CDS GC%: 43.9% tRNA GC%: 58.1% rRNA GC%: 52.7%
| IGS# | Up stream Locus | Up stream Product | Down Stream Locus | Down Stream Product | Gene Dir type | Start | End | IGS Len | GC% | IS NT | IS AA | NR | PT-Pair | Intra Spp. IGS | Inter Spp. IGS | Conserved Inter-spp IGS Start | Conserved Inter-spp IGS End | Blast Result | Conserved IGS Seq |
| 1 | AA00004 | conserved hypothetical protein (possible methyltransferase) | AA00007 | superoxide dismutase [Cu-Zn] precursor | ->-> | 4356 | 4542 | 187 | 21.4% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 4 | AA00015 | malate dehydrogenase | AA00017 | hypothetical protein | ->-> | 8394 | 8498 | 105 | 23.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 6 | AA00020 | conserved hypothetical protein | AA00021 | DNA helicase IV | ->-> | 14547 | 14769 | 223 | 31.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 7 | AA00022 | conserved hypothetical protein | AA00024 | transcriptional regulatory protein | ->-> | 18945 | 19150 | 206 | 30.1% | 0 | 0 | 0 | +: 0/6/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 8 | AA00026 | conserved hypothetical protein | AA00028 | conserved hypothetical protein (possible type III restriction-modification system restriction subunit) | ->-> | 20603 | 20734 | 132 | 34.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 9 | AA00030 | hypothetical protein | AA00031 | conserved hypothetical protein | ->-> | 25229 | 25420 | 192 | 35.4% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 10 | AA00037 | conserved hypothetical protein | AA00038 | conserved hypothetical protein | ->-> | 29967 | 30080 | 114 | 22.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 11 | AA00042 | hypothetical protein | AA00043 | formate dependent nitrite reductase, transmembrane protein | ->-> | 34316 | 34517 | 202 | 36.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 12 | AA00047 | formate dependent nitrite reductase, cytochrome c552 | AA00048 | conserved hypothetical protein | ->-> | 38414 | 38992 | 579 | 29.2% | 0 | 0 | 0 | +: 0/1/0 | -: 1/2/1 | 1 | 0 | 0 | 0 | Result | |
| 13 | AA00049 | conserved hypothetical protein | AA00050 | cytochrome c-type biogenesis protein precursor (reductase) | ->-> | 39925 | 40058 | 134 | 33.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 14 | AA00061 | cytochrome c-type biogenesis ATP-binding protein | AA00062 | bicyclomycin resistance protein (Sulfonamide resistance protein) | ->-> | 46855 | 47028 | 174 | 34.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 16 | AA00066 | NADP-dependent malic enzyme (NADP-ME) | AA00068 | manganese superoxide dismutase | ->-> | 51404 | 51549 | 146 | 30.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 17 | AA00068 | manganese superoxide dismutase | AA00069 | conserved hypothetical protein | ->-> | 52192 | 52604 | 413 | 35.6% | 0 | 0 | 0 | +: 2/1/2 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 18 | AA00069 | conserved hypothetical protein | AA00071 | conserved hypothetical protein (possible zinc protease) | ->-> | 53394 | 53602 | 209 | 40.2% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 19 | AA00071 | conserved hypothetical protein (possible zinc protease) | AA00072 | conserved hypothetical protein | ->-> | 54428 | 54566 | 139 | 32.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 20 | AA00076 | dihydroneopterin aldolase | AA00077 | conserved hypothetical protein (possible periplasmic binding transport protein) | ->-> | 56144 | 56250 | 107 | 33.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 21 | AA00080 | Na+/H+ antiporter protein | AA00081 | fatty acid metabolism regulator protein | ->-> | 59905 | 60098 | 194 | 26.3% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 22 | AA00084 | aminotransferase | AA00085 | menaquinone-specific isochorismate; isochorismate mutase | ->-> | 62166 | 62281 | 116 | 29.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 23 | AA00088 | 30S ribosomal protein S15 | AA00089 | S-adenosylmethionine synthase; methionine adenosyltransferase | ->-> | 66448 | 66657 | 210 | 34.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 24 | AA00091 | short-patch reverse transcription protein | AA00092 | serine transporter | ->-> | 68379 | 68537 | 159 | 25.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 25 | AA00093 | L-serine dehydratase (L-serine deaminase) | AA00096 | L-asparaginase II precursor | ->-> | 71234 | 71419 | 186 | 36.6% | 0 | 0 | 0 | +: 0/3/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 26 | AA00096 | L-asparaginase II precursor | AA00099 | conserved hypothetical protein | ->-> | 72467 | 72760 | 294 | 40.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 27 | AA00101 | fimbrial biogenesis and twitching motility protein | AA00105 | conserved hypothetical protein | ->-> | 74471 | 74616 | 146 | 40.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 28 | AA00112 | uracil permease | AA00113 | uracil phosphoribosyltransferase | ->-> | 81300 | 81425 | 126 | 38.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 29 | AA00113 | uracil phosphoribosyltransferase | AA00114 | peptidyl-prolyl cis-trans isomerase D (PPIase D) (rotamase D) | ->-> | 82050 | 82186 | 137 | 34.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 30 | AA00114 | peptidyl-prolyl cis-trans isomerase D (PPIase D) (rotamase D) | AA00115 | glutamate--cysteine ligase (gamma-glutamylcysteine synthetase) (gamma-ECS) | ->-> | 84032 | 84166 | 135 | 29.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 31 | AA00115 | glutamate--cysteine ligase (gamma-glutamylcysteine synthetase) (gamma-ECS) | AA00116 | conserved hypothetical protein | ->-> | 86438 | 86668 | 231 | 27.3% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 32 | AA00116 | conserved hypothetical protein | AA00117 | hypothetical protein | ->-> | 88268 | 88385 | 118 | 39.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 33 | AA00125 | conserved hypothetical protein (possible phage-related protein) | AA00126 | conserved hypothetical protein | ->-> | 91074 | 91192 | 119 | 32.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 34 | AA00135 | S-adenosylmethionine: 2-demethylmenaquinone methyltransferase (menaquinone biosynthesis protein) | AA00136 | sodium/sulphate transporter | ->-> | 96941 | 97131 | 191 | 29.8% | 0 | 0 | 0 | +: 1/2/1 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 35 | AA00139 | antibiotic maturation factor | AA00140 | hypothetical protein | ->-> | 100597 | 100785 | 189 | 30.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 1 | 15 | 162 | Result | taaatgataataattcttattgacaacaattaaaactctgctaacataagccacatctgttaagtattgcaatgaagatgaacggtagtcattggaagtctgcatagtactccaaacaggtagagtagaaagtaaattcgttagggta |
| 38 | AA00148 | ATP-dependent RNA helicase | AA00150 | conserved hypothetical protein (possible TPR domain protein) | ->-> | 107904 | 108017 | 114 | 36% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 39 | AA00151 | polynucleotide phosphorylase | AA00153 | conserved hypothetical protein | ->-> | 111132 | 111424 | 293 | 33.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 40 | AA00166 | conserved hypothetical protein (possible acetyltransferase) | AA00167 | possible amino-acid transporter (sodium-alanine symporters) | ->-> | 117980 | 118378 | 399 | 44.6% | 0 | 0 | 0 | +: 1/3/0 | -: 0/0/0 | 1 | 3 | 58 | 288 | Result | gttcggacgaaggtagctggagagcggggaatcgaccccacgccgacgaggtaaaatctttcaggcgcgatggcagggactgttactggacgaacccttggagagatccaaggtacttttaaagcgtttactttcaaggtaacgactttttaagtgctaatggacgccgaaggcgcaaagaagcttgattccatcaggcttttcaaacgctcaggcaaaaggacaggggca |
| 41 | AA00167 | possible amino-acid transporter (sodium-alanine symporters) | AA00168 | possible sigma 54 modulation protein | ->-> | 119750 | 119979 | 230 | 32.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 42 | AA00168 | possible sigma 54 modulation protein | AA00169 | conserved hypothetical protein | ->-> | 120301 | 120451 | 151 | 35.1% | 0 | 0 | 0 | +: 1/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 43 | AA00169 | conserved hypothetical protein | AA00170 | hypothetical protein | ->-> | 121004 | 121377 | 374 | 39% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 44 | AA00170 | hypothetical protein | AA00171 | DNA-binding protein | ->-> | 121468 | 121624 | 157 | 40.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 45 | AA00172 | conserved hypothetical protein (possible regulator protein / nitrogen fixation protein) | AA00173 | hypothetical protein | ->-> | 122965 | 123107 | 143 | 25.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 47 | AA00180 | conserved hypothetical protein | AA00181 | hypothetical protein | ->-> | 128129 | 128708 | 580 | 34.5% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 48 | AA00185 | 3-dehydroquinate dehydratase II | AA00186 | o-succinylbenzoate-CoA synthase; OSB synthase | ->-> | 131406 | 131506 | 101 | 34.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 49 | AA00189 | dihydroxynaphthoic acid synthase (naphthoate synthas) | AA00190 | triosephosphate isomerase | ->-> | 134114 | 134227 | 114 | 37.7% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 50 | AA00190 | triosephosphate isomerase | AA00191 | conserved hypothetical protein (possible acetyltransferase, GNAT family) | ->-> | 134993 | 135158 | 166 | 27.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 51 | AA00196 | conserved hypothetical protein | AA00198 | conserved hypothetical protein (Cytosine deaminase-related enzyme) | ->-> | 138076 | 138178 | 103 | 41.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 52 | AA00199 | hypothetical protein | AA00200 | thymidylate synthase | ->-> | 138805 | 139031 | 227 | 47.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
| 53 | AA00204 | (di)nucleoside polyphosphate hydrolase; possible invasion protein | AA00205 | ribose ABC transporter protein / high affinity D-ribose transport protein | ->-> | 142083 | 142301 | 219 | 36.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 54 | AA00212 | ribokinase | AA00213 | cold shock protein (negative regulator of cspA transcription) | ->-> | 147108 | 147210 | 103 | 34% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 58 | AA00218 | argininosuccinate lyase | AA00221 | NADP-specific glutamate dehydrogenase | ->-> | 152272 | 152575 | 304 | 29.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 59 | AA00221 | NADP-specific glutamate dehydrogenase | AA00223 | catalase (hydroperoxidase; iron heme axial ligand) | ->-> | 153926 | 154416 | 491 | 33.8% | 0 | 0 | 0 | +: 0/3/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 60 | AA00223 | catalase (hydroperoxidase; iron heme axial ligand) | AA00226 | hypothetical protein | ->-> | 155869 | 156415 | 547 | 35.1% | 0 | 0 | 5 | +: 1/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 62 | AA00229 | DNA polymerase III, alpha subunit | AA00231 | long-chain-fatty-acid--CoA ligase | ->-> | 160372 | 160674 | 303 | 39.9% | 0 | 1 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 63 | AA00233 | hypothetical protein | AA00234 | collagen adhesin | ->-> | 162593 | 162806 | 214 | 26.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 64 | AA00235 | hypothetical protein | AA00236 | anaerobic ribonucleoside-triphosphate reductase | ->-> | 168829 | 168957 | 129 | 27.9% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 65 | AA00237 | hypothetical protein | AA00239 | hypothetical protein | ->-> | 171230 | 171352 | 123 | 36.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 67 | AA00249 | cysteinyl-tRNA synthetase (cysteine--tRNA ligase) | AA00250 | lipoate biosynthesis protein A | ->-> | 175483 | 175635 | 153 | 37.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 68 | AA00254 | penicillin-binding protein 5 | AA00256 | rare lipoprotein A precursor | ->-> | 178835 | 178939 | 105 | 37.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 69 | AA00265 | transcription termination factor | AA00266 | conserved hypothetical protein (probable metabolite transport protein) | ->-> | 186644 | 186773 | 130 | 36.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 70 | AA00268 | acyl carrier protein (ACP) | AA00269 | 3-oxoacyl-(acyl-carrier-protein) reductase/short-chain alcohol dehydrogenase | ->-> | 188472 | 188747 | 276 | 37.3% | 0 | 0 | 0 | +: 0/0/0 | -: 2/2/2 | 1 | 0 | 0 | 0 | Result | |
| 71 | AA00280 | adenosylmethionine-8-amino-7-oxononanoate; 7,8-diamino-perlargonic acid ATase | AA00281 | phosphatidylserine decarboxylase proenzyme | ->-> | 197857 | 198078 | 222 | 33.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 72 | AA00305 | conserved hypothetical protein | AA00306 | nitrogen regulatory protein p-II | ->-> | 207922 | 208062 | 141 | 38.3% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 73 | AA00308 | glycerol-3-phosphate regulon repressor | AA00309 | 3-hydroxyisobutyrate dehydrogenase; 2-hydroxy-3-oxopropionate reductase | ->-> | 209233 | 209424 | 192 | 26% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 74 | AA00314 | conserved hypothetical protein (possible Kmt1 protein) | AA00316 | conserved hypothetical protein | ->-> | 214387 | 214584 | 198 | 40.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 75 | AA00316 | conserved hypothetical protein | AA00317 | DNA mismatch repair protein | ->-> | 215401 | 215611 | 211 | 39.8% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 76 | AA00317 | DNA mismatch repair protein | AA00318 | hypothetical protein | ->-> | 218171 | 218296 | 126 | 27.8% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 77 | AA00321 | hypothetical protein | AA00323 | conserved hypothetical protein (possible SAM-dependent methyltransferase) | ->-> | 219413 | 219526 | 114 | 31.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 78 | AA00327 | conserved hypothetical protein | AA00329 | molybdopterin-guanine dinucleotide biosynthesis protein | ->-> | 222743 | 222876 | 134 | 44.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 79 | AA00329 | molybdopterin-guanine dinucleotide biosynthesis protein | AA00330 | conserved hypothetical protein | ->-> | 223408 | 223508 | 101 | 38.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 80 | AA00330 | conserved hypothetical protein | AA00332 | PTS system, fructose-specific IIA/FPr component (diphosphoryl transfer protein) | ->-> | 224037 | 224150 | 114 | 36% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 81 | AA00335 | PTS fructose-specific IIBC component | AA00337 | conserved hypothetical protein | ->-> | 228291 | 228403 | 113 | 38.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 82 | AA00343 | conserved hypothetical protein (possible cytosolic protein) | AA00344 | preprotein translocase secE subunit | ->-> | 230714 | 231157 | 444 | 34.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 83 | AA00345 | transcription antitermination protein | AA00347 | 50S ribosomal protein L11 | ->-> | 232119 | 232276 | 158 | 39.2% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 84 | AA00349 | hypothetical protein | AA00350 | 50S ribosomal protein L10 | ->-> | 233588 | 233760 | 173 | 43.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 4 | 8 | 173 | Result | attcaagccccgtccaagaccgtaggggagcaatcttaattatcctacgtagatggtgaacagaataagaattttcttgcttctgtgcaccgagttcgtcctaatagcagttttattaggtatctaaattccgagcaatcggagtgtattcaggagctaacagcca |
| 85 | AA00351 | 50S ribosomal protein L7/L12 | AA00354 | hypothetical protein | ->-> | 234673 | 234829 | 157 | 35.7% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 86 | AA00355 | DNA-directed RNA polymerase beta chain (transcriptase beta chain) | AA00356 | DNA-directed RNA polymerase, beta' chain | ->-> | 238972 | 239076 | 105 | 42.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 89 | AA00370 | 30S ribosomal protein S10 | AA00371 | transcriptional regulator | ->-> | 249069 | 249320 | 252 | 36.1% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 3 | 1 | 174 | Result | tagaccagagctccaataaatttagctaataaaaaactaacaccatcacaattcttacatcaaaacaacaagaaaaggaggtgaaagctacctgttatatagtccccaaatcggagacattgttagtattacctatcgtaatacccgtttaataaatgattacactaaacggct |
