Origin IGS:
taattccataaagtgcaacttgctgcactgttctcattttaatcaaaaggtgcaccaaattgcaccctaccaaagagaaaatataaatgacacaaaaattcgaaatggcagaccgttttaatccgtctgcggtagagcaagccctttatcaacactgggaagaaagcggttattttaaaccgtcggaagaggcgaatgcgccgagttattctattgccattccgccgccgaatgtgacggggagtctgcac
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
gtgcagactccccgtcacattcggcggcggaatggcaatagaataactcggcgcattcgcctcttccgacggtttaaaataaccgctttcttcccagtgttgataaagggcttgctctaccgcagacggattaaaacggtctgccatttcgaatttttgtgtcatttatattttctctttggtagggtgcaatttggtgcaccttttgattaaaatgagaacagtgcagcaagttgcactttatggaatta

Mask Tandem Repeat Region ================================================
taattccataaagtgcaacttgctgcactgttctcattttaatcaaaaggtgcaccaaattgcaccctaccaaagagaaaatataaatgacacaaaaattcgaaatggcagaccgttttaatccgtctgcggtagagcaagccctttatcaacactgggaagaaagcggttattttaaaccgtcggaagaggcgaatgcgccgagttattctattgccattccgccgccgaatgtgacggggagtctgcac

Find is-nt database================================================
Query_seq: AA01723:AA01724|AA01723:AA01724:conserved hypothetical protein:valyl-tRNA synthetase:->->:1164335..1164585 251
taattccataaagtgcaacttgctgcactgttctcattttaatcaaaaggtgcaccaaattgcaccctaccaaagagaaaatataaatgacacaaaaattcgaaatggcagaccgttttaatccgtctgcggtagagcaagccctttatcaacactgggaagaaagcggttattttaaaccgtcggaagaggcgaatgcgccgagttattctattgccattccgccgccgaatgtgacggggagtctgcac
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: AA01723:AA01724|AA01723:AA01724:conserved hypothetical protein:valyl-tRNA synthetase:->->:1164335..1164585 251
taattccataaagtgcaacttgctgcactgttctcattttaatcaaaaggtgcaccaaattgcaccctaccaaagagaaaatataaatgacacaaaaattcgaaatggcagaccgttttaatccgtctgcggtagagcaagccctttatcaacactgggaagaaagcggttattttaaaccgtcggaagaggcgaatgcgccgagttattctattgccattccgccgccgaatgtgacggggagtctgcac
Intra-Species Hit: Count: 0

Inter-species Hit: Count: 1	Min: 105	Max: 251	Len: 147
Subject: gi|89110974|ref|AP_004754.1| valyl-tRNA synthetase [Escherichia coli W3110]
HSP  1	e-value: 8.0E-13	bit: 68.9	Len: 147	Query Start:105	Query End:251	Subject Strand: null	Subject Start: 1	Subject End: 49
........................................................................................................ M  A  D  R  F  N  P  S  A  V  E  Q  A  L  Y  Q  H  W  E  E  S  G  Y  F  K  P  S  E  E  A  N  A  P  S  Y  S  I  A  I  P  P  P  N  V  T  G  S  L  H 
........................................................................................................ M  E  K  T  Y  N  P  Q  D  I  E  Q  P  L  Y  E  H  W  E  K  Q  G  Y  F  K  P  N  G  D  E  S  Q  E  S  F  C  I  M  I  P  P  P  N  V  T  G  S  L  H 


Find nr database================================================
Query_seq: AA01723:AA01724|AA01723:AA01724:conserved hypothetical protein:valyl-tRNA synthetase:->->:1164335..1164585 251
taattccataaagtgcaacttgctgcactgttctcattttaatcaaaaggtgcaccaaattgcaccctaccaaagagaaaatataaatgacacaaaaattcgaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

taattccataaagtgcaacttgctgcactgttctcattttaatcaaaaggtgcaccaaattgcaccctaccaaagagaaaatataaatgacacaaaaattcgaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
Predict ORF larger than 30AA ================================================
Protein_Len: 37	Strand: +	Start: 8	End: 118
....... M  K  C  N  L  L  H  C  S  H  F  N  Q  K  V  H  Q  I  A  P  Y  Q  R  E  N  I  N  D  T  K  I  R  N  G  R  P  F .....................................................................................................................................
Protein_Len: 55	Strand: +	Start: 87	End: 251
...................................................................................... M  T  Q  K  F  E  M  A  D  R  F  N  P  S  A  V  E  Q  A  L  Y  Q  H  W  E  E  S  G  Y  F  K  P  S  E  E  A  N  A  P  S  Y  S  I  A  I  P  P  P  N  V  T  G  S  L  H 
Protein_Len: 60	Strand: -	Start: 42	End: 251
......................................... F  L  F  Y  L  H  C  L  F  E  F  H  C  V  T  K  I  R  R  R  Y  L  L  G  K  I  L  V  P  F  F  A  T  I  K  F  R  R  F  L  R  I  R  R  T  I  R  N  G  N  R  R  R  I  H  R  P  T  Q  M 
Protein_Len: 35	Strand: -	Start: 2	End: 106
. I  G  Y  L  A  V  Q  Q  V  T  R  M  K  I  L  L  H  V  L  N  C  G  V  L  S  F  I  Y  I  V  C  F  N  S  M .................................................................................................................................................

taattccataaagtgcaacttgctgcactgttctcattttaatcaaaaggtgcaccaaattgcaccctaccaaagagaaaatataaatgacacaaaaattcgaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

taattccataaagtgcaacttgctgcactgttctcattttaatcaaaaggtgcaccaaattgcaccctaccaaagagaaaatataaatgacacaaaaattcgaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
Predict TransTerm conf > 70================================================
TransTerm Strand: -	Conf: 76	HP_score: -7.0	Tail_Score: -4.42238	Start: 49	End: 66	Full_Region: ttttctctttggtag ggtgca atttgg tgcacc ttttgattaaaatga
................................................ggtgcaatttggtgcacc.........................................................................................................................................................................................

