Origin IGS: tagtcgtagcggaatgttattgttcccgagggtgttacggatacataaagcccatcacgatcggctactttatagagtttatcttttggttttagtgatttgatttttgaatcggttagcatttttattacgtctattataccgtctgaaaagtgtcggtatttttgatctttttggattgtgtttcaatacataccgtcaaaaataacgcaataaaaatgaaatactatgaaatgaattgaaatgatatgaaatagcaaaaccccgacatagcggggctttatggctattttgaaatgatatgaagtgttatgaaatgcaggaatatta .........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9 taatattcctgcatttcataacacttcatatcatttcaaaatagccataaagccccgctatgtcggggttttgctatttcatatcatttcaattcatttcatagtatttcatttttattgcgttatttttgacggtatgtattgaaacacaatccaaaaagatcaaaaataccgacacttttcagacggtataatagacgtaataaaaatgctaaccgattcaaaaatcaaatcactaaaaccaaaagataaactctataaagtagccgatcgtgatgggctttatgtatccgtaacaccctcgggaacaataacattccgctacgacta Mask Tandem Repeat Region ================================================ tagtcgtagcggaatgttattgttcccgagggtgttacggatacataaagcccatcacgatcggctactttatagagtttatcttttggttttagtgatttgatttttgaatcggttagcatttttattacgtctattataccgtctgaaaagtgtcggtatttttgatctttttggattgtgtttcaatacataccgtcaaaaataacgcaataaaaatgaaatactatgaaatgaattgaaatgatatgaaatagcaaaaccccgacatagcggggctttatggctattttgaaatgatatgaagtgttatgaaatgcaggaatatta Find is-nt database================================================ Query_seq: AA01911:AA01913|AA01911:AA01913:hypothetical protein:GMP synthase:->->:1288345..1288674 330 tagtcgtagcggaatgttattgttcccgagggtgttacggatacataaagcccatcacgatcggctactttatagagtttatcttttggttttagtgatttgatttttgaatcggttagcatttttattacgtctattataccgtctgaaaagtgtcggtatttttgatctttttggattgtgtttcaatacataccgtcaaaaataacgcaataaaaatgaaatactatgaaatgaattgaaatgatatgaaatagcaaaaccccgacatagcggggctttatggctattttgaaatgatatgaagtgttatgaaatgcaggaatatta Intra-Species Hit: Count: 0 Inter-species Hit: Count: 0 Find is-aa database================================================ Query_seq: AA01911:AA01913|AA01911:AA01913:hypothetical protein:GMP synthase:->->:1288345..1288674 330 tagtcgtagcggaatgttattgttcccgagggtgttacggatacataaagcccatcacgatcggctactttatagagtttatcttttggttttagtgatttgatttttgaatcggttagcatttttattacgtctattataccgtctgaaaagtgtcggtatttttgatctttttggattgtgtttcaatacataccgtcaaaaataacgcaataaaaatgaaatactatgaaatgaattgaaatgatatgaaatagcaaaaccccgacatagcggggctttatggctattttgaaatgatatgaagtgttatgaaatgcaggaatatta Intra-Species Hit: Count: 0 Inter-species Hit: Count: 0 Find nr database================================================ Query_seq: AA01911:AA01913|AA01911:AA01913:hypothetical protein:GMP synthase:->->:1288345..1288674 330 tagtcgtagcggaatgttattgttcccgagggtgttacggatacataaagcccatcacgatcggctactttatagagtttatcttttggttttagtgatttgatttttgaatcggttagcatttttattacgtctattataccgtctgaaaagtgtcggtatttttgatctttttggattgtgtttcaatacataccgtcaaaaataacgcaataaaaatgaaatactatgaaatgaattgaaatgatatgaaatagcaaaaccccgacatagcggggctttatggctattttgaaatgatatgaagtgttatgaaatgcaggaatatta Intra-Species Hit: Count: 0 Inter-species Hit: Count: 33 Min: 3 Max: 125 Len: 123 Subject: UniRef90_Q8FWT3 Cluster: Site-specific recombinase, phage integrase family; n=1; Brucella suis|Rep: Site-specific recombinase, phage integrase family - Brucella suis HSP 1 e-value: 5.0E-11 bit: 68.9 Len: 120 Query Start:3 Query End:122 Subject Strand: null Subject Start: 1 Subject End: 40 .. M L T D S K I K S L K P K D K L Y K V A D R D G L Y V S V T P S G T I T F R Y D ................................................................................................................................................................................................................ .. M L T D T K L R N L K P K D K L Y K V N D R D G L Y V A I T P A G S I S F R Y N ................................................................................................................................................................................................................ Subject: UniRef90_A1AE42 Cluster: Integrase-like protein; n=2; root|Rep: Integrase-like protein - Escherichia coli O1:K1 / APEC HSP 1 e-value: 5.0E-11 bit: 68.9 Len: 120 Query Start:3 Query End:122 Subject Strand: null Subject Start: 1 Subject End: 40 .. M L T D S K I K S L K P K D K L Y K V A D R D G L Y V S V T P S G T I T F R Y D ................................................................................................................................................................................................................ .. M L T D T K L K N L K P Q D K L Y K V S D R D G L Y V A V L T S G T V S F R Y D ................................................................................................................................................................................................................ Subject: UniRef90_A0HS29 Cluster: Phage integrase; n=1; Pseudomonas mendocina ymp|Rep: Phage integrase - Pseudomonas mendocina ymp HSP 1 e-value: 5.0E-11 bit: 68.9 Len: 120 Query Start:3 Query End:122 Subject Strand: null Subject Start: 1 Subject End: 40 .. M L T D S K I K S L K P K D K L Y K V A D R D G L Y V S V T P S G T I T F R Y D ................................................................................................................................................................................................................ .. M L T D S K L R N L K P K S K L Y K A F D R D G M Y V T V S P T G T V T F R Y D ................................................................................................................................................................................................................ Subject: