserved hypothetical protein	AA02077	probable outer membrane protein	->->	1411155	1411433	279	41.9%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
532	AA02081	periplasmic protein	AA02082	glutaminyl-tRNA synthetase	->->	1416020	1416240	221	32.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
533	AA02084	conserved hypothetical protein	AA02086	4-alpha-glucanotransferase	->->	1418415	1418516	102	27.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
535	AA02092	glycogen synthase	AA02094	glycogen phosphorylase; glycogen synthase	->->	1426251	1426375	125	24.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
536	AA02097	DedA-family integral membrane protein	AA02099	50S ribosomal protein L25	->->	1429566	1429778	213	30%	0	0	0	+: 1/1/0 \| -: 0/0/0	1	0	0	0	Result
537	AA02099	50S ribosomal protein L25	AA02100	lipoprotein	->->	1430064	1430213	150	32%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
538	AA02100	lipoprotein	AA02101	penicillin-binding protein 7	->->	1430820	1430969	150	36.7%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
539	AA02103	D-alanyl-D-alanine-endopeptidase; penicillin-binding protein 7	AA02105	killing protein	->->	1431845	1432024	180	32.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
540	AA02115	hypothetical protein	AA02116	hypothetical protein	->->	1445052	1445227	176	37.5%	0	0	0	+: 1/0/0 \| -: 0/1/0	4	0	0	0	Result
541	AA02118	hypothetical protein	AA02119	hypothetical protein	->->	1446000	1446511	512	36.3%	0	0	6	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
542	AA02119	hypothetical protein	AA02120	nonheme ferritin	->->	1446641	1447320	680	27.8%	0	0	0	+: 2/0/0 \| -: 0/0/0	1	1	133	239	Result	ttaactagtaatagtgacctttgaataactctgtgttttcattaaatcgtagtgttcatttactttgtcactaatttcgcataacatatattatgttaaataaaata
543	AA02123	hypothetical protein	AA02124	anaerobic regulatory protein; transcription regulator Fnr	->->	1448552	1448659	108	25.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
544	AA02124	anaerobic regulatory protein; transcription regulator Fnr	AA02125	conserved hypothetical protein; possible universal stress protein	->->	1449431	1449551	121	33.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
545	AA02125	conserved hypothetical protein; possible universal stress protein	AA02126	conserved hypothetical protein	->->	1450482	1450610	129	27.1%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
546	AA02135	hypothetical protein	AA02136	aspartate aminotransferase	->->	1459128	1459348	221	36.7%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
547	AA02137	transcriptional regulators (TetR/AcrR family)	AA02139	possible membrane protein	->->	1461154	1461300	147	38.8%	0	0	0	+: 1/2/0 \| -: 0/0/0	1	0	0	0	Result
550	AA02160	conserved hypothetical protein	AA02162	lipoprotein	->->	1478990	1479089	100	35%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
551	AA02166	phenylalanyl-tRNA synthetase, alpha subunit	AA02167	hypothetical protein	->->	1483327	1483426	100	29%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
552	AA02167	hypothetical protein	AA02168	possible protease; heat shock protein	->->	1483535	1483668	134	31.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
553	AA02169	hypothetical protein	AA02171	polysialic acid capsule expression protein	->->	1484725	1485223	499	53.9%	0	0	13	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
554	AA02172	conserved hypothetical protein	AA02173	anthranilate synthase component I	->->	1486711	1486880	170	34.7%	0	0	0	+: 1/1/0 \| -: 0/1/0	1	0	0	0	Result
555	AA02184	anthranilate isomerase; indole-3-glycerol phosphate synthase; phosphoribosylanthranilate isomerase	AA02187	hypothetical protein	->->	1492602	1492742	141	38.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
556	AA02190	hydrogenase-2 component protein	AA02191	hypothetical protein	->->	1493332	1493457	126	23.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
557	AA02191	hypothetical protein	AA02193	oxaloacetate decarboxylase gamma chain	->->	1493833	1494358	526	35%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
558	AA02199	hypothetical protein	AA02201	transferrin-binding protein 1 precursor	->->	1497962	1498161	200	33.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