| 90 | AA00371 | transcriptional regulator | AA00372 | acetate CoA-transferase (alpha subunit) | ->-> | 250215 | 250487 | 273 | 38.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 91 | AA00377 | acetyl-CoA acetyltransferase (Beta-ketothiolase,3-ketoacyl-CoA thiolase) | AA00378 | leucine-responsive regulatory protein (transcription regulator) | ->-> | 254361 | 254463 | 103 | 37.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 92 | AA00379 | possible membrane protein | AA00380 | carbamate kinase | ->-> | 256549 | 256667 | 119 | 38.7% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 93 | AA00381 | ornithine carbamoyltransferase | AA00382 | hypothetical protein | ->-> | 258612 | 258732 | 121 | 33.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 95 | AA00388 | uridine phosphorylase; possible 5'-methylthioadenosine phosphorylase; purine nucleoside phosphorylase | AA00390 | permease | ->-> | 263687 | 263828 | 142 | 39.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 96 | AA00391 | arsenate reductase | AA00395 | conserved hypothetical protein | ->-> | 265309 | 265417 | 109 | 42.2% | 0 | 0 | 0 | +: 0/3/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 97 | AA00396 | conserved hypothetical protein | AA00397 | Fe-S oxidoreductase; MiaB-like RNA modifying enzyme (2-methylthioadenine synthetase) | ->-> | 266013 | 266208 | 196 | 35.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 98 | AA00398 | protein-tyrosine-phosphatase (PTPase) | AA00399 | conserved hypothetical protein | ->-> | 268079 | 268207 | 129 | 36.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 99 | AA00406 | large-conductance mechanosensitive channel | AA00407 | trk system potassium uptake protein | ->-> | 270884 | 270995 | 112 | 29.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 106 | AA00413 | conserved hypothetical protein | AA00414 | possible histidinol-phosphatase | ->-> | 280615 | 281038 | 424 | 37.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 3 | 0 | 0 | 0 | Result | |
| 107 | AA00414 | possible histidinol-phosphatase | AA00415 | D-methionine ABC transporter, ATP-binding protein | ->-> | 281594 | 281789 | 196 | 29.6% | 0 | 0 | 0 | +: 0/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
| 108 | AA00417 | outer membrane lipoprotein precursor (probable D-methionine-binding lipoprotein) | AA00419 | conserved hypothetical protein (possible phosphatidylethanolamine-binding protein) | ->-> | 284369 | 284476 | 108 | 39.8% | 0 | 0 | 0 | +: 1/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 109 | AA00419 | conserved hypothetical protein (possible phosphatidylethanolamine-binding protein) | AA00420 | tRNA/rRNA methyltransferase | ->-> | 284972 | 285092 | 121 | 41.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 110 | AA00420 | tRNA/rRNA methyltransferase | AA00422 | LapB membrane protein | ->-> | 285567 | 285667 | 101 | 33.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 111 | AA00422 | LapB membrane protein | AA00423 | GTP-binding protein | ->-> | 286541 | 286672 | 132 | 31.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 112 | AA00426 | conserved hypothetical protein | AA00427 | hypothetical protein | ->-> | 288266 | 288369 | 104 | 28.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 113 | AA00428 | hypothetical protein | AA00429 | conserved hypothetical protein | ->-> | 290107 | 290706 | 600 | 29.3% | 0 | 0 | 0 | +: 0/1/0 | -: 2/1/0 | 1 | 0 | 0 | 0 | Result | |
| 115 | AA00432 | conserved hypothetical protein; possible methyltransferase | AA00434 | VgrG-like protein (Rhs accessory genetic element) | ->-> | 294694 | 294964 | 271 | 32.5% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 116 | AA00435 | hypothetical protein | AA00436 | hypothetical protein | ->-> | 301457 | 301877 | 421 | 31.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 117 | AA00436 | hypothetical protein | AA00437 | conserved hypothetical protein; possible parB-like nuclease | ->-> | 302160 | 302283 | 124 | 33.9% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 118 | AA00440 | hypothetical protein | AA00442 | conserved hypothetical protein (possible zinc finger protein) | ->-> | 305846 | 306328 | 483 | 28.2% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 119 | AA00447 | conserved hypothetical protein | AA00448 | C-terminal region of competence protein M | ->-> | 312282 | 312407 | 126 | 27.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 120 | AA00452 | phosphomannomutase; phosphoglucomutase | AA00453 | phosphoglyceromutase | ->-> | 317084 | 317388 | 305 | 32.8% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 121 | AA00461 | heat shock protein; protease | AA00463 | class B acid phosphatase | ->-> | 323040 | 323253 | 214 | 36.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 122 | AA00464 | conserved hypothetical protein | AA00465 | hypothetical protein | ->-> | 324166 | 324345 | 180 | 32.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 123 | AA00468 | tryptophan-specific transport protein / tyrosine-specific transport protein | AA00469 | inorganic pyrophosphatase, chain A | ->-> | 326185 | 326345 | 161 | 32.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 124 | AA00470 | conserved hypothetical protein (possible Zn-dependent protease with chaperone function) | AA00471 | 3,4-dihydroxy-2-butanone 4-phosphate synthase; GTP cyclohydrase II | ->-> | 327720 | 328401 | 682 | 39% | 0 | 0 | 0 | +: 0/3/0 | -: 0/2/0 | 1 | 2 | 390 | 588 | Result | tttgcgctatactaggcgcgcattctcagggcagggtgaaagtccctaccggtggtaagcatgaaggaatgtttcaatgcaagcccacgagcgtttatcgacaaaagtgcggtcgtttttgacggcgttttttcgataaagtcagcagatttggtgcgaatccaaagccgacagtgacagtctggatgaaagagaataa |
| 125 | AA00473 | tryptophanyl-tRNA synthetase | AA00474 | cell division protein Y (GTP-binding signal recognition particle) | ->-> | 330138 | 330314 | 177 | 32.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 126 | AA00475 | conserved hypothetical protein (possible N6-adenine-specific methylase) | AA00478 | mannose-specific phosphotransferase element | ->-> | 332343 | 332631 | 289 | 34.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 127 | AA00480 | mannose-specific phosphotransferase system IID | AA00482 | hydrolase (haloacid dehalogenase-like) (HAD superfamily) | ->-> | 335260 | 335371 | 112 | 43.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 128 | AA00485 | hypothetical protein | AA00486 | nucleoside transporter | ->-> | 336769 | 336922 | 154 | 30.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 129 | AA00486 | nucleoside transporter | AA00488 | purine nucleoside phosphorylase | ->-> | 338087 | 338214 | 128 | 38.3% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 130 | AA00489 | hypothetical protein | AA00490 | possible outer membrane protein (hemin-binding protein / haemin storage protein) | ->-> | 339093 | 339200 | 108 | 21.3% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 132 | AA00497 | hexose phosphate transport system regulatory protein; regulator of uhpT expression | AA00499 | pyridoxamine-5'-phosphate oxidase | ->-> | 346540 | 346709 | 170 | 34.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 134 | AA00504 | ATPase | AA00505 | hypothetical protein | ->-> | 351348 | 351700 | 353 | 36.3% | 0 | 0 | 0 | +: 0/1/0 | -: 1/1/1 | 1 | 0 | 0 | 0 | Result | |
| 135 | AA00512 | conserved hypothetical protein | AA00513 | pseudouridylate synthase (pseudouridine synthase) | ->-> | 354710 | 355089 | 380 | 40.5% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 136 | AA00516 | autoinducer-2 production protein | AA00518 | conserved hypothetical protein | ->-> | 356575 | 356790 | 216 | 28.2% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 137 | AA00521 | phosphatase | AA00523 | conserved hypothetical protein | ->-> | 358385 | 358611 | 227 | 39.6% | 0 | 0 | 1 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 138 | AA00528 | conserved hypothetical protein | AA00529 | outer membrane protein, Omp 18/16 | ->-> | 361764 | 361869 | 106 | 52.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 139 | AA00534 | hypothetical protein | AA00535 | hypothetical protein | ->-> | 365655 | 365834 | 180 | 48.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 140 | AA00535 | hypothetical protein | AA00536 | 5'-nucleotidase precursor | ->-> | 366180 | 366290 | 111 | 39.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 141 | AA00537 | conserved hypothetical protein | AA00538 | hypothetical protein | ->-> | 368840 | 369045 | 206 | 30.1% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 142 | AA00543 | ADP-heptose--LPS heptosyltransferase II | AA00544 | glutathionylspermidine synthetase;amidase | ->-> | 372468 | 372587 | 120 | 39.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 143 | AA00550 | ferredoxin-type protein | AA00551 | hypothetical protein | ->-> | 377262 | 377364 | 103 | 51.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 144 | AA00559 | conserved hypothetical protein | AA00560 | RNA polymerase sigma-32 factor | ->-> | 383619 | 383805 | 187 | 26.2% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 145 | AA00562 | hypothetical protein | AA00563 | elongation factor Tu | ->-> | 385521 | 386646 | 1126 | 34.4% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 146 | AA00564 | elongation factor G | AA00565 | 30S ribosomal protein S7 | ->-> | 389995 | 390111 | 117 | 27.4% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/1 | 1 | 0 | 0 | 0 | Result | |
| 147 | AA00565 | 30S ribosomal protein S7 | AA00566 | 30S ribosomal protein S12 (streptomycin resistance protein) | ->-> | 390580 | 390734 | 155 | 34.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 148 | AA00569 | ketol-acid reductoisomerase | AA00570 | hypothetical protein | ->-> | 391643 | 391752 | 110 | 39.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 149 | AA00570 | hypothetical protein | AA00573 | chloramphenicol-sensitive protein RarD | ->-> | 391846 | 392104 | 259 | 39% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 151 | AA00578 | DNA topoisomerase | AA00579 | probable DNA recombination protein | ->-> | 395262 | 395404 | 143 | 46.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 153 | AA00590 | outer membrane substrate binding protein; TonB-dependent outer membrane receptor | AA00591 | ABC transporter, ATP-binding protein | ->-> | 403158 | 403752 | 595 | 34.5% | 0 | 0 | 4 | +: 0/4/0 | -: 0/6/0 | 1 | 0 | 0 | 0 | Result | |
| 154 | AA00591 | ABC transporter, ATP-binding protein | AA00592 | conserved hypothetical protein (membrane/transport protein) | ->-> | 405568 | 405675 | 108 | 27.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 156 | AA00602 | 1-deoxy-D-xylulose 5-phosphate reductoisomerase | AA00603 | undecaprenyl pyrophosphate synthetase (UPPS) | ->-> | 410312 | 410422 | 111 | 45.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 157 | AA00608 | protective surface antigen D-15, 85 -kilodalton outermembrane protein | AA00609 | outer membrane protein | ->-> | 415710 | 415814 | 105 | 37.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 158 | AA00618 | molybdopterin biosynthesis protein | AA00619 | hypothetical protein | ->-> | 423703 | 424270 | 568 | 31.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 165 | AA00622 | conserved hypothetical protein | AA00623 | hypothetical protein | ->-> | 430165 | 430596 | 432 | 37.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 3 | 0 | 0 | 0 | Result | |
| 166 | AA00628 | biotin operon repressor; biotin acetyl coenzyme A carboxylase synthetase | AA00629 | inosine 5' monophosphate dehydrogenase (IMP dehydrogenase) | ->-> | 431925 | 432065 | 141 | 31.9% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 167 | AA00629 | inosine 5' monophosphate dehydrogenase (IMP dehydrogenase) | AA00631 | hypothetical protein | ->-> | 433530 | 433817 | 288 | 37.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 4 | 0 | 0 | 0 | Result | |
| 168 | AA00631 | hypothetical protein | AA00632 | inner membrane protein ImpA | ->-> | 433989 | 434266 | 278 | 35.6% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 2 | 0 | 0 | 0 | Result | |
| 169 | AA00632 | inner membrane protein ImpA | AA00633 | hypothetical protein | ->-> | 434714 | 435110 | 397 | 30.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 170 | AA00634 | DNA polymerase IV (Pol IV) | AA00635 | dihydropteroate synthase | ->-> | 435892 | 436036 | 145 | 39.3% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 171 | AA00637 | phosphohistidine phosphatase | AA00640 | hypothetical protein | ->-> | 438735 | 438932 | 198 | 22.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 172 | AA00643 | hypothetical protein | AA00644 | lipoprotein | ->-> | 440755 | 440924 | 170 | 34.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 173 | AA00644 | lipoprotein | AA00646 | 2-dehydro-3-deoxyphosphooctonate aldolase | ->-> | 441432 | 441613 | 182 | 23.6% | 0 | 0 | 0 | +: 1/2/0 | -: 1/3/3 | 1 | 0 | 0 | 0 | Result | |
| 174 | AA00649 | peptide chain release factor 1 (RF-1) | AA00650 | 15 kDa peptidoglycan-associated protein | ->-> | 444416 | 444637 | 222 | 35.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 175 | AA00651 | conserved hypothetical protein | AA00652 | arginyl-tRNA synthetase (arginine--tRNA ligase) | ->-> | 445720 | 445857 | 138 | 31.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 176 | AA00652 | arginyl-tRNA synthetase (arginine--tRNA ligase) | AA00653 | hypothetical protein | ->-> | 447547 | 447821 | 275 | 34.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 177 | AA00657 | heat shock protein 70 | AA00658 | hypothetical protein | ->-> | 451527 | 451757 | 231 | 36.8% | 0 | 0 | 0 | +: 1/0/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 178 | AA00660 | hypothetical protein | AA00661 | outer membrane protein | ->-> | 453396 | 453541 | 146 | 30.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 179 | AA00661 | outer membrane protein | AA00662 | cystathionine beta-lyase | ->-> | 454592 | 454807 | 216 | 28.7% | 0 | 0 | 0 | +: 0/1/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
| 180 | AA00663 | cystathionine beta-lyase | AA00664 | phosphatidylglycerophosphate synthase (CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase) | ->-> | 455995 | 456249 | 255 | 32.9% | 0 | 0 | 0 | +: 1/0/0 | -: 2/1/0 | 1 | 0 | 0 | 0 | Result | |
| 182 | AA00666 | hypothetical protein | AA00667 | cytolethal distending toxin protein C | ->-> | 457715 | 458082 | 368 | 30.4% | 0 | 0 | 0 | +: 0/3/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 183 | AA00673 | hypothetical protein | AA00674 | nicotinate-nucleotide-dimethylbenzimidazole phosphoribosyltransferase | ->-> | 461356 | 461949 | 594 | 40.2% | 0 | 0 | 3 | +: 0/0/0 | -: 1/1/1 | 1 | 0 | 0 | 0 | Result | |
| 184 | AA00675 | glutaredoxin 2 | AA00679 | cytoplasmic axial filament (Ribonuclease G) | ->-> | 463309 | 463427 | 119 | 46.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 185 | AA00679 | cytoplasmic axial filament (Ribonuclease G) | AA00680 | sodium/proline symporter (proline permease) | ->-> | 464901 | 465038 | 138 | 36.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 186 | AA00688 | curved DNA-binding protein | AA00689 | GTP-binding protein | ->-> | 470286 | 470572 | 287 | 33.4% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 187 | AA00691 | conserved hypothetical protein (possible multidrug/sugar efflux transporter) | AA00692 | conserved hypothetical protein | ->-> | 473216 | 473375 | 160 | 45% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 188 | AA00695 | uridine kinase | AA00696 | iron(III) ABC transporter, periplasmic iron-compound-binding protein | ->-> | 475821 | 476128 | 308 | 30.8% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/1 | 1 | 0 | 0 | 0 | Result | |