UniRef90_A1U1E1 Cluster: Phage integrase family protein; n=2; Gammaproteobacteria|Rep: Phage integrase family protein - Marinobacter aquaeolei (strain ATCC 700491 / DSM 11845 / VT8)(Marinobacter hydrocarbonoclasticus (strain DSM 11845)) HSP 1 e-value: 9.0E-11 bit: 68.2 Len: 120 Query Start:3 Query End:122 Subject Strand: null Subject Start: 1 Subject End: 40 .. M L T D S K I K S L K P K D K L Y K V A D R D G L Y V S V T P S G T I T F R Y D ................................................................................................................................................................................................................ .. M L T D T K L R N L K P R D K L Y K V N D R D G L Y V A V T P A G S I S F R Y N ................................................................................................................................................................................................................ Subject: UniRef90_Q212T0 Cluster: Phage integrase; n=1; Rhodopseudomonas palustris BisB18|Rep: Phage integrase - Rhodopseudomonas palustris (strain BisB18) HSP 1 e-value: 1.0E-10 bit: 67.8 Len: 120 Query Start:3 Query End:122 Subject Strand: null Subject Start: 1 Subject End: 40 .. M L T D S K I K S L K P K D K L Y K V A D R D G L Y V S V T P S G T I T F R Y D ................................................................................................................................................................................................................ .. M L T D M A I K R L K P K D K L Y K V A D R D G M Y V S V A T T G Q I T F R Y D ................................................................................................................................................................................................................ Subject: UniRef90_Q57LJ9 Cluster: Site-specific recombinase, phage integrase family; n=1; Salmonella choleraesuis|Rep: Site-specific recombinase, phage integrase family - Salmonella choleraesuis HSP 1 e-value: 1.0E-10 bit: 67.4 Len: 120 Query Start:3 Query End:122 Subject Strand: null Subject Start: 1 Subject End: 40 .. M L T D S K I K S L K P K D K L Y K V A D R D G L Y V S V T P S G T I T F R Y D ................................................................................................................................................................................................................ .. M L T D T R L R H L K P K E K L Y K V N D R D G L Y V A V T P A G T I S F R Y N ................................................................................................................................................................................................................ Subject: UniRef90_A4ADE4 Cluster: Phage integrase family; n=2; Gammaproteobacteria|Rep: Phage integrase family - Congregibacter litoralis KT71 HSP 1 e-value: 1.0E-10 bit: 67.4 Len: 120 Query Start:3 Query End:122 Subject Strand: null Subject Start: 1 Subject End: 40 .. M L T D S K I K S L K P K D K L Y K V A D R D G L Y V S V T P S G T I T F R Y D ................................................................................................................................................................................................................ .. M L T D T K L R N L K P K D K I Y K V N D R D G L Y V A V T P A G G I S F R Y N ................................................................................................................................................................................................................ Subject: UniRef90_A0EVM1 Cluster: Integrase; n=2; Escherichia coli|Rep: Integrase - Escherichia coli HSP 1 e-value: 1.0E-10 bit: 67.4 Len: 120 Query Start:3 Query End:122 Subject Strand: null Subject Start: 1 Subject End: 40 .. M L T D S K I K S L K P K D K L Y K V A D R D G L Y V S V T P S G T I T F R Y D ................................................................................................................................................................................................................ .. M L T D T R L R H L K P K E K L Y K V N D R D G L Y V A V T P A G T I S F R Y N ................................................................................................................................................................................................................ Subject: UniRef90_Q858E8 Cluster: Integrase; n=1; Enterobacteria phage epsilon15|Rep: Integrase - Enterobacteria phage epsilon15 HSP 1 e-value: 1.0E-10 bit: 67.4 Len: 120 Query Start:3 Query End:122 Subject Strand: null Subject Start: 1 Subject End: 40 .. M L T D S K I K S L K P K D K L Y K V A D R D G L Y V S V T P S G T I T F R Y D ................................................................................................................................................................................................................ .. M L T D T K L K N L K P Q D K L Y K V S D R D G L Y V A V L T S G S V S F R Y D ................................................................................................................................................................................................................ Subject: UniRef90_Q0ADW3 Cluster: Phage integrase family protein; n=3; Proteobacteria|Rep: Phage integrase family protein - Nitrosomonas eutropha (strain C71) HSP 1 e-value: 3.0E-10 bit: 66.6 Len: 120 Query Start:3 Query End:122 Subject Strand: null Subject Start: 1 Subject End: 40 .. M L T D S K I K S L K P K D K L Y K V A D R D G L Y V S V T P S G T I T F R Y D ................................................................................................................................................................................................................ .. M L T D T K L R N L K P R D K L Y K V N D R E G L Y V A V T P A G S I S F R Y N ................................................................................................................................................................................................................ Subject: UniRef90_A1W8X9 Cluster: Phage integrase family protein; n=6; Proteobacteria|Rep: Phage integrase family protein - Acidovorax sp. (strain JS42) HSP 1 e-value: 4.0E-10 bit: 65.9 Len: 120 Query Start:3 Query End:122 Subject Strand: null Subject Start: 1 Subject End: 40 .. M L T D S K I K S L K P K D K L Y K V A D R D G L Y V S V T P S G T I T F R Y D ................................................................................................................................................................................................................ .. M L T D T K L R N L K P K D K L Y K V N D R D G L Y V A V T A A G A I S F R Y N ................................................................................................................................................................................................................ Subject: UniRef90_A2W9D0 Cluster: Integrase; n=2; Burkholderia dolosa AUO158|Rep: Integrase - Burkholderia dolosa AUO158 HSP 1 e-value: 1.0E-9 bit: 64.7 Len: 120 Query Start:3 Query End:122 Subject Strand: null Subject Start: 1 Subject End: 40 .. M L T D S K I K S L K P K D K L Y K V A D R D G L Y V S V T P S G T I T F R Y D ................................................................................................................................................................................................................ .. M L T D T A L R N L K P K S K T Y K A S D R D G M Y V T V S P T G T V T F R Y D ................................................................................................................................................................................................................ Subject: UniRef90_A1H0W5 Cluster: Integrase; n=1; Parvibaculum lavamentivorans DS-1|Rep: Integrase - Parvibaculum lavamentivorans DS-1 HSP 1 e-value: 2.0E-9 bit: 63.9 Len: 120 Query Start:3 Query End:122 Subject Strand: null Subject Start: 1 Subject End: 40 .. M L T D S K I K S L K P K D K L Y K V A D R D G L Y V S V T P S G T I T F R Y D ................................................................................................................................................................................................................ .. M L T D A A I K A L R P R D K M Y K V T D R D G M Y V L V S P T G A L T F R F D ................................................................................................................................................................................................................ Subject: UniRef90_Q8PKJ0 Cluster: Phage-related integrase; n=1; Xanthomonas axonopodis pv. citri|Rep: Phage-related integrase - Xanthomonas axonopodis pv. citri HSP 1 e-value: 2.0E-9 bit: 63.5 Len: 120 Query Start:3 Query End:122 Subject Strand: null Subject Start: 1 Subject End: 40 .. M L T D S K I K S L K P K D K L Y K V A D R D G L Y V S V T P S G T I T F R Y D ................................................................................................................................................................................................................ .. M L T D T A L R N L K P K S K I Y K V F D R D G M Y V A V S T A G T I T F R Y D ................................................................................................................................................................................................................ Subject: UniRef90_Q5NYE6 Cluster: Integrase or site-specific recombinase; n=1; Azoarcus sp. EbN1|Rep: Integrase or site-specific recombinase - Azoarcus sp. (strain EbN1) (Aromatoleum aromaticum (strain EbN1)) HSP 1 e-value: 5.0E-9 bit: 62.4 Len: 117 Query Start:3 Query End:119 Subject Strand: null Subject Start: 3 Subject End: 41 .. L T D S K I K S L K P K D K L Y K V A D R D G L Y V S V T P S G T I T F R Y D ................................................................................................................................................................................................................... .. L S D M K L K N L K P Q E K A Y K V P D R D G M Y V V V S P K G T V T F R Y D ................................................................................................................................................................................................................... Subject: UniRef90_Q987R2 Cluster: CP4-like integrase; n=1; Mesorhizobium loti|Rep: CP4-like integrase - Rhizobium loti (Mesorhizobium loti) HSP 1 e-value: 5.0E-9 bit: 62.4 Len: 120 Query Start:3 Query End:122 Subject Strand: null Subject Start: 