560	AA02202	transferrin-binding protein 1 precursor	AA02204	hypothetical protein	->->	1500604	1501112	509	34%	0	0	9	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
561	AA02208	tryptophan synthase, alpha subunit	AA02210	ribonucleoside-diphosphate reductase alpha chain	->->	1504057	1504333	277	31.8%	0	0	0	+: 2/1/1 \| -: 0/0/0	1	0	0	0	Result
562	AA02210	ribonucleoside-diphosphate reductase alpha chain	AA02212	ribonucleoside-diphosphate reductase beta chain	->->	1506017	1506151	135	42.2%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
563	AA02213	hypothetical protein	AA02214	pyruvate kinase II	->->	1507226	1507387	162	36.4%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
564	AA02214	pyruvate kinase II	AA02215	conserved hypothetical protein	->->	1508831	1508939	109	33%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
565	AA02226	ABC transporter ATP-binding protein	AA02228	regulatory protein, sorC family	->->	1514867	1515120	254	25.2%	0	0	0	+: 1/0/0 \| -: 1/1/0	1	0	0	0	Result
566	AA02230	sugar kinase	AA02231	probable dethiobiotin synthetase 1	->->	1517678	1517789	112	41.1%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
567	AA02232	NagC-like transcriptional regulator	AA02233	asparaginyl-tRNA synthetase	->->	1519822	1520016	195	24.1%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
568	AA02236	stringent starvation protein A	AA02237	molybdopterin biosynthesis protein E chain	->->	1522698	1522899	202	37.6%	0	0	0	+: 0/1/0 \| -: 0/3/0	1	0	0	0	Result
569	AA02242	molybdenum cofactor biosynthesis protein A	AA02243	conserved hypothetical protein	->->	1525149	1525505	357	26.3%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
570	AA02244	conserved hypothetical protein (probable DNA-binding protein; death-on-curing family protein0	AA02245	hypothetical protein	->->	1527436	1527585	150	37.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
571	AA02249	thiamine biosynthesis protein	AA02250	possible cytochrome c-type protein	->->	1529960	1530264	305	26.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
572	AA02253	hypothetical protein	AA02254	2-oxoglutarate/malate translocator	->->	1534847	1534985	139	40.3%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
573	AA02254	2-oxoglutarate/malate translocator	AA02257	conserved hypothetical protein	->->	1536441	1536657	217	38.2%	0	0	0	+: 0/0/0 \| -: 1/2/0	1	0	0	0	Result
574	AA02260	pseudouridylate synthase I	AA02261	30S ribosomal protein S9	->->	1538023	1538152	130	39.2%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
575	AA02262	50S ribosomal protein L13	AA02263	conserved hypothetical protein	->->	1538988	1539231	244	35.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	1	1	147	Result	taattaattaccaatataataatattaatacccagtgcttaaaaaagcacaaccagttatcttaatcttcaccccttcgagtgcgatctcgacaaaataatacgcggtgggaatccgcagcattcacagggtcgcgcgattatacaa
577	AA02269	3-hydroxydecanoyl-(acyl-carrier protein) dehydratase	AA02270	endopeptidase La; lon protease; protease La homolog; ATP-dependent protease LA (lon-1)	->->	1546865	1547009	145	34.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
578	AA02280	conserved hypothetical protein	AA02281	phosphoglycerate transport system activator protein	->->	1552828	1552982	155	32.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
579	AA02285	phosphoglycerate transport regulatory protein	AA02286	sugar ABC transporter, ATP-binding protein	->->	1557345	1557717	373	29.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
580	AA02286	sugar ABC transporter, ATP-binding protein	AA02288	conserved hypothetical protein	->->	1558597	1558729	133	33.1%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
581	AA02289	cell division protein H, a metalloprotease	AA02290	cell division protein J; ribosomal RNA large subunit methyltransferase J	->->	1561280	1561421	142	25.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
582	AA02290	cell division protein J; ribosomal RNA large subunit methyltransferase J	AA02291	formyltetrahydrofolate deformylase	->->	1562049	1562185	137	33.6%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
583	AA02292	DNA-binding protein H-NS	AA02293	hypothetical protein	->->	1563458	1563670	213	26.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