| 189 | AA00700 | iron(III) ABC transporter, ATP-binding protein | AA00702 | conserved hypothetical protein | ->-> | 481519 | 481799 | 281 | 37.4% | 0 | 0 | 0 | +: 0/2/0 | -: 0/4/0 | 1 | 0 | 0 | 0 | Result | |
| 190 | AA00709 | metallocluster assembly (NifU protein) | AA00711 | conserved hypothetical protein | ->-> | 487899 | 488032 | 134 | 32.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 191 | AA00716 | conserved hypothetical protein | AA00717 | methionyl-tRNA synthetase | ->-> | 491305 | 491443 | 139 | 37.4% | 0 | 0 | 0 | +: 0/3/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 192 | AA00717 | methionyl-tRNA synthetase | AA00718 | ABC-related ATP-binding protein; MRP protein | ->-> | 493502 | 493673 | 172 | 30.2% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 193 | AA00721 | probable beta-N-acetylhexosaminidase (lacto-N-biosidase); dispersin B | AA00722 | nucleoside diphosphate kinase | ->-> | 496022 | 496159 | 138 | 29% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 194 | AA00726 | apolipoprotein N-acyltransferase, copper | AA00729 | possible hemolysin (TlyC-like) | ->-> | 499947 | 500343 | 397 | 46.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 4 | 0 | 0 | 0 | Result | |
| 195 | AA00741 | possible 2-oxoglutarate/malate transporter | AA00742 | hypothetical protein | ->-> | 508137 | 508324 | 188 | 37.2% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 197 | AA00747 | UTP--hexose-1-phosphate uridylyltransferase / UDPglucose-hexose-1-phosphate uridylyltransferas | AA00748 | hypothetical protein | ->-> | 513565 | 513757 | 193 | 32.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 198 | AA00749 | galactose operon repressor (gal repressor) | AA00750 | periplasmic D-galactose-binding ABC transport protein | ->-> | 514827 | 515043 | 217 | 28.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 199 | AA00759 | 3-oxoacyl-[acyl-carrier-protein] synthase I | AA00760 | conserved hypothetical protein (possible peptidase) | ->-> | 521961 | 522129 | 169 | 34.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 200 | AA00761 | conserved hypothetical protein (possible peptidase) | AA00762 | hemoglobin binding protein A | ->-> | 524147 | 524338 | 192 | 29.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 201 | AA00764 | hemoglobin binding protein A | AA00766 | heat shock protein B25.3 (HSP-70 cofactor) | ->-> | 527408 | 527523 | 116 | 37.9% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 202 | AA00776 | conserved hypothetical protein | AA00777 | soluble lytic murein transglycosylase | ->-> | 533930 | 534458 | 529 | 42% | 0 | 0 | 0 | +: 0/0/0 | -: 0/3/0 | 6 | 0 | 0 | 0 | Result | |
| 203 | AA00780 | monofunctional biosynthetic peptidoglycan transglycosylase | AA00781 | hypothetical protein | ->-> | 537765 | 538026 | 262 | 29.4% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 204 | AA00781 | hypothetical protein | AA00782 | conserved hypothetical protein | ->-> | 538279 | 538862 | 584 | 39.4% | 0 | 0 | 0 | +: 0/3/0 | -: 1/2/1 | 1 | 0 | 0 | 0 | Result | |
| 206 | AA00807 | fumarate reductase 13 kD hydrophobic protein | AA00809 | possible oxidoreductase | ->-> | 553249 | 553350 | 102 | 39.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 207 | AA00809 | possible oxidoreductase | AA00810 | alcohol dehydrogenase | ->-> | 555496 | 555765 | 270 | 30% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 208 | AA00811 | conserved hypothetical protein | AA00812 | ATPase (PP-loop superfamily), confers aluminum resistance | ->-> | 558088 | 558214 | 127 | 21.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 209 | AA00813 | hypothetical protein | AA00814 | conserved hypothetical protein | ->-> | 559082 | 559264 | 183 | 37.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 210 | AA00815 | conserved hypothetical protein | AA00816 | lacZ expression regulator | ->-> | 560524 | 561039 | 516 | 35.3% | 0 | 0 | 1 | +: 0/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 211 | AA00817 | MutT-family protein | AA00819 | D-alanyl-D-alanine carboxypeptidase | ->-> | 562536 | 562783 | 248 | 34.3% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 212 | AA00820 | succinyl-diaminopimelate desuccinylase | AA00822 | conserved hypothetical protein (possible arsenate reductase) | ->-> | 564597 | 564735 | 139 | 48.9% | 0 | 0 | 0 | +: 1/2/1 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 213 | AA00825 | P-protein (chorismate mutase/prephenate dehydratase) | AA00826 | UDP-3-O-acyl-GlcNAc deacetylase | ->-> | 568318 | 568517 | 200 | 26% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 215 | AA00847 | S-adenosyl-dependent methyltransferase | AA00849 | MraZ cell division protein | ->-> | 586066 | 586177 | 112 | 37.5% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 216 | AA00851 | carbon starvation protein | AA00852 | hypothetical protein | ->-> | 588496 | 588677 | 182 | 33.5% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 217 | AA00853 | hypothetical protein | AA00854 | arginine transport system permease protein | ->-> | 588920 | 589037 | 118 | 33.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 218 | AA00858 | arginine ABC transporter, ATP-binding protein | AA00860 | phosphoheptose isomerase | ->-> | 591863 | 592005 | 143 | 25.9% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 219 | AA00860 | phosphoheptose isomerase | AA00861 | transcription repair coupling factor | ->-> | 592588 | 592691 | 104 | 38.5% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 220 | AA00861 | transcription repair coupling factor | AA00862 | conserved hypothetical protein | ->-> | 596211 | 596604 | 394 | 44.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 5 | 0 | 0 | 0 | Result | |
| 221 | AA00864 | conserved hypothetical protein | AA00865 | conserved hypothetical protein | ->-> | 599444 | 599612 | 169 | 36.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 222 | AA00866 | conserved hypothetical protein | AA00867 | fimbrial protein Flp precursor | ->-> | 600311 | 600781 | 471 | 26.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 225 | AA00882 | hypothetical protein | AA00883 | hypothetical protein | ->-> | 613706 | 614437 | 732 | 36.9% | 0 | 0 | 0 | +: 1/1/1 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 226 | AA00884 | sodium-dependent transporter | AA00885 | ribosomal large subunit pseudouridine synthase c | ->-> | 616032 | 616446 | 415 | 26.3% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 227 | AA00900 | conserved hypothetical protein | AA00902 | RNA polymerase sigma-E factor sigma-24 | ->-> | 623834 | 623968 | 135 | 30.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 228 | AA00914 | aminoacyl-histidine dipeptidase; Beta-alanyl-histidine dipeptidase | AA00915 | xanthine-guanine phosphoribosyltransferase | ->-> | 629636 | 629749 | 114 | 38.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 229 | AA00920 | DNA-3-methyladenine glycosylase I | AA00921 | conserved hypothetical protein | ->-> | 633274 | 633471 | 198 | 22.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 231 | AA00932 | ribose ABC transporter, periplasmic protein | AA00933 | ribose ABC transporter, ATP-binding protein | ->-> | 644256 | 644417 | 162 | 32.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 233 | AA00937 | L-xylulokinase | AA00938 | L-xylulokinase | ->-> | 647586 | 647695 | 110 | 46.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 234 | AA00939 | transcription accessory protein (toxin expression) | AA00940 | probable transcriptional regulator (LysR family) | ->-> | 650785 | 651003 | 219 | 33.3% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 235 | AA00940 | probable transcriptional regulator (LysR family) | AA00941 | symporter transmembrane protein | ->-> | 651889 | 651997 | 109 | 26.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 236 | AA00942 | related to phosphoglycerate mutase | AA00943 | conserved hypothetical protein | ->-> | 654076 | 654470 | 395 | 31.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 238 | AA00948 | probable ECF-family RNA polymerase sigma factor | AA00949 | hypothetical protein | ->-> | 656184 | 656359 | 176 | 26.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 239 | AA00949 | hypothetical protein | AA00950 | conserved hypothetical protein | ->-> | 656639 | 657061 | 423 | 35.2% | 0 | 0 | 7 | +: 0/3/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 240 | AA00957 | porphobilinogen deaminase (hydroxymethylbilane synthase) | AA00958 | adenylate cyclase | ->-> | 662004 | 662257 | 254 | 37.8% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
| 241 | AA00964 | phosphoenolpyruvate carboxykinase/carboxylase | AA00965 | hypothetical protein | ->-> | 674429 | 674537 | 109 | 25.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 242 | AA00967 | conserved hypothetical protein | AA00969 | conserved hypothetical protein (possible NADH pyrophosphatase) | ->-> | 675328 | 675468 | 141 | 28.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 243 | AA00971 | conserved hypothetical protein | AA00972 | DNA-binding protein HU-ALPHA | ->-> | 677936 | 678104 | 169 | 31.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 244 | AA00972 | DNA-binding protein HU-ALPHA | AA00973 | transcriptional regulator, DeoR family | ->-> | 678375 | 678502 | 128 | 34.4% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 245 | AA00974 | glucosamine-fructose-6-phosphate | AA00976 | conserved hypothetical protein | ->-> | 681188 | 681345 | 158 | 38.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 246 | AA00976 | conserved hypothetical protein | AA00977 | transcriptional regulator (LysR family) | ->-> | 682339 | 682506 | 168 | 33.9% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 247 | AA00977 | transcriptional regulator (LysR family) | AA00978 | conserved hypothetical protein | ->-> | 683395 | 683538 | 144 | 43.8% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 248 | AA00978 | conserved hypothetical protein | AA00979 | type B carboxylesterase; p-nitrobenzyl esterase | ->-> | 684646 | 684784 | 139 | 47.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 249 | AA00981 | carboxylesterase | AA00982 | aldo-keto reductase | ->-> | 686438 | 686665 | 228 | 38.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 250 | AA00983 | aldo-keto reductase | AA00985 | transcriptional regulator (LysR family) | ->-> | 688553 | 688910 | 358 | 44.7% | 0 | 0 | 0 | +: 0/5/0 | -: 1/1/0 | 2 | 0 | 0 | 0 | Result | |
| 251 | AA00987 | tetracenomycin polyketide synthesis O-methyltransferase | AA00988 | conserved hypothetical protein | ->-> | 690647 | 691037 | 391 | 43.2% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 2 | 0 | 0 | 0 | Result | |
| 253 | AA00993 | possible D-tyrosyl-tRNA(Tyr) deacylase | AA00994 | sodium/glutamate symport carrier protein (glutamate permease) | ->-> | 695060 | 695227 | 168 | 35.1% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 254 | AA00995 | sensory transduction protein for cpxR/basR | AA00997 | response regulatory protein | ->-> | 697737 | 697927 | 191 | 27.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 255 | AA01001 | conserved hypothetical protein | AA01003 | conserved hypothetical protein | ->-> | 700035 | 700259 | 225 | 36% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 256 | AA01005 | conserved hypothetical protein | AA01006 | conserved hypothetical protein (possible cytosine deaminas) | ->-> | 702259 | 702519 | 261 | 33.7% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 258 | AA01008 | mazG beta-lactamase regulatory protein homolog | AA01009 | universal stress protein A | ->-> | 704474 | 704582 | 109 | 31.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 259 | AA01009 | universal stress protein A | AA01010 | hypothetical protein | ->-> | 705006 | 705178 | 173 | 32.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 260 | AA01011 | alanyl-tRNA synthetase (alanine--tRNA ligase) | AA01012 | probable carbon storage regulator homolog | ->-> | 707830 | 707954 | 125 | 29.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 261 | AA01014 | UTP-glucose-1-phosphate uridylyltransferase | AA01015 | met repressor | ->-> | 710494 | 710650 | 157 | 35% | 0 | 0 | 0 | +: 1/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 263 | AA01021 | hypothetical protein | AA01022 | tRNA (5-methylaminomethyl-2-thiouridylate) methyltransferase | ->-> | 714337 | 714828 | 492 | 41.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 264 | AA01022 | tRNA (5-methylaminomethyl-2-thiouridylate) methyltransferase | AA01023 | conserved hypothetical protein | ->-> | 715978 | 716240 | 263 | 32.7% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 266 | AA01039 | transcriptional regulator (possible murein gene regulator) | AA01040 | possible lipoprotein | ->-> | 724313 | 724415 | 103 | 33% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 268 | AA01044 | A/G-specific adenine glycosylase | AA01045 | S-adenosylmethionine-dependent methyltransferase | ->-> | 728039 | 728203 | 165 | 41.2% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 269 | AA01046 | conserved hypothetical protein | AA01048 | iron binding protein afuA, periplasmic protein | ->-> | 729341 | 729561 | 221 | 24.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 270 | AA01062 | ribonuclease PH (RNase PH) | AA01063 | conserved hypothetical protein | ->-> | 736560 | 736676 | 117 | 34.2% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 271 | AA01069 | translation elongation factor (EF-Ts) | AA01070 | DNA repair protein | ->-> | 740761 | 741059 | 299 | 41.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 272 | AA01070 | DNA repair protein | AA01071 | RNA methyltransferase | ->-> | 741744 | 741846 | 103 | 46.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 273 | AA01075 | hypothetical protein | AA01076 | hypothetical protein | ->-> | 746129 | 746304 | 176 | 37.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 4 | 0 | 0 | 0 | Result | |
| 274 | AA01086 | hypothetical protein | AA01087 | DNA polymerase III, delta subunit | ->-> | 751652 | 752008 | 357 | 26.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 275 | AA01102 | pyrimidine operon regulatory protein | AA01104 | conserved hypothetical protein | ->-> | 761154 | 761294 | 141 | 37.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 276 | AA01104 | conserved hypothetical protein | AA01106 | conserved hypothetical protein | ->-> | 761703 | 761814 | 112 | 40.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 277 | AA01109 | oxidoreductase (possible short-chain alcohol dehydrogenase) | AA01111 | conserved hypothetical protein | ->-> | 764786 | 764904 | 119 | 34.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 278 | AA01113 | transcriptional regulator (merR family) | AA01114 | alcohol dehydrogenase, class III; glutathione-dependent formaldehyde dehydrogenase | ->-> | 765310 | 765446 | 137 | 34.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 279 | AA01114 | alcohol dehydrogenase, class III; glutathione-dependent formaldehyde dehydrogenase | AA01115 | carboxylesterase | ->-> | 766569 | 766684 | 116 | 39.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 280 | AA01115 | carboxylesterase | AA01116 | hypothetical protein | ->-> | 767414 | 767768 | 355 | 42.3% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 281 | AA01116 | hypothetical protein | AA01117 | signal recognition particle protein 54 (GTP-binding export factor) | ->-> | 767901 | 768058 | 158 | 38% | 0 | 0 | 0 | +: 0/1/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 282 | AA01123 | possible hemolysin; membrane protein | AA01124 | biopolymer transport protein | ->-> | 771718 | 771894 | 177 | 29.4% | 0 | 0 | 0 | +: 1/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 283 | AA01127 | energy transducer protein | AA01128 | hypothetical protein | ->-> | 773581 | 774169 | 589 | 36% | 0 | 0 | 1 | +: 0/3/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 284 | AA01128 | hypothetical protein | AA01129 | hypothetical protein | ->-> | 774263 | 774752 | 490 | 36.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 286 | AA01132 | possible cell filamentation protein | AA01133 | conserved hypothetical protein | ->-> | 775968 | 776662 | 695 | 31.7% | 0 | 0 | 3 | +: 1/4/3 | -: 1/3/0 | 2 | 0 | 0 | 0 | Result | |