3 Subject End: 42 .. M L T D S K I K S L K P K D K L Y K V A D R D G L Y V S V T P S G T I T F R Y D ................................................................................................................................................................................................................ .. M L T D V A L K A L K P K E K I Y K I A D R D G I Y V R V M P S G A I S F R L D ................................................................................................................................................................................................................ Subject: UniRef90_Q0BE46 Cluster: Phage integrase family protein; n=1; Burkholderia cepacia AMMD|Rep: Phage integrase family protein - Burkholderia cepacia (strain ATCC 53795 / AMMD) HSP 1 e-value: 6.0E-9 bit: 62.0 Len: 120 Query Start:3 Query End:122 Subject Strand: null Subject Start: 1 Subject End: 40 .. M L T D S K I K S L K P K D K L Y K V A D R D G L Y V S V T P S G T I T F R Y D ................................................................................................................................................................................................................ .. M L T D T A L R N L K P K S L T Y K A S D R D G M Y V T V S P T G T V T F R Y D ................................................................................................................................................................................................................ Subject: UniRef90_A2SG96 Cluster: Integrase or site-specific recombinase; n=1; Methylibium petroleiphilum PM1|Rep: Integrase or site-specific recombinase - Methylibium petroleiphilum (strain PM1) HSP 1 e-value: 8.0E-9 bit: 61.6 Len: 123 Query Start:3 Query End:125 Subject Strand: null Subject Start: 19 Subject End: 59 .. K M L T D S K I K S L K P K D K L Y K V A D R D G L Y V S V T P S G T I T F R Y D ............................................................................................................................................................................................................. .. R S L T D L Q L K A L K P R D K A Y K V S D R D G L Y A Y V A P S G T V S L R Y D ............................................................................................................................................................................................................. Subject: UniRef90_A0GT25 Cluster: Phage integrase; n=1; Burkholderia phytofirmans PsJN|Rep: Phage integrase - Burkholderia phytofirmans PsJN HSP 1 e-value: 8.0E-9 bit: 61.6 Len: 120 Query Start:3 Query End:122 Subject Strand: null Subject Start: 1 Subject End: 40 .. M L T D S K I K S L K P K D K L Y K V A D R D G L Y V S V T P S G T I T F R Y D ................................................................................................................................................................................................................ .. M L T D M Q L R A L K P A E K I Y K V A D Q Q G L Y A A V T P S G A V S F R Y D ................................................................................................................................................................................................................ Subject: UniRef90_Q1LNC8 Cluster: Phage integrase; n=1; Ralstonia metallidurans CH34|Rep: Phage integrase - Ralstonia metallidurans (strain CH34 / ATCC 43123 / DSM 2839) HSP 1 e-value: 1.0E-8 bit: 61.2 Len: 120 Query Start:3 Query End:122 Subject Strand: null Subject Start: 1 Subject End: 40 .. M L T D S K I K S L K P K D K L Y K V A D R D G L Y V S V T P S G T I T F R Y D ................................................................................................................................................................................................................ .. M L T D T A L R N L K P K S L T Y K V S D R D G M Y V T V S P A N T V T F R Y D ................................................................................................................................................................................................................ Subject: UniRef90_A4F5J8 Cluster: Hypothetical protein; n=1; uncultured bacterium|Rep: Hypothetical protein - uncultured bacterium HSP 1 e-value: 1.0E-8 bit: 60.8 Len: 117 Query Start:3 Query End:119 Subject Strand: null Subject Start: 3 Subject End: 41 .. L T D S K I K S L K P K D K L Y K V A D R D G L Y V S V T P S G T I T F R Y D ................................................................................................................................................................................................................... .. L T D K A I K A L K P G E K T Y K V A D R D G L Y L S V A P S G T M S F R F N ................................................................................................................................................................................................................... Subject: UniRef90_Q0LS30 Cluster: Phage integrase; n=1; Caulobacter sp. K31|Rep: Phage integrase - Caulobacter sp. K31 HSP 1 e-value: 1.0E-8 bit: 60.8 Len: 120 Query Start:3 Query End:122 Subject Strand: null Subject Start: 1 Subject End: 40 .. M L T D S K I K S L K P K D K L Y K V A D R D G L Y V S V T P S G T I T F R Y D ................................................................................................................................................................................................................ .. M L T D A A L K F L K P K K K P Y K V A D R D G I Y V V V S P A G S I T F R L D ................................................................................................................................................................................................................ Subject: UniRef90_Q6N7Q3 Cluster: Integrase; n=2; Alphaproteobacteria|Rep: Integrase - Rhodopseudomonas palustris HSP 1 e-value: 2.0E-8 bit: 60.5 Len: 120 Query Start:3 Query End:122 Subject Strand: null Subject Start: 1 Subject End: 40 .. M L T D S K I K S L K P K D K L Y K V A D R D G L Y V S V T P S G T I T F R Y D ................................................................................................................................................................................................................ .. M L T D V A L K N L K P R E K A Y K V T D R D G L Y V Q V S T S G T L T F R L D ................................................................................................................................................................................................................ Subject: UniRef90_Q11KW8 Cluster: CP4-like integrase; n=1; Mesorhizobium sp. BNC1|Rep: CP4-like integrase - Mesorhizobium sp. (strain BNC1) HSP 1 e-value: 2.0E-8 bit: 60.5 Len: 120 Query Start:3 Query End:122 Subject Strand: null Subject Start: 1 Subject End: 40 .. M L T D S K I K S L K P K D K L Y K V A D R D G L Y V S V T P S G T I T F R Y D ................................................................................................................................................................................................................ .. M L T D A A L Q A L K P K D K I Y K V A D R D G M Y V C V M P S G A T S F R L E ................................................................................................................................................................................................................ Subject: UniRef90_Q26MU5 Cluster: Integrase or site-specific recombinase; n=2; Rhizobiales|Rep: Integrase or site-specific recombinase - Xanthobacter sp. (strain Py2) HSP 1 e-value: 3.0E-8 bit: 59.7 Len: 114 Query Start:6 Query End:119 Subject Strand: null Subject Start: 16 Subject End: 53 ..... L T D S K I K S L K P K D K L Y K V A D R D G L Y V S V T P S G T I T F R Y ................................................................................................................................................................................................................... ..... L T D K E L K N L K P R A K L Y K V T D R D G M Y A A V T P T G V V S F R Y ................................................................................................................................................................................................................... Subject: UniRef90_Q13XE3 Cluster: Putative phage integrase; n=1; Burkholderia xenovorans LB400|Rep: Putative phage integrase - Burkholderia xenovorans (strain LB400) HSP 1 e-value: 5.0E-8 bit: 58.9 Len: 120 Query Start:3 Query End:122 Subject Strand: null Subject Start: 1 Subject End: 40 .. M L T D S K I K S L K P K D K L Y K V A D R D G L Y V S V T P S G T I T F R Y D ................................................................................................................................................................................................................ .. M L T D M Q L R A L K P G E K I Y K V A D Q Q G L Y V A V M P S G G M S F R Y D ................................................................................................................................................................................................................ Subject: UniRef90_Q11L26 Cluster: Phage integrase; n=1; Mesorhizobium sp. BNC1|Rep: Phage integrase - Mesorhizobium sp. (strain BNC1) HSP 1 e-value: 7.0E-8 bit: 58.5 Len: 120 Query Start:3 Query End:122 Subject Strand: null Subject Start: 1 Subject End: 40 .. M L T D S K I K S L K P K D K L Y K V A D R D G L Y V S V T P S G T I T F R Y D ................................................................................................................................................................................................................ .. M L T D A A L K C L K P K A K M Y K V T D R D G M Y V R V A P T G G I S F R L D ................................................................................................................................................................................................................ Subject: UniRef90_Q3SQT0 Cluster: Integrase; n=1; Nitrobacter winogradskyi Nb-255|Rep: Integrase - Nitrobacter winogradskyi (strain Nb-255 / ATCC 25391) HSP 1 e-value: 9.0E-8 bit: 58.2 Len: 120 Query Start:3 Query End:122 Subject Strand: null Subject Start: 1 Subject End: 40 .. M L T D S K I K S L K P K D K L Y K V A D R D G L Y V S V T P S G T I T F R Y D ................................................................................................................................................................................................................ .. M L T D T E L K S L K P R A K N Y K V T D R D G M Y V L V I P S G A K T F R M