584	AA02293	hypothetical protein	AA02294	conserved hypothetical protein	->->	1563770	1563897	128	34.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
591	AA02298	conserved hypothetical protein	AA02300	glutamate racemase	->->	1571061	1571487	427	37.5%	0	0	0	+: 1/1/1 \| -: 0/1/0	3	0	0	0	Result
592	AA02307	5'-guanylate kinase	AA02309	glyceraldehyde 3-phosphate dehydrogenase	->->	1578119	1578287	169	35.5%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
593	AA02323	conserved hypothetical protein	AA02324	ABC transporter ATP binding protein	->->	1586384	1586657	274	34.7%	0	0	0	+: 1/1/1 \| -: 0/1/0	1	0	0	0	Result
594	AA02330	UDP-N-acetylglucosamine enolpyruvyl transferase	AA02331	ABC transporter, ATP-binding protein; possible leukotoxin secretion ATP-binding protein	->->	1591342	1592094	753	29.5%	0	1	3	+: 2/0/0 \| -: 0/0/0	1	0	0	0	Result
595	AA02331	ABC transporter, ATP-binding protein; possible leukotoxin secretion ATP-binding protein	AA02332	conserved hypothetical protein; possible glycosyltransferase	->->	1593040	1593390	351	23.9%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
596	AA02332	conserved hypothetical protein; possible glycosyltransferase	AA02333	conserved hypothetical protein	->->	1594453	1594956	504	32.3%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
597	AA02333	conserved hypothetical protein	AA02334	outer membrane protein P1	->->	1595245	1595446	202	30.7%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
598	AA02340	hypothetical protein	AA02341	hypothetical protein	->->	1599402	1599585	184	37%	0	0	0	+: 1/0/0 \| -: 0/1/0	4	0	0	0	Result
600	AA02343	glutamine synthetase	AA02344	GTP-binding protein, elongation factor typA/bipA	->->	1601720	1602105	386	26.9%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
601	AA02348	bacterioferritin comigratory protein	AA02349	dihydrodipicolinate synthetase	->->	1607374	1607530	157	27.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
602	AA02349	dihydrodipicolinate synthetase	AA02350	possible lipoprotein	->->	1608422	1608537	116	35.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
604	AA02351	conserved hypothetical protein	AA02352	glycine betaine/carnitine/choline ABC transporter	->->	1609529	1609707	179	36.3%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
605	AA02352	glycine betaine/carnitine/choline ABC transporter	AA02353	spermidine / putrescine transport ATP-binding	->->	1611175	1611491	317	40.7%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
606	AA02355	nicotinamide phosphoribosyl transferase	AA02356	hypothetical protein	->->	1614474	1614587	114	27.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
607	AA02365	hflC protein	AA02366	hypothetical protein	->->	1623022	1623159	138	34.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
608	AA02371	oxygen-independent coproporphyrinogen III oxidase	AA02374	ribose 5-phosphate isomerase A	->->	1625878	1625978	101	35.6%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
609	AA02385	dicarboxylate-binding periplasmic protein	AA02386	hypothetical protein	->->	1634241	1634685	445	35.5%	0	0	68	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
614	AA02398	DNA primase	AA02399	30S ribosomal protein S21	->->	1650916	1651039	124	34.7%	0	0	0	+: 0/1/0 \| -: 1/1/0	1	0	0	0	Result
615	AA02407	thymidine kinase	AA02409	DNA ligase	->->	1653301	1653454	154	43.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
616	AA02409	DNA ligase	AA02410	cell division protein	->->	1655465	1655568	104	41.3%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
617	AA02410	cell division protein	AA02411	cysteine synthetase	->->	1656604	1656742	139	36.7%	0	0	0	+: 2/0/0 \| -: 0/0/0	1	0	0	0	Result
618	AA02411	cysteine synthetase	AA02412	cysteine synthetase	->->	1657565	1657667	103	31.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
619	AA02416	conserved hypothetical protein	AA02417	GTP-binding protein	->->	1659639	1659949	311	41.2%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
620	AA02417	GTP-binding protein	AA02418	peptidyl-tRNA hydrolase	->->	1661039	1661229	191	38.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