| 287 | AA01134 | conserved hypothetical protein | AA01135 | possible cell filamentation protein | ->-> | 777348 | 777520 | 173 | 27.2% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 288 | AA01135 | possible cell filamentation protein | AA01136 | hypothetical protein | ->-> | 777725 | 778424 | 700 | 36.7% | 0 | 1 | 3 | +: 2/5/6 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 289 | AA01136 | hypothetical protein | AA01137 | anaerobic dimethyl sulfoxide reductase, chain A | ->-> | 778563 | 778699 | 137 | 33.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 290 | AA01146 | conserved hypothetical protein | AA01147 | nucleotidyltransferase | ->-> | 784831 | 784999 | 169 | 36.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 291 | AA01149 | glycyl-tRNA synthetase beta subunit | AA01151 | porphobilinogen synthase (delta-aminolevulinic acid dehydratase) | ->-> | 788246 | 788462 | 217 | 39.2% | 0 | 0 | 0 | +: 0/3/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 292 | AA01154 | sec-independent protein translocase protein | AA01155 | hypothetical protein | ->-> | 791194 | 791366 | 173 | 38.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 293 | AA01155 | hypothetical protein | AA01156 | chaperonin heat shock protein 33 homolog | ->-> | 791472 | 791598 | 127 | 43.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 294 | AA01162 | conserved hypothetical protein (possible transmembrane protein) | AA01164 | conserved hypothetical protein (possible integral membrane protein) | ->-> | 795837 | 796129 | 293 | 28.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 295 | AA01167 | glucose-6-phosphate 1-dehydrogenase | AA01168 | 6-phosphogluconolactonase | ->-> | 801128 | 801382 | 255 | 50.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 4 | 0 | 0 | 0 | Result | |
| 296 | AA01169 | hypothetical protein | AA01170 | hypothetical protein | ->-> | 802290 | 802603 | 314 | 34.4% | 0 | 0 | 2 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 297 | AA01170 | hypothetical protein | AA01171 | LysA activator protein | ->-> | 802700 | 802950 | 251 | 32.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 298 | AA01173 | VapD-homolog | AA01174 | hypothetical protein | ->-> | 804446 | 804839 | 394 | 44.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 5 | 0 | 0 | 0 | Result | |
| 299 | AA01176 | hypothetical protein | AA01177 | beta-ketoacyl-ACP synthase IV | ->-> | 806578 | 806871 | 294 | 31% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 300 | AA01199 | conserved hypothetical protein | AA01201 | phosphatase; hydrolase | ->-> | 822547 | 822652 | 106 | 41.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 302 | AA01212 | hypothetical protein | AA01213 | competence related protein | ->-> | 829874 | 830006 | 133 | 31.6% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 303 | AA01215 | aspartate-semialdehyde dehydrogenase | AA01216 | conserved hypothetical protein | ->-> | 831774 | 831959 | 186 | 32.3% | 0 | 0 | 0 | +: 0/0/0 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
| 304 | AA01220 | competence protein F; amidophosphoribosyltransferase | AA01221 | transformation locus protein orfG homolog | ->-> | 833599 | 833717 | 119 | 34.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 305 | AA01222 | hypothetical protein | AA01223 | branched-chain amino acid carrier protein | ->-> | 834447 | 834801 | 355 | 38.3% | 0 | 1 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 306 | AA01223 | branched-chain amino acid carrier protein | AA01224 | CTP synthase | ->-> | 836215 | 836360 | 146 | 37.7% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 309 | AA01227 | hypothetical protein | AA01228 | 50S ribosomal protein L14 | ->-> | 838906 | 839036 | 131 | 45.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 2 | 28 | 131 | Result | taggttcgtcccgcaagggtggttttttaatttaacggagcactaatatgatccaagaacagactatgctggatgttgctgataactcaggggctcgtagcgta |
| 310 | AA01238 | 50S ribosomal protein L36 | AA01239 | 30S ribosomal protein S13 | ->-> | 844499 | 844642 | 144 | 35.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 5 | 5 | 119 | Result | tgatatttttcttgcaaagaacaggttgggtagatatactgcctagctcatttatttccttgacactctgtttgagtatcctgaaaacgggcttttcaagatcagagtgtcaact |
| 313 | AA01250 | nadAB transcriptional regulator | AA01251 | hypothetical protein | ->-> | 851841 | 851964 | 124 | 37.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 314 | AA01251 | hypothetical protein | AA01252 | conserved hypothetical protein (probable SirA homolog) | ->-> | 852055 | 852162 | 108 | 32.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 322 | AA01263 | hypothetical protein | AA01264 | conserved hypothetical protein | ->-> | 861147 | 862002 | 856 | 33.9% | 0 | 0 | 9 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 323 | AA01271 | hypothetical protein | AA01272 | hypothetical protein | ->-> | 864042 | 864178 | 137 | 37.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 324 | AA01272 | hypothetical protein | AA01273 | hypothetical protein | ->-> | 864272 | 864501 | 230 | 41.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 325 | AA01276 | heptosyltransferase III | AA01277 | aspartate ammonia-lyase | ->-> | 865905 | 866088 | 184 | 38.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 327 | AA01280 | groES chaperonin | AA01284 | heat shock protein (hsp60) | ->-> | 868591 | 868713 | 123 | 39.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 329 | AA01288 | hypothetical protein | AA01289 | hypothetical protein | ->-> | 872349 | 872524 | 176 | 37.5% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 4 | 0 | 0 | 0 | Result | |
| 330 | AA01292 | single-stranded DNA binding protein | AA01294 | DNA adenine methylase | ->-> | 876444 | 876554 | 111 | 34.2% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 331 | AA01296 | shikimate kinase (shikimic acid kinase I) | AA01297 | competence protein E precursor | ->-> | 879013 | 879264 | 252 | 32.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 332 | AA01303 | competence protein A | AA01304 | penicillin-binding protein 1A | ->-> | 882943 | 883075 | 133 | 29.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 333 | AA01306 | glutathione reductase | AA01308 | cyclic AMP receptor protein | ->-> | 888046 | 888183 | 138 | 34.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 334 | AA01317 | probable DNA repair protein | AA01318 | hypothetical protein | ->-> | 891800 | 892221 | 422 | 35.8% | 0 | 0 | 0 | +: 0/4/0 | -: 0/4/0 | 1 | 0 | 0 | 0 | Result | |
| 335 | AA01318 | hypothetical protein | AA01319 | transcriptional regulatory protein | ->-> | 892474 | 892591 | 118 | 33.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 336 | AA01320 | hypothetical protein | AA01321 | DNA repair protein | ->-> | 893600 | 893713 | 114 | 33.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 337 | AA01321 | DNA repair protein | AA01323 | 50S ribosomal protein L28 | ->-> | 894176 | 894386 | 211 | 36% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 5 | 55 | 211 | Result | atttaggcttgagaatacaagataaagtgagtataatgcacgacctttaatatagtacgcgggtcgggttgcgacctgacgaggtcactctcaaaagttatttttgaagtattccgaaccgtaagctcgagcttatatttcattattggagattaat |
| 338 | AA01331 | 50S ribosomal protein L31 | AA01332 | galactosyltransferase II | ->-> | 898782 | 899014 | 233 | 41.2% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 339 | AA01334 | HtrL protein involved in lipopolysaccharide biosynthesis (ADP-L-glycero-D-mannoheptose-6-epimerase) | AA01335 | primosomal protein N' | ->-> | 901747 | 902132 | 386 | 44.3% | 0 | 1 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 340 | AA01341 | acriflavine resistance protein | AA01342 | conserved hypotheticl protein (possible ribosomal RNA adenine dimethylase) | ->-> | 910192 | 910347 | 156 | 36.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 341 | AA01342 | conserved hypotheticl protein (possible ribosomal RNA adenine dimethylase) | AA01344 | magnesium and cobalt transport protein | ->-> | 911146 | 911800 | 655 | 42% | 0 | 0 | 0 | +: 1/6/2 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
| 342 | AA01351 | probable sulfatase | AA01354 | conserved hypothetical protein | ->-> | 916454 | 916628 | 175 | 40% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 343 | AA01355 | large subunit pseudouridylate synthase D | AA01356 | lipooligosaccharide galactosyltransferase II (comL related) | ->-> | 918340 | 918445 | 106 | 29.2% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 344 | AA01357 | 5-formyltetrahydrofolate cyclo-ligase-family protein | AA01358 | conserved hypothetical protein | ->-> | 919846 | 920141 | 296 | 41.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 1 | 47 | 215 | Result | gtccttgaaccctacggttcaagggaattagttgaaatcatttttaggcttcttagtcgagctaagcctgcacaccaatgacaggaaaccaattcataagattaaaagtatcggctcagggacgtaacccactggcgaacacctcaggaaattcttttacttaatacta |
| 345 | AA01358 | conserved hypothetical protein | AA01359 | conserved hypothetical protein | ->-> | 920448 | 920623 | 176 | 41.5% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 346 | AA01360 | XAA-pro aminopeptidase (X-pro aminopeptidase) | AA01363 | hypothetical protein | ->-> | 922486 | 922644 | 159 | 35.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 347 | AA01368 | 50S ribosomal protein L19 | AA01369 | rod shape-determining protein | ->-> | 924973 | 925087 | 115 | 32.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 348 | AA01371 | rod shape-determining protein | AA01372 | ribonuclease r, virulence associated protein | ->-> | 927772 | 928020 | 249 | 33.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 349 | AA01378 | glycerol-3-phosphatase transporter | AA01379 | glycerophosphoryl diester phosphodiesterase (protein D) | ->-> | 932933 | 933168 | 236 | 47.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 350 | AA01390 | LexA repressor | AA01391 | glycerol-3-phosphate acyltransferase | ->-> | 937820 | 938026 | 207 | 30% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 352 | AA01394 | transcriptional regulator (mtr efflux pump) | AA01395 | conserved hypothetical protein | ->-> | 943272 | 943458 | 187 | 32.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 353 | AA01395 | conserved hypothetical protein | AA01396 | saccharide biosynthesis regulatory protein | ->-> | 943798 | 943899 | 102 | 37.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/4/0 | 1 | 0 | 0 | 0 | Result | |
| 354 | AA01402 | beta 1-4 glucosyltransferase | AA01404 | hypothetical protein | ->-> | 948443 | 948717 | 275 | 38.5% | 0 | 0 | 1 | +: 0/1/0 | -: 0/1/0 | 3 | 0 | 0 | 0 | Result | |
| 355 | AA01404 | hypothetical protein | AA01407 | outer membrane antigenic lipoprotein b precursor | ->-> | 948895 | 949144 | 250 | 40.8% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 2 | 0 | 0 | 0 | Result | |
| 356 | AA01418 | conserved hypothetical protein | AA01419 | D-ribulose-phosphate-3 epimerase | ->-> | 954367 | 954517 | 151 | 39.7% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 357 | AA01421 | phosphoglycolate phosphatase | AA01422 | cell division protein E, ABC system ATP-binding protein | ->-> | 955867 | 956148 | 282 | 47.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 358 | AA01423 | cell division protein X, ABC system permease | AA01424 | threonine deaminase (dehydratase) | ->-> | 957741 | 957879 | 139 | 44.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 359 | AA01426 | threonine deaminase (dehydratase) | AA01428 | acetolactate synthase | ->-> | 958716 | 958827 | 112 | 50% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 360 | AA01429 | conserved hypothetical protein | AA01431 | conserved hypothetical protein (possible hydrolase) | ->-> | 959853 | 959995 | 143 | 25.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 362 | AA01441 | tRNA/rRNA methylase | AA01442 | phosphatidylserine synthetase | ->-> | 967704 | 967888 | 185 | 33% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 364 | AA01445 | hypothetical protein | AA01446 | conserved hypothetical protein | ->-> | 970168 | 970290 | 123 | 42.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 367 | AA01453 | D-xylose isomerase | AA01455 | D-xylose ABC transporter, periplasmic-binding protein | ->-> | 974914 | 975170 | 257 | 37% | 0 | 0 | 0 | +: 1/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 368 | AA01464 | hypothetical protein | AA01465 | mannose-specific phosphotransferase element | ->-> | 984464 | 984611 | 148 | 33.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 369 | AA01467 | mannose-specific phosphotransferase system IID | AA01471 | type I restriction enzyme M (modification chain) | ->-> | 987275 | 987460 | 186 | 39.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 370 | AA01473 | type I restriction-modification system S (specificity subunit) | AA01474 | hypothetical protein | ->-> | 990293 | 990398 | 106 | 35.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 371 | AA01477 | type I restriction enzyme R protein | AA01478 | hypothetical protein | ->-> | 994540 | 994690 | 151 | 30.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 372 | AA01491 | conserved hypothetical protein | AA01492 | glucose inhibited division protein B | ->-> | 1002832 | 1002945 | 114 | 27.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 373 | AA01494 | conserved hypothetical protein | AA01495 | probable oxidoreductase | ->-> | 1003982 | 1004231 | 250 | 29.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 374 | AA01495 | probable oxidoreductase | AA01496 | glucose inhibited division protein A | ->-> | 1004988 | 1005264 | 277 | 39% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 375 | AA01496 | glucose inhibited division protein A | AA01497 | MioC protein | ->-> | 1007152 | 1007596 | 445 | 30.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 376 | AA01498 | conserved hypothetical protein | AA01499 | fructose 1,6-bisphosphatase protein | ->-> | 1008313 | 1008496 | 184 | 25.5% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 377 | AA01499 | fructose 1,6-bisphosphatase protein | AA01500 | hypothetical protein | ->-> | 1009508 | 1009855 | 348 | 33.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 378 | AA01507 | conserved hypothetical protein | AA01508 | anaerobic C4-dicarboxylate transporter | ->-> | 1013071 | 1013337 | 267 | 26.2% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 379 | AA01508 | anaerobic C4-dicarboxylate transporter | AA01509 | ABC system transport protein, ATP binding/permease | ->-> | 1014658 | 1014831 | 174 | 27.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 380 | AA01510 | ABC transporter, ATP-binding protein/permease | AA01511 | probable transcriptional regulator | ->-> | 1018226 | 1018342 | 117 | 31.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 381 | AA01513 | hydrogen peroxide-inducible activator | AA01514 | peroxiredoxin 2 family protein/glutaredoxin | ->-> | 1019872 | 1020029 | 158 | 27.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 382 | AA01528 | probable oxidoreductase | AA01530 | conserved hypothetical protein | ->-> | 1027321 | 1027447 | 127 | 38.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 383 | AA01534 | conserved hypothetical protein (possible GTP pyrophosphokinase) | AA01537 | possible glucokinase regulatory protein | ->-> | 1030639 | 1030755 | 117 | 38.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 384 | AA01544 | conserved hypothetical protein | AA01546 | deoxyribose operon repressor | ->-> | 1035494 | 1035633 | 140 | 35.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 385 | AA01547 | deoxyribose-phosphate aldolase | AA01549 | hypothetical protein | ->-> | 1037080 | 1037583 | 504 | 37.5% | 0 | 0 | 1 | +: 0/2/0 | -: 0/0/0 | 3 | 0 | 0 | 0 | Result | |
