Origin IGS:
tccatttcccacacaggctttcactaacggtttcactttggcgataccgtcaatcatggaaaaatcactgtgaacctgcaaatgaacgaaacgtggctgcgacataaaaatccttgggaaaaatcagacaaaagtgcggtgtattttagcggtattttacggggaattgtagggataatttgtcttgatgtcttgacgtaccgacacaataaatccctacaaaacgcagttttattgctagagttttgatcgttaatcggctatattagcgcacaactgttagctgattttggatttttaacc
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
ggttaaaaatccaaaatcagctaacagttgtgcgctaatatagccgattaacgatcaaaactctagcaataaaactgcgttttgtagggatttattgtgtcggtacgtcaagacatcaagacaaattatccctacaattccccgtaaaataccgctaaaatacaccgcacttttgtctgatttttcccaaggatttttatgtcgcagccacgtttcgttcatttgcaggttcacagtgatttttccatgattgacggtatcgccaaagtgaaaccgttagtgaaagcctgtgtgggaaatgga

Mask Tandem Repeat Region ================================================
tccatttcccacacaggctttcactaacggtttcactttggcgataccgtcaatcatggaaaaatcactgtgaacctgcaaatgaacgaaacgtggctgcgacataaaaatccttgggaaaaatcagacaaaagtgcggtgtattttagcggtattttacggggaattgtagggataatttgtcttgatgtcttgacgtaccgacacaataaatccctacaaaacgcagttttattgctagagttttgatcgttaatcggctatattagcgcacaactgttagctgattttggatttttaacc

Find is-nt database================================================
Query_seq: AA00229:AA00231|AA00229:AA00231:DNA polymerase III, alpha subunit:long-chain-fatty-acid--CoA ligase:->->:160372..160674 303
tccatttcccacacaggctttcactaacggtttcactttggcgataccgtcaatcatggaaaaatcactgtgaacctgcaaatgaacgaaacgtggctgcgacataaaaatccttgggaaaaatcagacaaaagtgcggtgtattttagcggtattttacggggaattgtagggataatttgtcttgatgtcttgacgtaccgacacaataaatccctacaaaacgcagttttattgctagagttttgatcgttaatcggctatattagcgcacaactgttagctgattttggatttttaacc
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: AA00229:AA00231|AA00229:AA00231:DNA polymerase III, alpha subunit:long-chain-fatty-acid--CoA ligase:->->:160372..160674 303
tccatttcccacacaggctttcactaacggtttcactttggcgataccgtcaatcatggaaaaatcactgtgaacctgcaaatgaacgaaacgtggctgcgacataaaaatccttgggaaaaatcagacaaaagtgcggtgtattttagcggtattttacggggaattgtagggataatttgtcttgatgtcttgacgtaccgacacaataaatccctacaaaacgcagttttattgctagagttttgatcgttaatcggctatattagcgcacaactgttagctgattttggatttttaacc
Intra-Species Hit: Count: 0

Inter-species Hit: Count: 1	Min: 1	Max: 105	Len: 105
Subject: gi|89107064|ref|AP_000844.1| DNA polymerase III alpha subunit [Escherichia coli W3110]
HSP  1	e-value: 3.0E-8	bit: 53.9	Len: 105	Query Start:1	Query End:105	Subject Strand: null	Subject Start: 1	Subject End: 35
 M  S  Q  P  R  F  V  H  L  Q  V  H  S  D  F  S  M  I  D  G  I  A  K  V  K  P  L  V  K  A  C  V  G  N  G ......................................................................................................................................................................................................
 M  S  E  P  R  F  V  H  L  R  V  H  S  D  Y  S  M  I  D  G  L  A  K  T  A  P  L  V  K  K  A  A  A  L  G ......................................................................................................................................................................................................


Find nr database================================================
Query_seq: AA00229:AA00231|AA00229:AA00231:DNA polymerase III, alpha subunit:long-chain-fatty-acid--CoA ligase:->->:160372..160674 303
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaaaaatccttgggaaaaatcagacaaaagtgcggtgtattttagcggtattttacggggaattgtagggataatttgtcttgatgtcttgacgtaccgacacaataaatccctacaaaacgcagttttattgctagagttttgatcgttaatcggctatattagcgcacaactgttagctgattttggatttttaacc
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaaaaatccttgggaaaaatcagacaaaagtgcggtgtattttagcggtattttacggggaattgtagggataatttgtcttgatgtcttgacgtaccgacacaataaatccctacaaaacgcagttttattgctagagttttgatcgttaatcggctatattagcgcacaactgttagctgattttggatttttaacc
Predict ORF larger than 30AA ================================================
Protein_Len: 60	Strand: +	Start: 64	End: 246
............................................................... M  T  V  N  L  Q  M  N  E  T  W  L  R  H  K  N  P  W  E  K  S  D  K  S  A  V  Y  F  S  G  I  L  R  G  I  V  G  I  I  C  L  D  V  L  T  Y  R  H  N  K  S  L  Q  N  A  V  L  L  L  E .........................................................
Protein_Len: 34	Strand: -	Start: 149	End: 250
.................................................................................................................................................... R  Y  K  V  P  F  Q  L  S  L  K  D  Q  H  R  S  T  G  V  C  Y  I  G  V  F  R  L  K  I  A  L  T  K  M .....................................................
Protein_Len: 60	Strand: -	Start: 57	End: 257
........................................................ C  I  F  S  V  H  S  R  C  L  F  G  Q  S  F  D  S  L  L  A  T  Y  K  L  P  I  K  R  P  I  T  P  I  I  Q  R  S  T  K  V  Y  R  C  L  L  D  R  C  F  A  T  K  N  S  S  N  Q  D  N  M ..............................................
Protein_Len: 37	Strand: -	Start: 1	End: 111
 G  N  G  V  C  A  K  V  L  P  K  V  K  A  I  G  D  I  M  S  F  D  S  H  V  Q  L  H  V  F  R  P  Q  S  M  F  M ................................................................................................................................................................................................

nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaaaaatccttgggaaaaatcagacaaaagtgcggtgtattttagcggtattttacggggaattgtagggataatttgtcttgatgtcttgacgtaccgacacaataaatccctacaaaacgcagttttattgctagagttttgatcgttaatcggctatattagcgcacaactgttagctgattttggatttttaacc
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaaaaatccttgggaaaaatcagacaaaagtgcggtgtattttagcggtattttacggggaattgtagggataatttgtcttgatgtcttgacgtaccgacacaataaatccctacaaaacgcagttttattgctagagttttgatcgttaatcggctatattagcgcacaactgttagctgattttggatttttaacc
Predict TransTerm conf > 70================================================

Find igs database================================================
Query_seq: AA00229:AA00231|AA00229:AA00231:DNA polymerase III, alpha subunit:long-chain-fatty-acid--CoA ligase:->->:160372..160674 303
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaaaaatccttgggaaaaatcagacaaaagtgcggtgtattttagcggtattttacggggaattgtagggataatttgtcttgatgtcttgacgtaccgacacaataaatccctacaaaacgcagttttattgctagagttttgatcgttaatcggctatattagcgcacaactgttagctgattttggatttttaacc
Intra-Species Hit: Count: 1	Min: 106	Max: 303	Len: 198
Subject: aact_AA00229_AA00231|DNA polymerase III, alpha subunit:long-chain-fatty-acid--CoA ligase|POSITIVE:POSITIVE|[160372,160674]|303
HSP  1	e-value: 1.0E-108	bit: 392.0	Len: 198	Query Start:106	Query End:303	Subject Strand: POSITIVE	Subject Start: 106	Subject End: 303
.........................................................................................................aaaaatccttgggaaaaatcagacaaaagtgcggtgtattttagcggtattttacggggaattgtagggataatttgtcttgatgtcttgacgtaccgacacaataaatccctacaaaacgcagttttattgctagagttttgatcgttaatcggctatattagcgcacaactgttagctgattttggatttttaacc
.........................................................................................................aaaaatccttgggaaaaatcagacaaaagtgcggtgtattttagcggtattttacggggaattgtagggataatttgtcttgatgtcttgacgtaccgacacaataaatccctacaaaacgcagttttattgctagagttttgatcgttaatcggctatattagcgcacaactgttagctgattttggatttttaacc