D ................................................................................................................................................................................................................ Subject: UniRef90_A3X0B6 Cluster: Phage integrase; n=1; Nitrobacter sp. Nb-311A|Rep: Phage integrase - Nitrobacter sp. Nb-311A HSP 1 e-value: 9.0E-8 bit: 58.2 Len: 114 Query Start:6 Query End:119 Subject Strand: null Subject Start: 4 Subject End: 41 ..... L T D S K I K S L K P K D K L Y K V A D R D G L Y V S V T P S G T I T F R Y ................................................................................................................................................................................................................... ..... L T D K E L K N L K P R A K L Y K V T D R D G M H A A V T P T G V I S F R Y ................................................................................................................................................................................................................... Subject: UniRef90_A3WWZ7 Cluster: Phage integrase; n=2; Nitrobacter|Rep: Phage integrase - Nitrobacter sp. Nb-311A HSP 1 e-value: 2.0E-7 bit: 57.0 Len: 120 Query Start:3 Query End:122 Subject Strand: null Subject Start: 1 Subject End: 40 .. M L T D S K I K S L K P K D K L Y K V A D R D G L Y V S V T P S G T I T F R Y D ................................................................................................................................................................................................................ .. M L T D V A L K N L K P K E K P Y K V T D R D G M Y V L V S T T G T V S F R L D ................................................................................................................................................................................................................ Subject: UniRef90_Q47DK9 Cluster: Phage integrase; n=1; Dechloromonas aromatica RCB|Rep: Phage integrase - Dechloromonas aromatica (strain RCB) HSP 1 e-value: 1.0E-6 bit: 54.3 Len: 120 Query Start:3 Query End:122 Subject Strand: null Subject Start: 1 Subject End: 40 .. M L T D S K I K S L K P K D K L Y K V A D R D G L Y V S V T P S G T I T F R Y D ................................................................................................................................................................................................................ .. M L T D M Q L R A L K P T G Q I Y K V A D Q Q G L Y V A V T R T G V V S F R F D ................................................................................................................................................................................................................ Subject: UniRef90_A0G1U0 Cluster: Phage integrase; n=1; Burkholderia phymatum STM815|Rep: Phage integrase - Burkholderia phymatum STM815 HSP 1 e-value: 2.0E-6 bit: 53.5 Len: 120 Query Start:3 Query End:122 Subject Strand: null Subject Start: 1 Subject End: 40 .. M L T D S K I K S L K P K D K L Y K V A D R D G L Y V S V T P S G T I T F R Y D ................................................................................................................................................................................................................ .. M L T D L E L R A L K P T G R I Y K V T D Q R G L Y V A V T S S G A V S F R F D ................................................................................................................................................................................................................ Subject: UniRef90_A3JTI3 Cluster: Symbiosis island integrase; n=1; Rhodobacterales bacterium HTCC2150|Rep: Symbiosis island integrase - Rhodobacterales bacterium HTCC2150 HSP 1 e-value: 3.0E-6 bit: 53.1 Len: 114 Query Start:6 Query End:119 Subject Strand: null Subject Start: 3 Subject End: 40 ..... L T D S K I K S L K P K D K L Y K V A D R D G L Y V S V T P S G T I T F R Y ................................................................................................................................................................................................................... ..... L T D L K I K N L K P K D K A Y K I A D F D G L F V L V T D R G S K L F R F ................................................................................................................................................................................................................... tannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntattacgtctattataccgtctgaaaagtgtcggtatttttgatctttttggattgtgtttcaatacataccgtcaaaaataacgcaataaaaatgaaatactatgaaatgaattgaaatgatatgaaatagcaaaaccccgacatagcggggctttatggctattttgaaatgatatgaagtgttatgaaatgcaggaatatta Predict ORF larger than 30AA ================================================ Protein_Len: 33 Strand: + Start: 107 End: 205 .......................................................................................................... M N R L A F L L R L L Y R L K S V G I F D L F G L C F N T Y R Q K ............................................................................................................................. Protein_Len: 34 Strand: - Start: 202 End: 303 ......................................................................................................................................................................................................... F