| 386 | AA01549 | hypothetical protein | AA01550 | hypothetical protein | ->-> | 1037941 | 1038175 | 235 | 31.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 387 | AA01551 | hypothetical protein | AA01552 | hypothetical protein | ->-> | 1038435 | 1039132 | 698 | 43.3% | 0 | 0 | 2 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 389 | AA01556 | ABC transporter ATP-binding protein | AA01557 | recombinase A | ->-> | 1044820 | 1045050 | 231 | 35.1% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 390 | AA01563 | transketolase isozyme 1 | AA01564 | transaldolase B | ->-> | 1049104 | 1049238 | 135 | 36.3% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/1 | 1 | 0 | 0 | 0 | Result | |
| 398 | AA01573 | peptide transport periplasmic protein | AA01575 | conserved hypothetical protein | ->-> | 1061515 | 1061803 | 289 | 36% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 399 | AA01584 | host factor-I protein | AA01585 | tRNA delta(2)-isopentenylpyrophosphate | ->-> | 1066026 | 1066146 | 121 | 32.2% | 0 | 0 | 0 | +: 0/0/0 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
| 403 | AA01598 | conserved hypothetical protein | AA01599 | phosphocarrier protein HPr | ->-> | 1080027 | 1080249 | 223 | 24.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 404 | AA01599 | phosphocarrier protein HPr | AA01600 | phosphotransferase system enzyme I | ->-> | 1080505 | 1080620 | 116 | 32.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 405 | AA01601 | PTS system, glucose-specific IIA componen | AA01603 | oligopeptidase A | ->-> | 1082907 | 1083037 | 131 | 36.6% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 406 | AA01603 | oligopeptidase A | AA01604 | conserved hypothetical protein | ->-> | 1085075 | 1085185 | 111 | 25.2% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 407 | AA01607 | oligopeptide transporter, periplasmic-binding protein | AA01608 | conserved hypothetical protein | ->-> | 1087173 | 1087452 | 280 | 31.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 408 | AA01611 | anthranilate synthase component II | AA01614 | D-isomer specific 2-hydroxyacid dehydrogenase family protein | ->-> | 1089680 | 1089837 | 158 | 39.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 409 | AA01614 | D-isomer specific 2-hydroxyacid dehydrogenase family protein | AA01615 | lipoprotein releasing system transmembrane | ->-> | 1090780 | 1091325 | 546 | 37.2% | 0 | 0 | 0 | +: 1/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 410 | AA01618 | lipoprotein releasing system transmembrane protein | AA01619 | phospho-2-dehydro-3-deoxyheptonate aldolase (DAHP synthase) | ->-> | 1094459 | 1094561 | 103 | 29.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 411 | AA01624 | glucose-6-phosphate isomerase | AA01625 | riboflavin synthase, beta chain | ->-> | 1099962 | 1100103 | 142 | 36.6% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 412 | AA01631 | dihydrodipicolinate reductase | AA01633 | probable ferredoxin-like protein | ->-> | 1103976 | 1104147 | 172 | 39.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 413 | AA01635 | ribonucleoside diphosphate reductase, beta chain | AA01636 | conserved hypothetical protein | ->-> | 1105883 | 1106086 | 204 | 30.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 414 | AA01637 | ribonucleoside diphosphate reductase | AA01639 | hypothetical protein | ->-> | 1109065 | 1109275 | 211 | 25.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 415 | AA01654 | periplasmic maltose-binding protein precursor | AA01655 | hypothetical protein | ->-> | 1121224 | 1121326 | 103 | 47.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 416 | AA01655 | hypothetical protein | AA01656 | maltose/maltodextrin transport ATP-binding protein | ->-> | 1121447 | 1121679 | 233 | 28.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 417 | AA01660 | hypothetical protein | AA01661 | molybdopterin biosynthesis protein | ->-> | 1125343 | 1125523 | 181 | 40.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 418 | AA01662 | molybdopterin biosynthesis protein | AA01663 | GTP cyclohydrolase I | ->-> | 1127483 | 1127610 | 128 | 31.2% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 419 | AA01663 | GTP cyclohydrolase I | AA01666 | penicillin-binding protein 4; D-alanyl-D-alanine carboxypeptidase; D-alanyl-D-alanine-endopeptidase | ->-> | 1128265 | 1128370 | 106 | 34.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 420 | AA01666 | penicillin-binding protein 4; D-alanyl-D-alanine carboxypeptidase; D-alanyl-D-alanine-endopeptidase | AA01668 | transcription elongation factor | ->-> | 1129682 | 1129969 | 288 | 41.3% | 0 | 0 | 0 | +: 1/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 421 | AA01670 | conserved hypothetical protein | AA01671 | conserved hypothetical protein | ->-> | 1130822 | 1130988 | 167 | 28.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 422 | AA01675 | probable multidrug resistance protein; multidrug-efflux transporter | AA01678 | possible transcriptional regulator | ->-> | 1133650 | 1133958 | 309 | 35% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
| 423 | AA01689 | conserved hypothetical protein (possible inner membrane protein) | AA01690 | penicillin-binding protein 1C | ->-> | 1146726 | 1146847 | 122 | 25.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 424 | AA01690 | penicillin-binding protein 1C | AA01692 | hexulose-6-phosphate synthase | ->-> | 1149203 | 1149317 | 115 | 37.4% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 425 | AA01695 | carbohydrate transport protein | AA01696 | conserved hypothetical protein | ->-> | 1152355 | 1152701 | 347 | 23.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 426 | AA01704 | tyrosine-specific transport protein | AA01705 | beta-galactosidase | ->-> | 1157522 | 1157782 | 261 | 35.2% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 427 | AA01705 | beta-galactosidase | AA01708 | glutaredoxin | ->-> | 1158041 | 1158275 | 235 | 39.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 428 | AA01715 | conserved hypothetical protein | AA01717 | fumarate hydratase, class II | ->-> | 1161223 | 1161328 | 106 | 32.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 429 | AA01717 | fumarate hydratase, class II | AA01718 | DNA polymerase III, chi subunit | ->-> | 1162721 | 1162929 | 209 | 34.4% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 430 | AA01722 | conserved hypothetical protein | AA01723 | conserved hypothetical protein | ->-> | 1163700 | 1163908 | 209 | 22.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 431 | AA01723 | conserved hypothetical protein | AA01724 | valyl-tRNA synthetase | ->-> | 1164335 | 1164585 | 251 | 44.2% | 0 | 1 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 432 | AA01730 | conserved hypothetical protein (possible transcriptional regulator) | AA01731 | multidrug resistance protein B | ->-> | 1169144 | 1169289 | 146 | 24.7% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 433 | AA01733 | hypothetical protein | AA01734 | DNA-binding protein; DPS family protein | ->-> | 1172052 | 1172182 | 131 | 28.2% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 434 | AA01739 | conserved hypothetical protein | AA01740 | conserved hypothetical protein | ->-> | 1176573 | 1176697 | 125 | 32.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 435 | AA01741 | 6-pyruvoyl tetrahydrobiopterin synthase | AA01743 | lysyl-tRNA synthetase | ->-> | 1177756 | 1177947 | 192 | 34.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 436 | AA01743 | lysyl-tRNA synthetase | AA01744 | peptide chain release factor RF-2 | ->-> | 1179412 | 1179512 | 101 | 31.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 438 | AA01750 | MTA/SAH nucleosidase [Includes: 5'-methylthioadenosine nucleosidase; S-adenosylhomocysteine nucleosidase] | AA01751 | conserved hypothetical protein | ->-> | 1184580 | 1184759 | 180 | 36.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 440 | AA01763 | conserved hypothetical protein (possible transcriptional regulatory protein) | AA01764 | hypothetical protein | ->-> | 1190879 | 1191665 | 787 | 32.3% | 0 | 0 | 1 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 442 | AA01770 | hypothetical protein | AA01772 | shikimate 5-dehydrogenase protein | ->-> | 1193458 | 1194189 | 732 | 30.9% | 0 | 0 | 0 | +: 0/2/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
| 443 | AA01774 | 5,10-methylenetetrahydrofolate reductase | AA01775 | hypothetical protein | ->-> | 1196037 | 1196140 | 104 | 28.8% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 444 | AA01777 | conserved hypothetical protein | AA01778 | aminopeptidase A/I; cytosol aminopeptidase; leucyl aminopeptidase | ->-> | 1198402 | 1198537 | 136 | 27.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 445 | AA01778 | aminopeptidase A/I; cytosol aminopeptidase; leucyl aminopeptidase | AA01779 | molybdenum ABC transporter, ATP-binding protein | ->-> | 1200026 | 1200175 | 150 | 38.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 446 | AA01781 | molybdenum ABC transporter, periplasmic substrate-binding | AA01782 | molybdenum transport protein; transcriptional regulator | ->-> | 1202793 | 1203018 | 226 | 32.7% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 447 | AA01782 | molybdenum transport protein; transcriptional regulator | AA01784 | sodium-dependent transporter | ->-> | 1203796 | 1203964 | 169 | 33.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 449 | AA01794 | glycine cleavage system transcription activator | AA01796 | branched-chain amino acid aminotransferase | ->-> | 1210751 | 1211211 | 461 | 31.2% | 0 | 0 | 0 | +: 1/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 450 | AA01798 | hypothetical protein | AA01799 | polysacharide biosynthesis protein (Orf14 of cluster) | ->-> | 1212396 | 1212598 | 203 | 25.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 452 | AA01804 | sugar nucleotide epimerase; cell division inhibitor | AA01805 | electron transport complex protein | ->-> | 1216062 | 1216254 | 193 | 36.3% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 453 | AA01813 | electron transport complex protein | AA01814 | endonuclease III | ->-> | 1221872 | 1222020 | 149 | 29.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 454 | AA01816 | hypothetical protein | AA01817 | hypothetical protein | ->-> | 1224195 | 1224364 | 170 | 37.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 455 | AA01818 | high-affinity zinc uptake system membrane protein | AA01820 | high-affinity zinc uptake system ATP-binding protein | ->-> | 1225139 | 1225242 | 104 | 46.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 456 | AA01820 | high-affinity zinc uptake system ATP-binding protein | AA01822 | lysostaphin precursor | ->-> | 1226014 | 1226201 | 188 | 27.1% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 457 | AA01832 | formate dehydrogenase formation protein E | AA01834 | hypothetical protein | ->-> | 1234664 | 1234779 | 116 | 36.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 458 | AA01835 | conserved hypothetical protein | AA01837 | transcriptional regulatory protein | ->-> | 1235450 | 1235589 | 140 | 37.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 459 | AA01841 | conserved hypothetical protein | AA01842 | conserved hypothetical protein | ->-> | 1237924 | 1238410 | 487 | 37.4% | 0 | 0 | 1 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 460 | AA01845 | gamma-glutamyltranspeptidase precursor | AA01846 | conserved hypothetical protein | ->-> | 1241748 | 1241982 | 235 | 31.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 461 | AA01846 | conserved hypothetical protein | AA01848 | argininosuccinate synthetase | ->-> | 1242226 | 1242417 | 192 | 38.5% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/1 | 1 | 0 | 0 | 0 | Result | |
| 462 | AA01850 | conserved hypothetical protein; possible enzyme of sugar metabolism | AA01851 | hypothetical protein | ->-> | 1244675 | 1244862 | 188 | 31.9% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 463 | AA01857 | glutamate-ammonia-ligase adenylyltransferase | AA01858 | conserved hypothetical protein | ->-> | 1250418 | 1250838 | 421 | 42.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 464 | AA01858 | conserved hypothetical protein | AA01859 | hypothetical protein | ->-> | 1251598 | 1251857 | 260 | 39.6% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 465 | AA01868 | biotin synthetase | AA01869 | periplasmic serine protease do; hhoA-like precursor; heat shock protein | ->-> | 1256687 | 1256789 | 103 | 40.8% | 0 | 0 | 0 | +: 0/3/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 466 | AA01869 | periplasmic serine protease do; hhoA-like precursor; heat shock protein | AA01871 | conserved hypothetical protein | ->-> | 1258170 | 1258362 | 193 | 32.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 467 | AA01871 | conserved hypothetical protein | AA01872 | conserved hypothetical protein | ->-> | 1258771 | 1258943 | 173 | 30.6% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 468 | AA01873 | mannose-6-phosphate isomerase | AA01874 | conserved hypothetical protein | ->-> | 1262001 | 1262175 | 175 | 39.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 469 | AA01874 | conserved hypothetical protein | AA01875 | PTS system, glucose-specific enzyme II, A component | ->-> | 1262512 | 1262702 | 191 | 28.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 470 | AA01878 | hydroxyacylglutathione hydrolase | AA01879 | glutamyl-tRNA reductase | ->-> | 1265670 | 1265856 | 187 | 33.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 473 | AA01881 | adenylate kinase | AA01883 | recycling protein; permease | ->-> | 1269826 | 1269960 | 135 | 37.8% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 474 | AA01886 | UDP-glucose-4-epimerase | AA01887 | conserved hypothetical protein (possible cytochrome | ->-> | 1272618 | 1272810 | 193 | 33.7% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 475 | AA01893 | acetyl-coenzyme-A carboxylase subunit A | AA01894 | conserved hypothetical protein (possible transthyretin-like periplasmic protein) | ->-> | 1277933 | 1279106 | 1174 | 31.8% | 0 | 0 | 6 | +: 1/0/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 476 | AA01894 | conserved hypothetical protein (possible transthyretin-like periplasmic protein) | AA01895 | hypothetical protein | ->-> | 1279518 | 1279713 | 196 | 32.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 477 | AA01895 | hypothetical protein | AA01896 | hypothetical protein | ->-> | 1280662 | 1281100 | 439 | 31.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 480 | AA01902 | conserved hypothetical protein | AA01903 | hypothetical protein | ->-> | 1283677 | 1284122 | 446 | 41% | 0 | 0 | 0 | +: 0/2/0 | -: 1/4/0 | 1 | 0 | 0 | 0 | Result | |