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
AAAAAUCCUUGGGAAAAAUCAGACAAAAGUGCGGUGUAUUUUAGCGGUAUUUUACGGGGAAUUGUAGGGAUAAUUUGUCUUGAUGUCUUGACGUACCGACACAAUAAAUCCCUACAAAACGCAGUUUUAUUGCUAGAGUUUUGAUCGUUAAUCGGCUAUAUUAGCGCACAACUGUUAGCUGAUUUUGGAUUUUUAACC
((((((((......(((((((((((...(((((.((.((((((((((((....((.(.(..((((((((((.(((((((...((((....))))...)))).)))..))))))))))..).).))..))))))))))))..((..((.....))..))...)).)))))...)))...)))))))))))))))).... (-55.10)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
GGUUAAAAAUCCAAAAUCAGCUAACAGUUGUGCGCUAAUAUAGCCGAUUAACGAUCAAAACUCUAGCAAUAAAACUGCGUUUUGUAGGGAUUUAUUGUGUCGGUACGUCAAGACAUCAAGACAAAUUAUCCCUACAAUUCCCCGUAAAAUACCGCUAAAAUACACCGCACUUUUGUCUGAUUUUUCCCAAGGAUUUUU
....((((((((((((((((...((((..(((((......((((.((((.(((............(((.......)))...((((((((((......((((.....((....)).....))))....)))))))))).....)))..))).).))))........)))))..))))))))))))......)))))))) (-47.74)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
385	66	21	172	116	aact:AA01564|5end_transaldolase_B_1049099..1049329_POSITIVE
379	59	12	231	185	aact:AA02195|5end_oxaloacetate_decarboxylase_alpha_chain_1494501..1494731_POSITIVE
361	59	17	136	93	aact:AA01453|5end_D-xylose_isomerase_973457..973687_POSITIVE
360	70	21	201	153	aact:AA00711|5end_conserved_hypothetical_protein_487893..488123_POSITIVE
360	61	22	153	107	aact:AA00174|5end_ribosomal_protein_L11_methyltransferase_123072..123302_POSITIVE
360	61	22	49	3	aact:AA00173|5end_hypothetical_protein_122968..123198_POSITIVE
349	70	25	151	93	aact:AA02231|5end_probable_dethiobiotin_synthetase_1_1517650..1517880_POSITIVE
346	167	121	231	183	aact:AA01572|5end_peptide_ABC_transporter,_permease_protein_1058796..1059026_POSITIVE
334	48	11	127	96	aact:AA00789|5end_DNA_topoisomerase_III_540486..540716_POSITIVE
331	66	21	169	111	aact:AA01666|5end_penicillin-binding_protein_4;_D-alanyl-D-alanine_carboxypeptidase;_D-alanyl-D-alanine-endopeptidase_1128231..1128461_POSITIVE
323	60	24	190	153	aact:AA00501|5end_hypothetical_protein_347293..347523_POSITIVE
323	60	24	48	11	aact:AA00500|5end_hypothetical_protein_347151..347381_POSITIVE
320	100	54	206	152	aact:AA02297|5end_conserved_hypothetical_protein_1569620..1569850_POSITIVE
320	100	54	206	152	aact:AA00621|5end_conserved_hypothetical_protein_428727..428957_POSITIVE
318	47	7	74	40	aact:AA00264|5end_hypothetical_protein_185052..185282_POSITIVE
317	56	19	176	138	aact:AA02509|5end_chorismate_synthase_1740952..1741182_POSITIVE
314	70	29	227	178	aact:AA01079|5end_conserved_hypothetical_protein_747404..747634_POSITIVE
314	58	11	163	118	aact:AA00145|5end_probable_degenerate_transposase_fragment_105046..105276_POSITIVE
313	70	25	144	101	aact:AA02418|5end_peptidyl-tRNA_hydrolase_1661090..1661320_POSITIVE
312	100	51	198	154	aact:AA00776|5end_conserved_hypothetical_protein_533496..533726_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
361	59	17	83	40	aact:AA01451|3end_D-xylulokinase_973484..973634_POSITIVE
360	70	21	66	18	aact:AA00709|3end_metallocluster_assembly_(NifU_protein)_487838..487988_POSITIVE
360	61	22	138	92	aact:AA00173|3end_hypothetical_protein_123137..123287_POSITIVE
341	60	13	110	61	aact:AA02253|3end_hypothetical_protein_1534786..1534936_POSITIVE
331	66	21	62	4	aact:AA01663|3end_GTP_cyclohydrolase_I_1128204..1128354_POSITIVE
329	48	9	72	35	aact:AA00221|3end_NADP-specific_glutamate_dehydrogenase_153865..154015_POSITIVE
323	60	24	96	59	aact:AA00499|3end_pyridoxamine-5'-phosphate_oxidase_347279..347429_POSITIVE
318	47	7	37	3	aact:AA00263|3end_ATP-dependent_RNA_helicase_185095..185245_POSITIVE
317	56	19	151	113	aact:AA02507|3end_penicillin-insensitive_murein_endopeptidase_A_1741007..1741157_POSITIVE
314	176	133	104	70	aact:AA01317|3end_probable_DNA_repair_protein_891739..891889_POSITIVE
311	61	24	86	47	aact:AA02616|3end_transcriptional_regulator_1824675..1824825_POSITIVE
308	167	126	94	51	aact:AA01351|3end_probable_sulfatase_916393..916543_POSITIVE
299	65	25	98	61	aact:AA00383|3end_chloride_channel_protein_260182..260332_POSITIVE
298	66	24	70	19	aact:AA02246|3end_peptidase_E_1528355..1528505_POSITIVE
297	58	18	81	43	aact:AA01957|3end_conserved_hypothetical_protein_1323467..1323617_POSITIVE
292	59	25	80	44	aact:AA00417|3end_outer_membrane_lipoprotein_precursor_(probable_D-methionine-binding_lipoprotein)_284308..284458_POSITIVE
291	48	6	94	52	aact:AA02063|3end_23S_rRNA_psedouridine_synthase,_Rlu_family_protein_1405217..1405367_POSITIVE
290	79	33	44	1	aact:AA02230|3end_sugar_kinase_1517617..1517767_POSITIVE
285	70	28	83	32	aact:AA02984|3end_formate_transporter_2088534..2088684_POSITIVE
285	57	26	83	51	aact:AA02409|3end_DNA_ligase_1655404..1655554_POSITIVE