628	AA02423	undecaprenyl-phosphate alpha-N-acetylglucosaminyltransferase	AA02425	glutamate-1-semialdehyde aminotransferase	->->	1670313	1670440	128	32.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
629	AA02429	methionine aminopeptidase	AA02430	conserved hypothetical protein	->->	1675258	1675390	133	33.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
630	AA02433	hypothetical protein	AA02434	membrane protein	->->	1678536	1678686	151	32.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
631	AA02436	periplasmic protein	AA02437	integral membrane protein	->->	1681156	1681296	141	30.5%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
632	AA02443	cytochrome C related protein	AA02446	conserved hypothetical protein	->->	1686651	1686980	330	44.8%	0	0	0	+: 0/1/0 \| -: 0/3/0	1	0	0	0	Result
633	AA02451	conserved hypothetical protein	AA02453	conserved hypothetical protein	->->	1688987	1689086	100	47%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
634	AA02457	conserved hypothetical protein	AA02458	outer membrane protein 34	->->	1695835	1696130	296	35.8%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
635	AA02458	outer membrane protein 34	AA02459	conserved hypothetical protein	->->	1697169	1697607	439	28.9%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
636	AA02462	thiol peroxidase (scavengase)	AA02463	N-acetylglucosamine-6-phosphate deacetylase	->->	1702734	1702943	210	40%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
637	AA02465	glucosamine-6-phosphate isomerase	AA02466	N-acetylneuraminate lyase	->->	1704946	1705102	157	40.1%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
638	AA02472	conserved hypothetical protein	AA02473	conserved hypothetical protein	->->	1708470	1708710	241	29.5%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
639	AA02476	conserved hypothetical protein	AA02477	PTS system, N-acetylglucosamine-permease IIABC component	->->	1712878	1713128	251	37.1%	0	0	0	+: 1/1/1 \| -: 0/1/0	1	0	0	0	Result
640	AA02478	PTS system, N-acetylglucosamine-specific enzyme IIABC	AA02479	outer membrane protein 34	->->	1714593	1715273	681	34.1%	0	72	0	+: 1/1/0 \| -: 0/2/0	1	0	0	0	Result
641	AA02479	outer membrane protein 34	AA02480	excinuclease ABC subunit B	->->	1716342	1716570	229	22.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
644	AA02481	conserved hypothetical protein	AA02482	conserved hypothetical protein	->->	1720164	1720270	107	33.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
645	AA02484	ABC transporter, ATP-binding protein	AA02485	outer membrane protein 100	->->	1722981	1723089	109	33.9%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
646	AA02485	outer membrane protein 100	AA02486	topoisomerase IV, subunit B	->->	1723975	1724476	502	28.7%	0	0	0	+: 1/1/1 \| -: 0/1/0	1	0	0	0	Result
647	AA02491	topoisomerase IV, subunit A	AA02492	glutathione S-transferase	->->	1729220	1729505	286	32.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
648	AA02494	conserved hypothetical protein	AA02495	conserved hypothetical protein	->->	1731601	1731701	101	27.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
649	AA02499	dolichol phosphate mannose	AA02500	conserved hypothetical protein	->->	1734605	1734750	146	23.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
651	AA02514	esterase/lipase	AA02515	flavodoxin	->->	1748439	1748860	422	34.8%	0	1	0	+: 1/1/0 \| -: 0/3/0	1	0	0	0	Result
652	AA02526	conserved hypothetical protein	AA02527	integration host factor,beta-subunit	->->	1755659	1755759	101	27.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
653	AA02528	30S ribosomal protein S1	AA02529	cytidylate kinase 1	->->	1757753	1757852	100	29%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
654	AA02531	conserved hypothetical protein	AA02532	conserved hypothetical protein	->->	1759402	1759705	304	32.2%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
655	AA02539	transcriptional activator	AA02540	5-methyltetrahydropteroyltriglutamate-homocystein e methyltransferase	->->	1766990	1767288	299	32.1%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
656	AA02540	5-methyltetrahydropteroyltriglutamate-homocystein e methyltransferase	AA02541	conserved hypothetical protein	->->	1769560	1769995	436	36.9%	0	0	0	+: 0/3/0 \| -: 0/3/0	1	0	0	0	Result