| 481 | AA01903 | hypothetical protein | AA01904 | hypothetical protein | ->-> | 1284276 | 1284587 | 312 | 40.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 1 | 179 | 308 | Result | caaattgtctaaaattcaaaacaggttactgatgagtgcctttctttatgcttgtaaggctcaagccctcttgtatgcgactacagcgaggaatataatgctctctgcgactacaatttaatcagaggaa |
| 482 | AA01904 | hypothetical protein | AA01905 | hypothetical protein | ->-> | 1285110 | 1285445 | 336 | 30.7% | 0 | 0 | 0 | +: 0/0/0 | -: 1/2/1 | 1 | 0 | 0 | 0 | Result | |
| 483 | AA01906 | repressor protein CI | AA01908 | conserved hypothetical protein | ->-> | 1287108 | 1287207 | 100 | 24% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 484 | AA01909 | hypothetical protein | AA01911 | hypothetical protein | ->-> | 1287807 | 1287930 | 124 | 34.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 485 | AA01911 | hypothetical protein | AA01913 | GMP synthase | ->-> | 1288345 | 1288674 | 330 | 33.3% | 0 | 0 | 33 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 488 | AA01922 | translation initiation factor IF2 | AA01923 | type III restriction-modification system methylation subunit | ->-> | 1297340 | 1297626 | 287 | 34.5% | 0 | 0 | 4 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 489 | AA01923 | type III restriction-modification system methylation subunit | AA01925 | conserved hypothetical protein | ->-> | 1299997 | 1300100 | 104 | 45.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 490 | AA01928 | ATP-dependent RNA helicase | AA01930 | ribosome-binding factor A | ->-> | 1304748 | 1304851 | 104 | 33.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 491 | AA01934 | conserved hypothetical protein | AA01936 | tyrosyl-tRNA synthetase | ->-> | 1307054 | 1307182 | 129 | 44.2% | 0 | 0 | 0 | +: 0/3/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 492 | AA01936 | tyrosyl-tRNA synthetase | AA01937 | sugar fermentation stimulation protein | ->-> | 1308368 | 1308617 | 250 | 32.8% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
| 493 | AA01937 | sugar fermentation stimulation protein | AA01938 | NAD(P) transhydrogenase subunit alpha | ->-> | 1309395 | 1309632 | 238 | 29.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 494 | AA01943 | conserved hypothetical protein | AA01944 | conserved hypothetical protein | ->-> | 1313149 | 1313615 | 467 | 30.2% | 0 | 0 | 1 | +: 0/0/0 | -: 1/1/1 | 1 | 0 | 0 | 0 | Result | |
| 495 | AA01944 | conserved hypothetical protein | AA01945 | selenophosphate synthase | ->-> | 1314462 | 1315005 | 544 | 31.4% | 0 | 0 | 0 | +: 1/1/1 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 496 | AA01945 | selenophosphate synthase | AA01947 | iron(III)-transport ATP-binding protein | ->-> | 1316083 | 1316529 | 447 | 39.6% | 0 | 18 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 497 | AA01953 | hypothetical protein | AA01954 | excinuclease ABC, subunit C | ->-> | 1320410 | 1320607 | 198 | 39.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 498 | AA01954 | excinuclease ABC, subunit C | AA01956 | 3-deoxy-manno-octulosonate cytidylyltransferase | ->-> | 1322375 | 1322575 | 201 | 35.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 499 | AA01962 | recombination protein rec2 | AA01963 | dnaK suppressor protein | ->-> | 1328767 | 1329063 | 297 | 34.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 500 | AA01963 | dnaK suppressor protein | AA01965 | poly(A) polymerase | ->-> | 1329499 | 1329617 | 119 | 27.7% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 501 | AA01969 | hypothetical protein | AA01972 | phosphotransacetylase | ->-> | 1332226 | 1332358 | 133 | 27.1% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 502 | AA01973 | acetate kinase | AA01974 | conserved hypothetical protein | ->-> | 1335794 | 1336030 | 237 | 36.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 503 | AA01974 | conserved hypothetical protein | AA01976 | colicin V production protein | ->-> | 1336472 | 1336652 | 181 | 32.6% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 504 | AA01981 | 4-alpha-glucanotransferase | AA01982 | maltodextrin phosphorylase | ->-> | 1339415 | 1339526 | 112 | 44.6% | 0 | 0 | 0 | +: 0/3/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 505 | AA01982 | maltodextrin phosphorylase | AA01983 | maltose regulon positive regulatory protein | ->-> | 1341915 | 1342086 | 172 | 33.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 506 | AA01983 | maltose regulon positive regulatory protein | AA01984 | tellurite resistance protein; hemagglutinin homolog | ->-> | 1344799 | 1344956 | 158 | 34.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 507 | AA01984 | tellurite resistance protein; hemagglutinin homolog | AA01985 | pyruvate dehydrogenase, E1 component | ->-> | 1345815 | 1346206 | 392 | 26.5% | 0 | 0 | 0 | +: 1/1/1 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 508 | AA01988 | dihydrolipoamide dehydrogenase; lipoamide dehydrogenase | AA01989 | hypothetical protein | ->-> | 1352079 | 1352178 | 100 | 27% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 509 | AA01989 | hypothetical protein | AA01991 | conserved hypothetical protein (possible nitroreductase) | ->-> | 1352302 | 1352511 | 210 | 37.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 510 | AA01991 | conserved hypothetical protein (possible nitroreductase) | AA01992 | protease IV; signal peptide peptidase; Endopeptidase IV | ->-> | 1353064 | 1353168 | 105 | 36.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 511 | AA02000 | 2,3,4,5-tetrahydropyridine-2-carboxylate | AA02001 | conserved hypothetical protein | ->-> | 1359862 | 1359981 | 120 | 29.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 512 | AA02002 | hypothetical protein | AA02003 | purine nucleotide synthesis repressor protein | ->-> | 1360468 | 1360772 | 305 | 34.4% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 513 | AA02003 | purine nucleotide synthesis repressor protein | AA02004 | homoserine O-acetyltransferase | ->-> | 1361769 | 1362076 | 308 | 35.1% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 514 | AA02004 | homoserine O-acetyltransferase | AA02005 | vancomycin sensitivity; SanA protein | ->-> | 1363178 | 1363282 | 105 | 41.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 515 | AA02006 | PEP--fructosephosphotransferase system repressor, DeoR family | AA02007 | hypothetical protein | ->-> | 1365054 | 1365887 | 834 | 28.4% | 0 | 0 | 5 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 516 | AA02008 | conserved hypothetical protein | AA02010 | peptide methionine sulfoxide reductase; cytochrome C-TYPE biogenesis protein; transcriptional regulator | ->-> | 1366535 | 1367319 | 785 | 29.6% | 0 | 0 | 7 | +: 0/2/0 | -: 2/2/0 | 1 | 0 | 0 | 0 | Result | |
| 517 | AA02012 | peptide methionine sulfoxide reductase | AA02013 | carbonic anhydrase | ->-> | 1369530 | 1369744 | 215 | 28.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 518 | AA02013 | carbonic anhydrase | AA02014 | probable hemolysin | ->-> | 1370435 | 1370545 | 111 | 37.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 519 | AA02014 | probable hemolysin | AA02015 | phosphoheptose isomerase | ->-> | 1371038 | 1371198 | 161 | 46% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 520 | AA02020 | conserved hypothetical protein (possible tetrapyrrole methylase family protein) | AA02021 | anaerobic glycerol-3-phosphate dehydrogenase | ->-> | 1374803 | 1375074 | 272 | 34.2% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 521 | AA02023 | NADH dehydrogenase | AA02024 | acyl carrier protein phosphodiesterase | ->-> | 1378176 | 1378283 | 108 | 26.9% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 522 | AA02025 | hypothetical protein | AA02026 | probable serine proteinase | ->-> | 1378912 | 1379063 | 152 | 27.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 524 | AA02030 | threonyl-tRNA synthetase | AA02031 | type III site-specific deoxyribonuclease | ->-> | 1384240 | 1384477 | 238 | 31.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 525 | AA02034 | ferredoxin NADP+ reductase | AA02035 | translation initiation factor IF-3 | ->-> | 1386115 | 1386488 | 374 | 30.7% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 528 | AA02062 | conserved hypothetical protein (probable membrane protein) | AA02063 | 23S rRNA psedouridine synthase, Rlu family protein | ->-> | 1404473 | 1404590 | 118 | 42.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 529 | AA02071 | conserved hypothetical protein | AA02072 | conserved hypothetical protein | ->-> | 1408342 | 1408740 | 399 | 30.1% | 0 | 0 | 3 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 530 | AA02072 | conserved hypothetical protein | AA02074 | hypothetical protein | ->-> | 1409164 | 1409479 | 316 | 30.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 531 | AA02076 | conserved hypothetical protein | AA02077 | probable outer membrane protein | ->-> | 1411155 | 1411433 | 279 | 41.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 532 | AA02081 | periplasmic protein | AA02082 | glutaminyl-tRNA synthetase | ->-> | 1416020 | 1416240 | 221 | 32.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 533 | AA02084 | conserved hypothetical protein | AA02086 | 4-alpha-glucanotransferase | ->-> | 1418415 | 1418516 | 102 | 27.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 535 | AA02092 | glycogen synthase | AA02094 | glycogen phosphorylase; glycogen synthase | ->-> | 1426251 | 1426375 | 125 | 24.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 536 | AA02097 | DedA-family integral membrane protein | AA02099 | 50S ribosomal protein L25 | ->-> | 1429566 | 1429778 | 213 | 30% | 0 | 0 | 0 | +: 1/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 537 | AA02099 | 50S ribosomal protein L25 | AA02100 | lipoprotein | ->-> | 1430064 | 1430213 | 150 | 32% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 538 | AA02100 | lipoprotein | AA02101 | penicillin-binding protein 7 | ->-> | 1430820 | 1430969 | 150 | 36.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 539 | AA02103 | D-alanyl-D-alanine-endopeptidase; penicillin-binding protein 7 | AA02105 | killing protein | ->-> | 1431845 | 1432024 | 180 | 32.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 540 | AA02115 | hypothetical protein | AA02116 | hypothetical protein | ->-> | 1445052 | 1445227 | 176 | 37.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 4 | 0 | 0 | 0 | Result | |
| 541 | AA02118 | hypothetical protein | AA02119 | hypothetical protein | ->-> | 1446000 | 1446511 | 512 | 36.3% | 0 | 0 | 6 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 542 | AA02119 | hypothetical protein | AA02120 | nonheme ferritin | ->-> | 1446641 | 1447320 | 680 | 27.8% | 0 | 0 | 0 | +: 2/0/0 | -: 0/0/0 | 1 | 1 | 133 | 239 | Result | ttaactagtaatagtgacctttgaataactctgtgttttcattaaatcgtagtgttcatttactttgtcactaatttcgcataacatatattatgttaaataaaata |
| 543 | AA02123 | hypothetical protein | AA02124 | anaerobic regulatory protein; transcription regulator Fnr | ->-> | 1448552 | 1448659 | 108 | 25.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 544 | AA02124 | anaerobic regulatory protein; transcription regulator Fnr | AA02125 | conserved hypothetical protein; possible universal stress protein | ->-> | 1449431 | 1449551 | 121 | 33.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 545 | AA02125 | conserved hypothetical protein; possible universal stress protein | AA02126 | conserved hypothetical protein | ->-> | 1450482 | 1450610 | 129 | 27.1% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 546 | AA02135 | hypothetical protein | AA02136 | aspartate aminotransferase | ->-> | 1459128 | 1459348 | 221 | 36.7% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 547 | AA02137 | transcriptional regulators (TetR/AcrR family) | AA02139 | possible membrane protein | ->-> | 1461154 | 1461300 | 147 | 38.8% | 0 | 0 | 0 | +: 1/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 550 | AA02160 | conserved hypothetical protein | AA02162 | lipoprotein | ->-> | 1478990 | 1479089 | 100 | 35% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 551 | AA02166 | phenylalanyl-tRNA synthetase, alpha subunit | AA02167 | hypothetical protein | ->-> | 1483327 | 1483426 | 100 | 29% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 552 | AA02167 | hypothetical protein | AA02168 | possible protease; heat shock protein | ->-> | 1483535 | 1483668 | 134 | 31.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 553 | AA02169 | hypothetical protein | AA02171 | polysialic acid capsule expression protein | ->-> | 1484725 | 1485223 | 499 | 53.9% | 0 | 0 | 13 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 554 | AA02172 | conserved hypothetical protein | AA02173 | anthranilate synthase component I | ->-> | 1486711 | 1486880 | 170 | 34.7% | 0 | 0 | 0 | +: 1/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 555 | AA02184 | anthranilate isomerase; indole-3-glycerol phosphate synthase; phosphoribosylanthranilate isomerase | AA02187 | hypothetical protein | ->-> | 1492602 | 1492742 | 141 | 38.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 556 | AA02190 | hydrogenase-2 component protein | AA02191 | hypothetical protein | ->-> | 1493332 | 1493457 | 126 | 23.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 557 | AA02191 | hypothetical protein | AA02193 | oxaloacetate decarboxylase gamma chain | ->-> | 1493833 | 1494358 | 526 | 35% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 558 | AA02199 | hypothetical protein | AA02201 | transferrin-binding protein 1 precursor | ->-> | 1497962 | 1498161 | 200 | 33.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 560 | AA02202 | transferrin-binding protein 1 precursor | AA02204 | hypothetical protein | ->-> | 1500604 | 1501112 | 509 | 34% | 0 | 0 | 9 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 561 | AA02208 | tryptophan synthase, alpha subunit | AA02210 | ribonucleoside-diphosphate reductase alpha chain | ->-> | 1504057 | 1504333 | 277 | 31.8% | 0 | 0 | 0 | +: 2/1/1 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 562 | AA02210 | ribonucleoside-diphosphate reductase alpha chain | AA02212 | ribonucleoside-diphosphate reductase beta chain | ->-> | 1506017 | 1506151 | 135 | 42.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 563 | AA02213 | hypothetical protein | AA02214 | pyruvate kinase II | ->-> | 1507226 | 1507387 | 162 | 36.4% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 564 | AA02214 | pyruvate kinase II | AA02215 | conserved hypothetical protein | ->-> | 1508831 | 1508939 | 109 | 33% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 565 | AA02226 | ABC transporter ATP-binding protein | AA02228 | regulatory protein, sorC family | ->-> | 1514867 | 1515120 | 254 | 25.2% | 0 | 0 | 0 | +: 1/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
| 566 | AA02230 | sugar kinase | AA02231 | probable dethiobiotin synthetase 1 | ->-> | 1517678 | 1517789 | 112 | 41.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 567 | AA02232 | NagC-like transcriptional regulator | AA02233 | asparaginyl-tRNA synthetase | ->-> | 1519822 | 1520016 | 195 | 24.1% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 568 | AA02236 | stringent starvation protein A | AA02237 | molybdopterin biosynthesis protein E chain | ->-> | 1522698 | 1522899 | 202 | 37.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 569 | AA02242 | molybdenum cofactor biosynthesis protein A | AA02243 | conserved hypothetical protein | ->-> | 1525149 | 1525505 | 357 | 26.3% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 570 | AA02244 | conserved hypothetical protein (probable DNA-binding protein; death-on-curing family protein0 | AA02245 | hypothetical protein | ->-> | 1527436 | 1527585 | 150 | 37.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 571 | AA02249 | thiamine biosynthesis protein | AA02250 | possible cytochrome c-type protein | ->-> | 1529960 | 1530264 | 305 | 26.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 572 | AA02253 | hypothetical protein | AA02254 | 2-oxoglutarate/malate translocator | ->-> | 1534847 | 1534985 | 139 | 40.3% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 573 | AA02254 | 2-oxoglutarate/malate translocator | AA02257 | conserved hypothetical protein | ->-> | 1536441 | 1536657 | 217 | 38.2% | 0 | 0 | 0 | +: 0/0/0 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