Y R L L F S I S H F S N F H Y S I A F G R C L P A K H S N Q F S M ........................... Protein_Len: 46 Strand: - Start: 189 End: 326 ............................................................................................................................................................................................ Y M G D F I V C Y F H F V I F H I S I I H F L L V G V Y R P K I A I K F H Y S T N H F A P M .... Protein_Len: 36 Strand: - Start: 82 End: 189 ................................................................................. R K T K T I Q N K F R N A N K N R R N Y R R F L T P I K S R K P N H K M ............................................................................................................................................. Protein_Len: 59 Strand: - Start: 3 End: 179 .. D Y R F T I T G S P T V S V Y L G D R D A V K Y L K D K P K L S K I K S D T L M K I V D I I G D S F H R Y K Q D K Q M ....................................................................................................................................................... tannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntattacgtctattataccgtctgaaaagtgtcggtatttttgatctttttggattgtgtttcaatacataccgtcaaaaataacgcaataaaaatgaaatactatgaaatgaattgaaatgatatgaaatagcaaaaccccgacatagcggggctttatggctattttgaaatgatatgaagtgttatgaaatgcaggaatatta Predict Promoter with matrix: RpoD-15 score > 80================================================ Predict Promoter with matrix: RpoD-16 score > 80================================================ Predict Promoter with matrix: RpoD-17 score > 80================================================ Predict Promoter with matrix: RpoD-18 score > 80================================================ Predict Promoter with matrix: RpoD-19 score > 80================================================ Predict Promoter with matrix: RpoN score > 80================================================ tannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntattacgtctattataccgtctgaaaagtgtcggtatttttgatctttttggattgtgtttcaatacataccgtcaaaaataacgcaataaaaatgaaatactatgaaatgaattgaaatgatatgaaatagcaaaaccccgacatagcggggctttatggctattttgaaatgatatgaagtgttatgaaatgcaggaatatta Predict TransTerm conf > 70================================================ TransTerm Strand: - Conf: 63 HP_score: -7.6 Tail_Score: -2.70986 Start: 258 End: 283 Full_Region: atttcaaaatagcca taaagccccg ctatgt cggggttttg ctatttcatatcatt .................................................................................................................................................................................................................................................................taaagccccgctatgtcggggttttg............................................... TransTerm Strand: - Conf: 82 HP_score: -7.5 Tail_Score: -4.51363 Start: 263 End: 278 Full_Region: aaaatagccataaag ccccg ctatgt cgggg ttttgctatttcata ......................................................................................................................................................................................................................................................................ccccgctatgtcgggg.................................................... Find igs database================================================ Query_seq: AA01911:AA01913|AA01911:AA01913:hypothetical protein:GMP synthase:->->:1288345..1288674 330 tannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntattacgtctattataccgtctgaaaagtgtcggtatttttgatctttttggattgtgtttcaatacataccgtcaaaaataacgcaataaaaatgaaatactatgaaatgaattgaaatgatatgaaatagcaaaaccccgacatagcggggctttatggctattttgaaatgatatgaagtgttatgaaatgcaggaatatta Intra-Species Hit: Count: 1 Min: 126 Max: 330 Len: 205 Subject: aact_AA01911_AA01913|hypothetical protein:GMP synthase|POSITIVE:POSITIVE|[1288345,1288674]|330 HSP 1 e-value: 7.0E-35 bit: 149.0 Len: 75 Query Start:126 Query End:200 Subject Strand: POSITIVE Subject Start: 126 Subject End: 200 .............................................................................................................................tattacgtctattataccgtctgaaaagtgtcggtatttttgatctttttggattgtgtttcaatacataccgtc.................................................................................................................................. .............................................................................................................................tattacgtctattataccgtctgaaaagtgtcggtatttttgatctttttggattgtgtttcaatacataccgtc.................................................................................................................................. HSP 2 e-value: 1.0E-30 bit: 135.0 Len: 68 Query Start:263 Query End:330 Subject Strand: POSITIVE Subject Start: 263 Subject End: 330 ......................................................................................................................................................................................................................................................................ccccgacatagcggggctttatggctattttgaaatgatatgaagtgttatgaaatgcaggaatatta ......................................................................................................................................................................................................................................................................ccccgacatagcggggctttatggctattttgaaatgatatgaagtgttatgaaatgcaggaatatta Inter-species Hit: Count: 0 Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================ UAUUACGUCUAUUAUACCGUCUGAAAAGUGUCGGUAUUUUUGAUCUUUUUGGAUUGUGUUUCAAUACAUACCGUCAAAAAUAACGCAAUAAAAAUGAAAUACUAUGAAAUGAAUUGAAAUGAUAUGAAAUAGCAAAACCCCGACAUAGCGGGGCUUUAUGGCUAUUUUGAAAUGAUAUGAAGUGUUAUGAAAUGCAGGAAUAUUA (((((..