657	AA02541	conserved hypothetical protein	AA02543	conserved hypothetical protein	->->	1772705	1772840	136	30.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
658	AA02545	conserved hypothetical protein	AA02546	hypothetical protein	->->	1774282	1774677	396	35.6%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
660	AA02553	acylphosphatase	AA02554	conserved hypothetical protein	->->	1779731	1779874	144	31.9%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
661	AA02562	adenine specific methylase	AA02563	transketolase C-terminal section	->->	1785207	1785378	172	34.9%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
663	AA02568	sugar phosphotransferase component II B	AA02569	hypothetical protein	->->	1788786	1789151	366	46.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
664	AA02570	conserved hypothetical protein	AA02573	ABC transporter, ATP-binding protein	->->	1790286	1790548	263	38.8%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
668	AA02591	conserved hypothetical protein (possible membrane protein)	AA02592	conserved hypothetical protein	->->	1802647	1803170	524	33%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
669	AA02592	conserved hypothetical protein	AA02593	conserved hypothetical protein (exported protein)	->->	1803990	1804197	208	25.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
670	AA02594	conserved hypothetical protein	AA02595	cytochrome c peroxidase	->->	1805185	1805880	696	29%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
671	AA02601	ATP-dependent helicase	AA02602	conserved hypothetical protein	->->	1813370	1813546	177	45.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
672	AA02602	conserved hypothetical protein	AA02603	possible thioredoxin trxA homolog	->->	1814363	1814774	412	36.7%	0	0	0	+: 0/3/0 \| -: 0/0/0	1	0	0	0	Result
673	AA02609	ABC transporter, ATP-binding protein/permease	AA02610	acyl-CoA thioesterase II	->->	1820245	1820510	266	45.1%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	3	23	145	Result	ggaaaccttcccggcttgatctcggcacacgaaaattctgactctggctgctttcttccgaacctgacctggtaaaccagacttcattgcgagggaccgaaaaggtttccattgaattaaccg
674	AA02610	acyl-CoA thioesterase II	AA02611	hypothetical protein	->->	1821375	1821528	154	33.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
675	AA02619	GTP cyclohydrolase II	AA02620	orf14; possible membrane protein	->->	1826254	1826534	281	32%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
677	AA02628	exodeoxyribonuclease III	AA02629	hypothetical protein	->->	1830066	1830211	146	32.2%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
678	AA02629	hypothetical protein	AA02630	hypothetical protein	->->	1830335	1830435	101	34.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
682	AA02656	possible polysaccharide polymerization protein	AA02657	conserved hypothetical protein	->->	1852041	1852151	111	25.2%	0	0	0	+: 1/1/0 \| -: 0/0/0	1	0	0	0	Result
683	AA02663	DNA ligase	AA02666	DNA helicase II	->->	1854412	1854549	138	31.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
684	AA02666	DNA helicase II	AA02667	hypothetical protein	->->	1856644	1856748	105	41.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
685	AA02670	hypothetical protein	AA02671	gluconokinase	->->	1858324	1858461	138	27.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
686	AA02674	formate dehydrogenase-related protein	AA02675	formate dehydrogenase alpha subunit	->->	1860793	1861150	358	29.3%	0	0	0	+: 2/1/0 \| -: 0/2/0	1	0	0	0	Result
687	AA02681	hypothetical protein	AA02682	hydrogenase maturation protein	->->	1866012	1866443	432	37%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
688	AA02682	hydrogenase maturation protein	AA02683	hydrogenase 4 Fe-S subunit	->->	1868727	1869021	295	27.1%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
689	AA02695	hydrogenase-3 component G	AA02696	formate hydrogenlyase maturation protein	->->	1879479	1879615	137	51.8%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
690	AA02697	hydrogenase 3 maturation protease	AA02698	formate dehydrogenase H, selenopolypeptide subunit	->->	1880469	1880999	531	34.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