| 574 | AA02260 | pseudouridylate synthase I | AA02261 | 30S ribosomal protein S9 | ->-> | 1538023 | 1538152 | 130 | 39.2% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 575 | AA02262 | 50S ribosomal protein L13 | AA02263 | conserved hypothetical protein | ->-> | 1538988 | 1539231 | 244 | 35.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 1 | 1 | 147 | Result | taattaattaccaatataataatattaatacccagtgcttaaaaaagcacaaccagttatcttaatcttcaccccttcgagtgcgatctcgacaaaataatacgcggtgggaatccgcagcattcacagggtcgcgcgattatacaa |
| 577 | AA02269 | 3-hydroxydecanoyl-(acyl-carrier protein) dehydratase | AA02270 | endopeptidase La; lon protease; protease La homolog; ATP-dependent protease LA (lon-1) | ->-> | 1546865 | 1547009 | 145 | 34.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 578 | AA02280 | conserved hypothetical protein | AA02281 | phosphoglycerate transport system activator protein | ->-> | 1552828 | 1552982 | 155 | 32.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 579 | AA02285 | phosphoglycerate transport regulatory protein | AA02286 | sugar ABC transporter, ATP-binding protein | ->-> | 1557345 | 1557717 | 373 | 29.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 580 | AA02286 | sugar ABC transporter, ATP-binding protein | AA02288 | conserved hypothetical protein | ->-> | 1558597 | 1558729 | 133 | 33.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 581 | AA02289 | cell division protein H, a metalloprotease | AA02290 | cell division protein J; ribosomal RNA large subunit methyltransferase J | ->-> | 1561280 | 1561421 | 142 | 25.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 582 | AA02290 | cell division protein J; ribosomal RNA large subunit methyltransferase J | AA02291 | formyltetrahydrofolate deformylase | ->-> | 1562049 | 1562185 | 137 | 33.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 583 | AA02292 | DNA-binding protein H-NS | AA02293 | hypothetical protein | ->-> | 1563458 | 1563670 | 213 | 26.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 584 | AA02293 | hypothetical protein | AA02294 | conserved hypothetical protein | ->-> | 1563770 | 1563897 | 128 | 34.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 591 | AA02298 | conserved hypothetical protein | AA02300 | glutamate racemase | ->-> | 1571061 | 1571487 | 427 | 37.5% | 0 | 0 | 0 | +: 1/1/1 | -: 0/1/0 | 3 | 0 | 0 | 0 | Result | |
| 592 | AA02307 | 5'-guanylate kinase | AA02309 | glyceraldehyde 3-phosphate dehydrogenase | ->-> | 1578119 | 1578287 | 169 | 35.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 593 | AA02323 | conserved hypothetical protein | AA02324 | ABC transporter ATP binding protein | ->-> | 1586384 | 1586657 | 274 | 34.7% | 0 | 0 | 0 | +: 1/1/1 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 594 | AA02330 | UDP-N-acetylglucosamine enolpyruvyl transferase | AA02331 | ABC transporter, ATP-binding protein; possible leukotoxin secretion ATP-binding protein | ->-> | 1591342 | 1592094 | 753 | 29.5% | 0 | 1 | 3 | +: 2/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 595 | AA02331 | ABC transporter, ATP-binding protein; possible leukotoxin secretion ATP-binding protein | AA02332 | conserved hypothetical protein; possible glycosyltransferase | ->-> | 1593040 | 1593390 | 351 | 23.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 596 | AA02332 | conserved hypothetical protein; possible glycosyltransferase | AA02333 | conserved hypothetical protein | ->-> | 1594453 | 1594956 | 504 | 32.3% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 597 | AA02333 | conserved hypothetical protein | AA02334 | outer membrane protein P1 | ->-> | 1595245 | 1595446 | 202 | 30.7% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 598 | AA02340 | hypothetical protein | AA02341 | hypothetical protein | ->-> | 1599402 | 1599585 | 184 | 37% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 4 | 0 | 0 | 0 | Result | |
| 600 | AA02343 | glutamine synthetase | AA02344 | GTP-binding protein, elongation factor typA/bipA | ->-> | 1601720 | 1602105 | 386 | 26.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 601 | AA02348 | bacterioferritin comigratory protein | AA02349 | dihydrodipicolinate synthetase | ->-> | 1607374 | 1607530 | 157 | 27.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 602 | AA02349 | dihydrodipicolinate synthetase | AA02350 | possible lipoprotein | ->-> | 1608422 | 1608537 | 116 | 35.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 604 | AA02351 | conserved hypothetical protein | AA02352 | glycine betaine/carnitine/choline ABC transporter | ->-> | 1609529 | 1609707 | 179 | 36.3% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 605 | AA02352 | glycine betaine/carnitine/choline ABC transporter | AA02353 | spermidine / putrescine transport ATP-binding | ->-> | 1611175 | 1611491 | 317 | 40.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 606 | AA02355 | nicotinamide phosphoribosyl transferase | AA02356 | hypothetical protein | ->-> | 1614474 | 1614587 | 114 | 27.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 607 | AA02365 | hflC protein | AA02366 | hypothetical protein | ->-> | 1623022 | 1623159 | 138 | 34.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 608 | AA02371 | oxygen-independent coproporphyrinogen III oxidase | AA02374 | ribose 5-phosphate isomerase A | ->-> | 1625878 | 1625978 | 101 | 35.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 609 | AA02385 | dicarboxylate-binding periplasmic protein | AA02386 | hypothetical protein | ->-> | 1634241 | 1634685 | 445 | 35.5% | 0 | 0 | 68 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 614 | AA02398 | DNA primase | AA02399 | 30S ribosomal protein S21 | ->-> | 1650916 | 1651039 | 124 | 34.7% | 0 | 0 | 0 | +: 0/1/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
| 615 | AA02407 | thymidine kinase | AA02409 | DNA ligase | ->-> | 1653301 | 1653454 | 154 | 43.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 616 | AA02409 | DNA ligase | AA02410 | cell division protein | ->-> | 1655465 | 1655568 | 104 | 41.3% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 617 | AA02410 | cell division protein | AA02411 | cysteine synthetase | ->-> | 1656604 | 1656742 | 139 | 36.7% | 0 | 0 | 0 | +: 2/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 618 | AA02411 | cysteine synthetase | AA02412 | cysteine synthetase | ->-> | 1657565 | 1657667 | 103 | 31.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 619 | AA02416 | conserved hypothetical protein | AA02417 | GTP-binding protein | ->-> | 1659639 | 1659949 | 311 | 41.2% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 620 | AA02417 | GTP-binding protein | AA02418 | peptidyl-tRNA hydrolase | ->-> | 1661039 | 1661229 | 191 | 38.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 628 | AA02423 | undecaprenyl-phosphate alpha-N-acetylglucosaminyltransferase | AA02425 | glutamate-1-semialdehyde aminotransferase | ->-> | 1670313 | 1670440 | 128 | 32.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 629 | AA02429 | methionine aminopeptidase | AA02430 | conserved hypothetical protein | ->-> | 1675258 | 1675390 | 133 | 33.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 630 | AA02433 | hypothetical protein | AA02434 | membrane protein | ->-> | 1678536 | 1678686 | 151 | 32.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 631 | AA02436 | periplasmic protein | AA02437 | integral membrane protein | ->-> | 1681156 | 1681296 | 141 | 30.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 632 | AA02443 | cytochrome C related protein | AA02446 | conserved hypothetical protein | ->-> | 1686651 | 1686980 | 330 | 44.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 633 | AA02451 | conserved hypothetical protein | AA02453 | conserved hypothetical protein | ->-> | 1688987 | 1689086 | 100 | 47% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 634 | AA02457 | conserved hypothetical protein | AA02458 | outer membrane protein 34 | ->-> | 1695835 | 1696130 | 296 | 35.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 635 | AA02458 | outer membrane protein 34 | AA02459 | conserved hypothetical protein | ->-> | 1697169 | 1697607 | 439 | 28.9% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
| 636 | AA02462 | thiol peroxidase (scavengase) | AA02463 | N-acetylglucosamine-6-phosphate deacetylase | ->-> | 1702734 | 1702943 | 210 | 40% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 637 | AA02465 | glucosamine-6-phosphate isomerase | AA02466 | N-acetylneuraminate lyase | ->-> | 1704946 | 1705102 | 157 | 40.1% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 638 | AA02472 | conserved hypothetical protein | AA02473 | conserved hypothetical protein | ->-> | 1708470 | 1708710 | 241 | 29.5% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 639 | AA02476 | conserved hypothetical protein | AA02477 | PTS system, N-acetylglucosamine-permease IIABC component | ->-> | 1712878 | 1713128 | 251 | 37.1% | 0 | 0 | 0 | +: 1/1/1 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 640 | AA02478 | PTS system, N-acetylglucosamine-specific enzyme IIABC | AA02479 | outer membrane protein 34 | ->-> | 1714593 | 1715273 | 681 | 34.1% | 0 | 72 | 0 | +: 1/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 641 | AA02479 | outer membrane protein 34 | AA02480 | excinuclease ABC subunit B | ->-> | 1716342 | 1716570 | 229 | 22.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 644 | AA02481 | conserved hypothetical protein | AA02482 | conserved hypothetical protein | ->-> | 1720164 | 1720270 | 107 | 33.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 645 | AA02484 | ABC transporter, ATP-binding protein | AA02485 | outer membrane protein 100 | ->-> | 1722981 | 1723089 | 109 | 33.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 646 | AA02485 | outer membrane protein 100 | AA02486 | topoisomerase IV, subunit B | ->-> | 1723975 | 1724476 | 502 | 28.7% | 0 | 0 | 0 | +: 1/1/1 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 647 | AA02491 | topoisomerase IV, subunit A | AA02492 | glutathione S-transferase | ->-> | 1729220 | 1729505 | 286 | 32.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 648 | AA02494 | conserved hypothetical protein | AA02495 | conserved hypothetical protein | ->-> | 1731601 | 1731701 | 101 | 27.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 649 | AA02499 | dolichol phosphate mannose | AA02500 | conserved hypothetical protein | ->-> | 1734605 | 1734750 | 146 | 23.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 651 | AA02514 | esterase/lipase | AA02515 | flavodoxin | ->-> | 1748439 | 1748860 | 422 | 34.8% | 0 | 1 | 0 | +: 1/1/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 652 | AA02526 | conserved hypothetical protein | AA02527 | integration host factor,beta-subunit | ->-> | 1755659 | 1755759 | 101 | 27.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 653 | AA02528 | 30S ribosomal protein S1 | AA02529 | cytidylate kinase 1 | ->-> | 1757753 | 1757852 | 100 | 29% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 654 | AA02531 | conserved hypothetical protein | AA02532 | conserved hypothetical protein | ->-> | 1759402 | 1759705 | 304 | 32.2% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 655 | AA02539 | transcriptional activator | AA02540 | 5-methyltetrahydropteroyltriglutamate-homocystein e methyltransferase | ->-> | 1766990 | 1767288 | 299 | 32.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 656 | AA02540 | 5-methyltetrahydropteroyltriglutamate-homocystein e methyltransferase | AA02541 | conserved hypothetical protein | ->-> | 1769560 | 1769995 | 436 | 36.9% | 0 | 0 | 0 | +: 0/3/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 657 | AA02541 | conserved hypothetical protein | AA02543 | conserved hypothetical protein | ->-> | 1772705 | 1772840 | 136 | 30.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 658 | AA02545 | conserved hypothetical protein | AA02546 | hypothetical protein | ->-> | 1774282 | 1774677 | 396 | 35.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 660 | AA02553 | acylphosphatase | AA02554 | conserved hypothetical protein | ->-> | 1779731 | 1779874 | 144 | 31.9% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 661 | AA02562 | adenine specific methylase | AA02563 | transketolase C-terminal section | ->-> | 1785207 | 1785378 | 172 | 34.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 663 | AA02568 | sugar phosphotransferase component II B | AA02569 | hypothetical protein | ->-> | 1788786 | 1789151 | 366 | 46.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 664 | AA02570 | conserved hypothetical protein | AA02573 | ABC transporter, ATP-binding protein | ->-> | 1790286 | 1790548 | 263 | 38.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 668 | AA02591 | conserved hypothetical protein (possible membrane protein) | AA02592 | conserved hypothetical protein | ->-> | 1802647 | 1803170 | 524 | 33% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 669 | AA02592 | conserved hypothetical protein | AA02593 | conserved hypothetical protein (exported protein) | ->-> | 1803990 | 1804197 | 208 | 25.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 670 | AA02594 | conserved hypothetical protein | AA02595 | cytochrome c peroxidase | ->-> | 1805185 | 1805880 | 696 | 29% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 671 | AA02601 | ATP-dependent helicase | AA02602 | conserved hypothetical protein | ->-> | 1813370 | 1813546 | 177 | 45.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 672 | AA02602 | conserved hypothetical protein | AA02603 | possible thioredoxin trxA homolog | ->-> | 1814363 | 1814774 | 412 | 36.7% | 0 | 0 | 0 | +: 0/3/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 673 | AA02609 | ABC transporter, ATP-binding protein/permease | AA02610 | acyl-CoA thioesterase II | ->-> | 1820245 | 1820510 | 266 | 45.1% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 3 | 23 | 145 | Result | ggaaaccttcccggcttgatctcggcacacgaaaattctgactctggctgctttcttccgaacctgacctggtaaaccagacttcattgcgagggaccgaaaaggtttccattgaattaaccg |