((..((((...(((..(((((.(((((.....))))))))))..))).((((((((........(((........))).........))))))))......))))...))..))))).((((((((.((((((((......))))).)))...))))))))....((((((...(((((....)))))....)))))) (-40.83) Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================ UAAUAUUCCUGCAUUUCAUAACACUUCAUAUCAUUUCAAAAUAGCCAUAAAGCCCCGCUAUGUCGGGGUUUUGCUAUUUCAUAUCAUUUCAAUUCAUUUCAUAGUAUUUCAUUUUUAUUGCGUUAUUUUUGACGGUAUGUAUUGAAACACAAUCCAAAAAGAUCAAAAAUACCGACACUUUUCAGACGGUAUAAUAGACGUAAUA ......................................(((((((...(((((((((......))))))))))))))))....................................(((((((((..(((((((..(.((.((((.....)))).)).)..).))))))((((((.(........).))))))....))))))))) (-36.50) Find mRNA Target Using Conserved IGS================================================ 5'END mRNA Target Prediction=================================== Score srna_start srna_end target_start tegart_end seq_id 312 165 131 227 196 aact:AA01859|5end_hypothetical_protein_1251718..1251948_POSITIVE 312 200 152 105 53 aact:AA00283|5end_glutamate_5-kinase_(gamma-glutamyl_kinase)_199534..199764_POSITIVE 305 170 132 57 13 aact:AA01845|5end_gamma-glutamyltranspeptidase_precursor_1239841..1240071_POSITIVE 301 163 131 211 167 aact:AA01568|5end_dipeptide_transport_system_ATP-binding_protein_1056037..1056267_POSITIVE 298 175 132 99 56 aact:AA00596|5end_uridylate_kinase_407496..407726_POSITIVE 286 162 128 151 113 aact:AA00395|5end_conserved_hypothetical_protein_265278..265508_POSITIVE 274 174 138 193 162 aact:AA01232|5end_30S_ribosomal_protein_S8_840445..840675_POSITIVE 270 188 142 63 25 aact:AA02678|5end_formate_dehydrogenase,_gamma_subunit_1865021..1865251_POSITIVE 269 39 2 59 8 aact:AA02230|5end_sugar_kinase_1515984..1516214_POSITIVE 266 189 141 193 134 aact:AA02687|5end_hydrogenase-4_component_D_1872521..1872751_POSITIVE 266 169 127 220 161 aact:AA02097|5end_DedA-family_integral_membrane_protein_1428823..1429053_POSITIVE 266 169 127 151 92 aact:AA02096|5end_hypothetical_protein_1428754..1428984_POSITIVE 266 58 14 143 109 aact:AA00726|5end_apolipoprotein_N-acyltransferase,_copper_498265..498495_POSITIVE 261 158 138 44 19 aact:AA01056|5end_conserved_hypothetical_protein_733867..734097_POSITIVE 261 188 141 220 176 aact:AA00420|5end_tRNA/rRNA_methyltransferase_284953..285183_POSITIVE 260 162 132 127 94 aact:AA01724|5end_valyl-tRNA_synthetase_1164446..1164676_POSITIVE 258 162 128 43 15 aact:AA01875|5end_PTS_system,_glucose-specific_enzyme_II,_A_component_1262563..1262793_POSITIVE 257 56 12 75 24 aact:AA02507|5end_penicillin-insensitive_murein_endopeptidase_A_1740058..1740288_POSITIVE 257 54 17 128 101 aact:AA00142|5end_glycerate_kinase_101309..101539_POSITIVE 256 171 139 149 108 aact:AA01891|5end_pyridoxine_kinase_1275922..1276152_POSITIVE 3'END mRNA Target Prediction=================================== Score srna_start srna_end target_start tegart_end seq_id 286 162 128 41 3 aact:AA00391|3end_arsenate_reductase_265248..265398_POSITIVE 270 188 142 67 29 aact:AA02677|3end_formate_dehydrogenase,_beta_subunit_1865105..1865255_POSITIVE 266 169 127 95 36 aact:AA02094|3end_glycogen_phosphorylase;_glycogen_synthase_1428778..1428928_POSITIVE 266 58 14 74 40 aact:AA00725|3end_translation_initiation_factor_1_498276..498426_POSITIVE 263 170 138 149 122 aact:AA01231|3end_30S_ribosomal_protein_S14_840485..840635_POSITIVE 261 158 138 37 12 aact:AA01054|3end_conserved_hypothetical_protein_733940..734090_POSITIVE 261 188 141 98 54 aact:AA00419|3end_conserved_hypothetical_protein_(possible_phosphatidylethanolamine-binding_protein)_284911..285061_POSITIVE 257 56 12 68 17 aact:AA02506|3end_possible_transmembrane_protein_1740131..1740281_POSITIVE 257 54 17 52 25 aact:AA00141|3end_hypoxanthine_phosphoribosyl_transferase_(HPRT)_101313..101463_POSITIVE 256 171 139 114 73 aact:AA01890|3end_cell-cycle_protein_1275967..1276117_POSITIVE 250 56 11 81 30 aact:AA01589|3end_conserved_hypothetical_protein_1070871..1071021_POSITIVE 248 170 137 38 2 aact:AA02152|3end_ferric_enterobactin_transport;_ABC_transporter_ATP-binding_protein_1472610..1472760_POSITIVE 248 45 6 148 109 aact:AA00974|3end_glucosamine-fructose-6-phosphate_681127..681277_POSITIVE 247 162 128 58 12 aact:AA02324|3end_ABC_transporter_ATP_binding_protein_1587392..1587542_POSITIVE 246 180 131 58 4 aact:AA01799|3end_polysacharide_biosynthesis_protein_(Orf14_of_cluster)_1213276..1213426_POSITIVE 244 162 131 77 42 aact:AA01304|3end_penicillin-binding_protein_1A_885580..885730_POSITIVE 244 159 122 49 3 aact:AA01099|3end_dimethyladenosine_transferase_759482..759632_POSITIVE 243 154 133 151 120 aact:AA01117|3end_signal_recognition_particle_protein_54_(GTP-binding_export_factor)_769375..769525_POSITIVE 243 160 135 93 65 aact:AA00691|3end_conserved_hypothetical_protein_(possible_multidrug/sugar_efflux_transporter)_473155..473305_POSITIVE 240 190 141 104 59 aact:AA00987|3end_tetracenomycin_polyketide_synthesis_O-methyltransferase_690586..690736_POSITIVE