691	AA02699	formate dehydrogenase H, selenopolypeptide subunit	AA02700	succinyl-CoA synthase, alpha subunit	->->	1883220	1883395	176	36.4%	0	0	0	+: 0/2/0 \| -: 0/3/0	1	0	0	0	Result
692	AA02713	possible prop effector homolog	AA02714	paraquat-inducible protein PqiA homolog	->->	1895730	1895946	217	27.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
693	AA02721	spermidine/putrescine ABC transporter, periplasmic-binding protein	AA02722	cytidine deaminase	->->	1905395	1905518	124	29.8%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
694	AA02724	seryl-tRNA ligase	AA02726	anaerobic C4-dicarboxylate transporter	->->	1907811	1908117	307	31.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
695	AA02727	hypothetical protein	AA02728	conserved hypothetical protein (possible ATPase)	->->	1909986	1910284	299	40.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
696	AA02734	leucine-responsive regulatory protein	AA02735	DNA repair protein	->->	1915753	1916113	361	38%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
697	AA02736	conserved hypothetical protein	AA02737	conserved hypothetical protein	->->	1918642	1918805	164	28.7%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
698	AA02745	isopentenyl monophosphate kinase	AA02747	ribose-phosphate pyrophosphokinase; phosphoribosylpyrophosphate synthase	->->	1924328	1924463	136	44.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
699	AA02747	ribose-phosphate pyrophosphokinase; phosphoribosylpyrophosphate synthase	AA02748	conserved hypothetical protein	->->	1925319	1925498	180	33.3%	0	0	0	+: 0/2/0 \| -: 1/2/0	1	0	0	0	Result
700	AA02748	conserved hypothetical protein	AA02749	L-lactate dehydrogenase	->->	1925643	1925953	311	31.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
701	AA02750	hypothetical protein	AA02751	L-lactate permease	->->	1927230	1927341	112	30.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
702	AA02751	L-lactate permease	AA02754	conserved hypothetical protein	->->	1928929	1929088	160	37.5%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
705	AA02766	hypothetical protein	AA02767	conserved hypothetical protein (possible stability determinant)	->->	1935206	1935340	135	36.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
706	AA02767	conserved hypothetical protein (possible stability determinant)	AA02768	conserved hypothetical protein	->->	1935518	1935679	162	33.3%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
707	AA02770	hypothetical protein	AA02772	hypothetical protein	->->	1936088	1936383	296	34.8%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
708	AA02774	collagenase prtC homolog, possible protease	AA02775	S-adenosylmethionine:tRNA ribosyltransferase-isomerase (Queuosine biosynthesis protein queA)	->->	1938396	1938694	299	33.1%	0	0	0	+: 1/1/1 \| -: 0/0/0	1	0	0	0	Result
709	AA02776	conserved hypothetical protein	AA02777	tRNA-guanine transglycosylase	->->	1940967	1941438	472	32.6%	0	0	0	+: 1/1/0 \| -: 0/1/0	1	2	159	462	Result	aataaaaaacaaggaatggcgataaccattccttgcggcatcaattactatgagccagtgctacttttcaataacaggcaaagtagaataatgatgaccaatttaataaaaaatttaatcatatttttatccttatgattataacaaggatctactaatctagcccaacagcggcaactggcggactatcattagtagagtccgcctctgctcgtaagagcattgcgaaaaattatagcatgaagcctgtatatttaaacaggcttttttattaaccaaaaatcttcgaactgtttattcgttg
710	AA02777	tRNA-guanine transglycosylase	AA02778	hypothetical protein	->->	1942588	1942724	137	32.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
711	AA02781	protein-export membrane protein	AA02782	outer membrane haemophore receptor (tonB related)	->->	1946042	1946263	222	27%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
712	AA02783	hypothetical protein	AA02784	NAD+ dependent acetaldehyde-alcohol dehydrogenase, iron-containing	->->	1949139	1949240	102	23.5%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
713	AA02788	possible ABC-related substrate binding protein	AA02789	oxidoreductase-dehydrogenase	->->	1956478	1956780	303	29.7%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
714	AA02790	NAD-dependent aldehyde dehydrogenase	AA02792	GlpT/UhpT family transporter (hexosphosphate transport)	->->	1959517	1959756	240	28.3%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