| 674 | AA02610 | acyl-CoA thioesterase II | AA02611 | hypothetical protein | ->-> | 1821375 | 1821528 | 154 | 33.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 675 | AA02619 | GTP cyclohydrolase II | AA02620 | orf14; possible membrane protein | ->-> | 1826254 | 1826534 | 281 | 32% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 677 | AA02628 | exodeoxyribonuclease III | AA02629 | hypothetical protein | ->-> | 1830066 | 1830211 | 146 | 32.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 678 | AA02629 | hypothetical protein | AA02630 | hypothetical protein | ->-> | 1830335 | 1830435 | 101 | 34.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 682 | AA02656 | possible polysaccharide polymerization protein | AA02657 | conserved hypothetical protein | ->-> | 1852041 | 1852151 | 111 | 25.2% | 0 | 0 | 0 | +: 1/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 683 | AA02663 | DNA ligase | AA02666 | DNA helicase II | ->-> | 1854412 | 1854549 | 138 | 31.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 684 | AA02666 | DNA helicase II | AA02667 | hypothetical protein | ->-> | 1856644 | 1856748 | 105 | 41.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 685 | AA02670 | hypothetical protein | AA02671 | gluconokinase | ->-> | 1858324 | 1858461 | 138 | 27.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 686 | AA02674 | formate dehydrogenase-related protein | AA02675 | formate dehydrogenase alpha subunit | ->-> | 1860793 | 1861150 | 358 | 29.3% | 0 | 0 | 0 | +: 2/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 687 | AA02681 | hypothetical protein | AA02682 | hydrogenase maturation protein | ->-> | 1866012 | 1866443 | 432 | 37% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 688 | AA02682 | hydrogenase maturation protein | AA02683 | hydrogenase 4 Fe-S subunit | ->-> | 1868727 | 1869021 | 295 | 27.1% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 689 | AA02695 | hydrogenase-3 component G | AA02696 | formate hydrogenlyase maturation protein | ->-> | 1879479 | 1879615 | 137 | 51.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 690 | AA02697 | hydrogenase 3 maturation protease | AA02698 | formate dehydrogenase H, selenopolypeptide subunit | ->-> | 1880469 | 1880999 | 531 | 34.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 691 | AA02699 | formate dehydrogenase H, selenopolypeptide subunit | AA02700 | succinyl-CoA synthase, alpha subunit | ->-> | 1883220 | 1883395 | 176 | 36.4% | 0 | 0 | 0 | +: 0/2/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 692 | AA02713 | possible prop effector homolog | AA02714 | paraquat-inducible protein PqiA homolog | ->-> | 1895730 | 1895946 | 217 | 27.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 693 | AA02721 | spermidine/putrescine ABC transporter, periplasmic-binding protein | AA02722 | cytidine deaminase | ->-> | 1905395 | 1905518 | 124 | 29.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 694 | AA02724 | seryl-tRNA ligase | AA02726 | anaerobic C4-dicarboxylate transporter | ->-> | 1907811 | 1908117 | 307 | 31.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 695 | AA02727 | hypothetical protein | AA02728 | conserved hypothetical protein (possible ATPase) | ->-> | 1909986 | 1910284 | 299 | 40.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 696 | AA02734 | leucine-responsive regulatory protein | AA02735 | DNA repair protein | ->-> | 1915753 | 1916113 | 361 | 38% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 697 | AA02736 | conserved hypothetical protein | AA02737 | conserved hypothetical protein | ->-> | 1918642 | 1918805 | 164 | 28.7% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 698 | AA02745 | isopentenyl monophosphate kinase | AA02747 | ribose-phosphate pyrophosphokinase; phosphoribosylpyrophosphate synthase | ->-> | 1924328 | 1924463 | 136 | 44.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 699 | AA02747 | ribose-phosphate pyrophosphokinase; phosphoribosylpyrophosphate synthase | AA02748 | conserved hypothetical protein | ->-> | 1925319 | 1925498 | 180 | 33.3% | 0 | 0 | 0 | +: 0/2/0 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
| 700 | AA02748 | conserved hypothetical protein | AA02749 | L-lactate dehydrogenase | ->-> | 1925643 | 1925953 | 311 | 31.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 701 | AA02750 | hypothetical protein | AA02751 | L-lactate permease | ->-> | 1927230 | 1927341 | 112 | 30.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 702 | AA02751 | L-lactate permease | AA02754 | conserved hypothetical protein | ->-> | 1928929 | 1929088 | 160 | 37.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 705 | AA02766 | hypothetical protein | AA02767 | conserved hypothetical protein (possible stability determinant) | ->-> | 1935206 | 1935340 | 135 | 36.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 706 | AA02767 | conserved hypothetical protein (possible stability determinant) | AA02768 | conserved hypothetical protein | ->-> | 1935518 | 1935679 | 162 | 33.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 707 | AA02770 | hypothetical protein | AA02772 | hypothetical protein | ->-> | 1936088 | 1936383 | 296 | 34.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 708 | AA02774 | collagenase prtC homolog, possible protease | AA02775 | S-adenosylmethionine:tRNA ribosyltransferase-isomerase (Queuosine biosynthesis protein queA) | ->-> | 1938396 | 1938694 | 299 | 33.1% | 0 | 0 | 0 | +: 1/1/1 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 709 | AA02776 | conserved hypothetical protein | AA02777 | tRNA-guanine transglycosylase | ->-> | 1940967 | 1941438 | 472 | 32.6% | 0 | 0 | 0 | +: 1/1/0 | -: 0/1/0 | 1 | 2 | 159 | 462 | Result | aataaaaaacaaggaatggcgataaccattccttgcggcatcaattactatgagccagtgctacttttcaataacaggcaaagtagaataatgatgaccaatttaataaaaaatttaatcatatttttatccttatgattataacaaggatctactaatctagcccaacagcggcaactggcggactatcattagtagagtccgcctctgctcgtaagagcattgcgaaaaattatagcatgaagcctgtatatttaaacaggcttttttattaaccaaaaatcttcgaactgtttattcgttg |
| 710 | AA02777 | tRNA-guanine transglycosylase | AA02778 | hypothetical protein | ->-> | 1942588 | 1942724 | 137 | 32.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 711 | AA02781 | protein-export membrane protein | AA02782 | outer membrane haemophore receptor (tonB related) | ->-> | 1946042 | 1946263 | 222 | 27% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
| 712 | AA02783 | hypothetical protein | AA02784 | NAD+ dependent acetaldehyde-alcohol dehydrogenase, iron-containing | ->-> | 1949139 | 1949240 | 102 | 23.5% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 713 | AA02788 | possible ABC-related substrate binding protein | AA02789 | oxidoreductase-dehydrogenase | ->-> | 1956478 | 1956780 | 303 | 29.7% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 714 | AA02790 | NAD-dependent aldehyde dehydrogenase | AA02792 | GlpT/UhpT family transporter (hexosphosphate transport) | ->-> | 1959517 | 1959756 | 240 | 28.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 715 | AA02793 | inositol-1-monophosphatase; extragenic suppressor protein | AA02794 | myo-inositol catabolism protein | ->-> | 1961919 | 1962181 | 263 | 30.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 716 | AA02794 | myo-inositol catabolism protein | AA02796 | possible transcriptional regulator, RpiR family | ->-> | 1963010 | 1963140 | 131 | 26% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 717 | AA02802 | probable myo-inositol 2-dehydrogenase | AA02803 | leukotoxin secretion protein D; hemolysin export system membrane fusion protein | ->-> | 1970147 | 1970421 | 275 | 35.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 718 | AA02808 | conserved hypothetical protein (possible serine hydroxymethyltransferase) | AA02810 | glycine hydroxymethyltransferase; serine hydroxymethyltransferase | ->-> | 1978005 | 1978324 | 320 | 26.6% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 719 | AA02810 | glycine hydroxymethyltransferase; serine hydroxymethyltransferase | AA02811 | hypothetical protein | ->-> | 1979585 | 1979721 | 137 | 35.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 722 | AA02837 | conserved hypothetical protein | AA02838 | conserved hypothetical protein | ->-> | 1993038 | 1993155 | 118 | 33.1% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 723 | AA02841 | cytochrome D ubiquinol oxidase, subunit I | AA02842 | conserved hypothetical protein | ->-> | 1996263 | 1996713 | 451 | 31.9% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 725 | AA02853 | conserved hypothetical protein | AA02854 | hypothetical protein | ->-> | 2002430 | 2002552 | 123 | 23.6% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 726 | AA02856 | aspartyl-tRNA synthetase | AA02857 | conserved hypothetical protein | ->-> | 2004600 | 2004806 | 207 | 24.6% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 727 | AA02864 | glycerol-3-phosphate transport protein | AA02865 | iron-regulated outer membrane protein (omp64) | ->-> | 2010253 | 2010652 | 400 | 28.5% | 0 | 0 | 0 | +: 1/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 728 | AA02865 | iron-regulated outer membrane protein (omp64) | AA02866 | lactoylglutathione lyase | ->-> | 2012603 | 2012763 | 161 | 39.8% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 729 | AA02869 | hypothetical protein | AA02870 | conserved hypothetical protein | ->-> | 2014033 | 2014262 | 230 | 36.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 730 | AA02873 | conserved hypothetical protein | AA02874 | hypothetical protein | ->-> | 2017688 | 2017833 | 146 | 34.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 731 | AA02874 | hypothetical protein | AA02875 | conserved hypothetical protein (2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase) | ->-> | 2017960 | 2018069 | 110 | 38.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 732 | AA02875 | conserved hypothetical protein (2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase) | AA02876 | conserved hypothetical protein | ->-> | 2018211 | 2018432 | 222 | 27.9% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 733 | AA02876 | conserved hypothetical protein | AA02878 | conserved hypothetical protein | ->-> | 2018814 | 2018929 | 116 | 37.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 734 | AA02879 | octaprenyl-diphosphate synthase | AA02880 | 50S ribosomal protein L21 | ->-> | 2020650 | 2020896 | 247 | 32.4% | 0 | 0 | 0 | +: 1/0/0 | -: 1/1/0 | 1 | 1 | 58 | 200 | Result | aaagtgcggtggattttacctgatttttcaggctttctgaaatcaaactgccgaaattgcgaaattttttattttctcgtaaataaattcttgctatcccctaaatttttccgtagaattcacgccctatttatatgaatttt |
| 735 | AA02889 | hypothetical protein | AA02890 | hypothetical protein | ->-> | 2025332 | 2025457 | 126 | 38.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 737 | AA02892 | oligopeptide ABC transporter, periplasmic-binding protein | AA02893 | oligopeptide transport system permease protein, N-terminal | ->-> | 2027238 | 2027340 | 103 | 34% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 738 | AA02899 | oligopeptide ABC transporter, ATP-binding protein | AA02902 | aerobic respiration control protein | ->-> | 2031199 | 2031310 | 112 | 32.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 739 | AA02902 | aerobic respiration control protein | AA02903 | conserved hypothetical protein (ribosomal protein L36) | ->-> | 2032016 | 2032279 | 264 | 29.5% | 0 | 0 | 0 | +: 1/0/0 | -: 1/2/2 | 1 | 0 | 0 | 0 | Result | |
| 740 | AA02904 | 50S ribosomal protein L31 | AA02905 | conserved hypothetical protein | ->-> | 2032694 | 2032907 | 214 | 27.6% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 742 | AA02911 | hypothetical protein | AA02912 | hypothetical protein | ->-> | 2039296 | 2039434 | 139 | 33.8% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 743 | AA02913 | ribosomal large subunit pseudouridine synthase | AA02915 | thioredoxin m | ->-> | 2040588 | 2040791 | 204 | 37.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 745 | AA02917 | cystathionine gamma-synthase | AA02918 | hypothetical protein | ->-> | 2043341 | 2043459 | 119 | 31.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 747 | AA02919 | CagE protein (tranport-associated) | AA02920 | hypothetical protein | ->-> | 2045362 | 2045533 | 172 | 34.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 748 | AA02921 | conserved hypothetical protein (cell filamentation protein) | AA02922 | gamma-glutamylphosphate reductase | ->-> | 2046135 | 2046364 | 230 | 30% | 0 | 0 | 0 | +: 1/1/1 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 749 | AA02922 | gamma-glutamylphosphate reductase | AA02925 | conserved hypothetical protein | ->-> | 2047502 | 2047632 | 131 | 38.2% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 750 | AA02929 | hypothetical protein | AA02930 | fructose-1,6-bisphosphatase | ->-> | 2049431 | 2049573 | 143 | 24.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 751 | AA02930 | fructose-1,6-bisphosphatase | AA02931 | UDP-N-acetylmuramate:L-alanyl-gamma-d-glutamayl-m edo-diaminopimelate | ->-> | 2050579 | 2050735 | 157 | 26.1% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 753 | AA02935 | high-affinity zinc uptake system periplasmic binding protein | AA02936 | lipoprotein E precursor; outer membrane protein P4 precursor; acid phosphatase | ->-> | 2055494 | 2055749 | 256 | 36.7% | 0 | 0 | 1 | +: 0/0/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 754 | AA02944 | 30S ribosomal protein S20 | AA02946 | virulence factor protein | ->-> | 2059089 | 2059355 | 267 | 35.2% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 3 | 1 | 247 | Result | ggtcaaactcctaaaaatttctgttagttaatagtgacaaaataggggcgtaaatatgccgatttcttatacttttgtcaacgggaattttgtgttgatttcggtgagacacaaccgaaagaaagcatcgttatatttaacaagcactttcaaaccggctcacgaaacgatgtgcgcgagattttaacagttttttcccttagaatatagcgtaaaaacgaaatttctatacaattaggcaaatttt |
| 755 | AA02947 | riboflavin biosynthesis protein | AA02949 | hypothetical protein | ->-> | 2061935 | 2062083 | 149 | 55% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 756 | AA02949 | hypothetical protein | AA02950 | isoleucyl-tRNA synthetase | ->-> | 2062303 | 2062434 | 132 | 37.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 757 | AA02954 | penicillin tolerance protein; hydroxymethylbutenyl pyrophosphate reductase | AA02955 | trigger factor | ->-> | 2066692 | 2067161 | 470 | 38.7% | 0 | 0 | 0 | +: 0/2/0 | -: 0/3/0 | 2 | 0 | 0 | 0 | Result | |
| 758 | AA02955 | trigger factor | AA02956 | integrase-recombinase | ->-> | 2068458 | 2068623 | 166 | 36.1% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 760 | AA02972 | conserved hypothetical protein (tyrosine phenol lyase-related protein) | AA02973 | tyrosine-specific transport protein | ->-> | 2077683 | 2077846 | 164 | 38.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 761 | AA02976 | UDP-2,3-diacylglucosamine hydrolase | AA02977 | 1-acyl-sn-glycerol-3-phosphate acyltransferase | ->-> | 2081098 | 2081207 | 110 | 27.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 762 | AA02980 | conserved hypothetical protein | AA02982 | pyruvate formate-lyase activating enzyme | ->-> | 2084306 | 2084449 | 144 | 40.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 763 | AA02982 | pyruvate formate-lyase activating enzyme | AA02983 | formate acetyltransferase | ->-> | 2085188 | 2085334 | 147 | 38.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 764 | AA02983 | formate acetyltransferase | AA02984 | formate transporter | ->-> | 2087645 | 2087745 | 101 | 33.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 765 | AA02984 | formate transporter | AA02987 | histidine triad protein homolog | ->-> | 2088595 | 2088906 | 312 | 32.4% | 0 | 0 | 0 | +: 1/2/2 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 767 | AA02992 | RNA methyltransferase | AA02993 | 6-phosphofructokinase | ->-> | 2091801 | 2091905 | 105 | 36.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 769 | AA03000 | uracil-DNA glycosylase (UDG) | AA03001 | probable glycyl radical protein/pyruvate-formate lyase | ->-> | 2095882 | 2096166 | 285 | 28.4% | 0 | 0 | 0 | +: 1/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
| 770 | AA03010 | thiophene and furan oxidation protein | AA03011 | inner membrane protein, 60 kDa | ->-> | 2102595 | 2102724 | 130 | 34.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 771 | AA03014 | conserved hypothetical protein | AA03015 | hypothetical protein | ->-> | 2105087 | 2105221 | 135 | 27.4% | 0 | 0 | 0 | +: 0/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
| Total: | 0 | 21 | 0/59 | 630 | 16 | ||||||||||||||