715	AA02793	inositol-1-monophosphatase; extragenic suppressor protein	AA02794	myo-inositol catabolism protein	->->	1961919	1962181	263	30.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
716	AA02794	myo-inositol catabolism protein	AA02796	possible transcriptional regulator, RpiR family	->->	1963010	1963140	131	26%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
717	AA02802	probable myo-inositol 2-dehydrogenase	AA02803	leukotoxin secretion protein D; hemolysin export system membrane fusion protein	->->	1970147	1970421	275	35.6%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
718	AA02808	conserved hypothetical protein (possible serine hydroxymethyltransferase)	AA02810	glycine hydroxymethyltransferase; serine hydroxymethyltransferase	->->	1978005	1978324	320	26.6%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
719	AA02810	glycine hydroxymethyltransferase; serine hydroxymethyltransferase	AA02811	hypothetical protein	->->	1979585	1979721	137	35.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
722	AA02837	conserved hypothetical protein	AA02838	conserved hypothetical protein	->->	1993038	1993155	118	33.1%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
723	AA02841	cytochrome D ubiquinol oxidase, subunit I	AA02842	conserved hypothetical protein	->->	1996263	1996713	451	31.9%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
725	AA02853	conserved hypothetical protein	AA02854	hypothetical protein	->->	2002430	2002552	123	23.6%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
726	AA02856	aspartyl-tRNA synthetase	AA02857	conserved hypothetical protein	->->	2004600	2004806	207	24.6%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
727	AA02864	glycerol-3-phosphate transport protein	AA02865	iron-regulated outer membrane protein (omp64)	->->	2010253	2010652	400	28.5%	0	0	0	+: 1/2/0 \| -: 0/1/0	1	0	0	0	Result
728	AA02865	iron-regulated outer membrane protein (omp64)	AA02866	lactoylglutathione lyase	->->	2012603	2012763	161	39.8%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
729	AA02869	hypothetical protein	AA02870	conserved hypothetical protein	->->	2014033	2014262	230	36.5%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
730	AA02873	conserved hypothetical protein	AA02874	hypothetical protein	->->	2017688	2017833	146	34.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
731	AA02874	hypothetical protein	AA02875	conserved hypothetical protein (2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase)	->->	2017960	2018069	110	38.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
732	AA02875	conserved hypothetical protein (2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase)	AA02876	conserved hypothetical protein	->->	2018211	2018432	222	27.9%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
733	AA02876	conserved hypothetical protein	AA02878	conserved hypothetical protein	->->	2018814	2018929	116	37.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
734	AA02879	octaprenyl-diphosphate synthase	AA02880	50S ribosomal protein L21	->->	2020650	2020896	247	32.4%	0	0	0	+: 1/0/0 \| -: 1/1/0	1	1	58	200	Result	aaagtgcggtggattttacctgatttttcaggctttctgaaatcaaactgccgaaattgcgaaattttttattttctcgtaaataaattcttgctatcccctaaatttttccgtagaattcacgccctatttatatgaatttt
735	AA02889	hypothetical protein	AA02890	hypothetical protein	->->	2025332	2025457	126	38.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
737	AA02892	oligopeptide ABC transporter, periplasmic-binding protein	AA02893	oligopeptide transport system permease protein, N-terminal	->->	2027238	2027340	103	34%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
738	AA02899	oligopeptide ABC transporter, ATP-binding protein	AA02902	aerobic respiration control protein	->->	2031199	2031310	112	32.1%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
739	AA02902	aerobic respiration control protein	AA02903	conserved hypothetical protein (ribosomal protein L36)	->->	2032016	2032279	264	29.5%	0	0	0	+: 1/0/0 \| -: 1/2/2	1	0	0	0	Result
740	AA02904	50S ribosomal protein L31	AA02905	conserved hypothetical protein	->->	2032694	2032907	214	27.6%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
742	AA02911	hypothetical protein	AA02912	hypothetical protein	->->	2039296	2039434	139	33.8%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
743	AA02913	ribosomal large subunit pseudouridine synthase	AA02915	thioredoxin m	->->	2040588	2040791	204	37.3%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
745	AA02917	cystathionine gamma-synthase	AA02918	hypothetical protein	->->	2043341	2043459	119	31.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
747	AA02919	CagE protein (tranport-associated)	AA02920	hypothetical protein	->->	2045362	2045533	172	34.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
748	AA02921	conserved hypothetical protein (cell filamentation protein)	AA02922	gamma-glutamylphosphate reductase	->->	2046135	2046364	230	30%	0	0	0	+: 1/1/1 \| -: 0/0/0	1	0	0	0	Result
749	AA02922	gamma-glutamylphosphate reductase	AA02925	conserved hypothetical protein	->->	2047502	2047632	131	38.2%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
750	AA02929	hypothetical protein	AA02930	fructose-1,6-bisphosphatase	->->	2049431	2049573	143	24.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
751	AA02930	fructose-1,6-bisphosphatase	AA02931	UDP-N-acetylmuramate:L-alanyl-gamma-d-glutamayl-m edo-diaminopimelate	->->	2050579	2050735	157	26.1%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
753	AA02935	high-affinity zinc uptake system periplasmic binding protein	AA02936	lipoprotein E precursor; outer membrane protein P4 precursor; acid phosphatase	->->	2055494	2055749	256	36.7%	0	0	1	+: 0/0/0 \| -: 0/3/0	1	0	0	0	Result
754	AA02944	30S ribosomal protein S20	AA02946	virulence factor protein	->->	2059089	2059355	267	35.2%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	3	1	247	Result	ggtcaaactcctaaaaatttctgttagttaatagtgacaaaataggggcgtaaatatgccgatttcttatacttttgtcaacgggaattttgtgttgatttcggtgagacacaaccgaaagaaagcatcgttatatttaacaagcactttcaaaccggctcacgaaacgatgtgcgcgagattttaacagttttttcccttagaatatagcgtaaaaacgaaatttctatacaattaggcaaatttt
755	AA02947	riboflavin biosynthesis protein	AA02949	hypothetical protein	->->	2061935	2062083	149	55%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
756	AA02949	hypothetical protein	AA02950	isoleucyl-tRNA synthetase	->->	2062303	2062434	132	37.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
757	AA02954	penicillin tolerance protein; hydroxymethylbutenyl pyrophosphate reductase	AA02955	trigger factor	->->	2066692	2067161	470	38.7%	0	0	0	+: 0/2/0 \| -: 0/3/0	2	0	0	0	Result
758	AA02955	trigger factor	AA02956	integrase-recombinase	->->	2068458	2068623	166	36.1%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
760	AA02972	conserved hypothetical protein (tyrosine phenol lyase-related protein)	AA02973	tyrosine-specific transport protein	->->	2077683	2077846	164	38.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
761	AA02976	UDP-2,3-diacylglucosamine hydrolase	AA02977	1-acyl-sn-glycerol-3-phosphate acyltransferase	->->	2081098	2081207	110	27.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
762	AA02980	conserved hypothetical protein	AA02982	pyruvate formate-lyase activating enzyme	->->	2084306	2084449	144	40.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
763	AA02982	pyruvate formate-lyase activating enzyme	AA02983	formate acetyltransferase	->->	2085188	2085334	147	38.1%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
764	AA02983	formate acetyltransferase	AA02984	formate transporter	->->	2087645	2087745	101	33.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
765	AA02984	formate transporter	AA02987	histidine triad protein homolog	->->	2088595	2088906	312	32.4%	0	0	0	+: 1/2/2 \| -: 0/0/0	1	0	0	0	Result
767	AA02992	RNA methyltransferase	AA02993	6-phosphofructokinase	->->	2091801	2091905	105	36.2%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
769	AA03000	uracil-DNA glycosylase (UDG)	AA03001	probable glycyl radical protein/pyruvate-formate lyase	->->	2095882	2096166	285	28.4%	0	0	0	+: 1/0/0 \| -: 1/1/0	1	0	0	0	Result
770	AA03010	thiophene and furan oxidation protein	AA03011	inner membrane protein, 60 kDa	->->	2102595	2102724	130	34.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
771	AA03014	conserved hypothetical protein	AA03015	hypothetical protein	->->	2105087	2105221	135	27.4%	0	0	0	+: 0/0/0 \| -: 2/0/0	1	0	0	0	Result
Total:										0	21	0/59		630	16