Find igs database================================================
Query_seq: AA01723:AA01724|AA01723:AA01724:conserved hypothetical protein:valyl-tRNA synthetase:->->:1164335..1164585 251
taattccataaagtgcaacttgctgcactgttctcattttaatcaaaaggtgcaccaaattgcaccctaccaaagagaaaatataaatgacacaaaaattcgaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
Intra-Species Hit: Count: 1	Min: 1	Max: 104	Len: 104
Subject: aact_AA01723_AA01724|conserved hypothetical protein:valyl-tRNA synthetase|POSITIVE:POSITIVE|[1164335,1164585]|251
HSP  1	e-value: 3.0E-52	bit: 206.0	Len: 104	Query Start:1	Query End:104	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 104
taattccataaagtgcaacttgctgcactgttctcattttaatcaaaaggtgcaccaaattgcaccctaccaaagagaaaatataaatgacacaaaaattcgaa...................................................................................................................................................
taattccataaagtgcaacttgctgcactgttctcattttaatcaaaaggtgcaccaaattgcaccctaccaaagagaaaatataaatgacacaaaaattcgaa...................................................................................................................................................

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UAAUUCCAUAAAGUGCAACUUGCUGCACUGUUCUCAUUUUAAUCAAAAGGUGCACCAAAUUGCACCCUACCAAAGAGAAAAUAUAAAUGACACAAAAAUUCGAA
......(((..((((((......)))))).(((((..(((....))).((((((......))))))........))))).......)))............... (-19.10)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UUCGAAUUUUUGUGUCAUUUAUAUUUUCUCUUUGGUAGGGUGCAAUUUGGUGCACCUUUUGAUUAAAAUGAGAACAGUGCAGCAAGUUGCACUUUAUGGAAUUA
...(((....((((.....))))..)))..(((.(((((((((((((((.(((((.((((.((....)).))))..))))).))))))))))))))).)))... (-31.90)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
349	70	21	165	120	aact:AA01175|5end_6-phosphogluconate_dehydrogenase_804864..805094_POSITIVE
277	77	43	208	170	aact:AA00698|5end_iron(III)_ABC_transporter,_periplasmic_iron-compound-binding_protein_477191..477421_POSITIVE
270	70	24	220	181	aact:AA02260|5end_pseudouridylate_synthase_I_1537067..1537297_POSITIVE
268	67	23	153	94	aact:AA01335|5end_primosomal_protein_N'_901993..902223_POSITIVE
265	52	16	79	49	aact:AA02035|5end_translation_initiation_factor_IF-3_1386349..1386579_POSITIVE
264	57	15	161	120	aact:AA01995|5end_conserved_hypothetical_protein_(possible_chorismate_mutase)_1355120..1355350_POSITIVE
258	34	2	219	188	aact:AA01336|5end_hypothetical_protein_904056..904286_POSITIVE
250	56	12	73	26	aact:AA00449|5end_conserved_hypothetical_protein_312996..313226_POSITIVE
248	53	11	184	147	aact:AA01883|5end_recycling_protein;_permease_1269821..1270051_POSITIVE
245	57	12	229	183	aact:AA02811|5end_hypothetical_protein_1979582..1979812_POSITIVE
241	54	22	170	128	aact:AA02824|5end_conserved_hypothetical_protein_1986131..1986361_POSITIVE
238	70	23	37	1	aact:AA00614|5end_ribonuclease_HII_(RNase_HII)_419890..420120_POSITIVE
236	90	48	112	71	aact:AA00732|5end_citrate_lyase_ligase_501343..501573_POSITIVE
233	67	21	112	76	aact:AA01338|5end_hypothetical_protein_904967..905197_POSITIVE
232	40	10	159	121	aact:AA01123|5end_possible_hemolysin;_membrane_protein_770318..770548_POSITIVE
229	39	12	36	4	aact:AA02696|5end_formate_hydrogenlyase_maturation_protein_1879476..1879706_POSITIVE
228	53	17	143	109	aact:AA02252|5end_conserved_hypothetical_protein_1533840..1534070_POSITIVE
228	68	21	136	77	aact:AA01532|5end_hypothetical_protein_1028771..1029001_POSITIVE
228	68	21	70	11	aact:AA01531|5end_hypothetical_protein_1028705..1028935_POSITIVE
227	58	14	70	24	aact:AA01891|5end_pyridoxine_kinase_1275922..1276152_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
349	70	21	144	99	aact:AA01174|3end_hypothetical_protein_804923..805073_POSITIVE
277	77	43	111	73	aact:AA00697|3end_hypothetical_protein_477174..477324_POSITIVE
277	77	43	43	5	aact:AA00696|3end_iron(III)_ABC_transporter,_periplasmic_iron-compound-binding_protein_477106..477256_POSITIVE
263	53	13	69	32	aact:AA01631|3end_dihydrodipicolinate_reductase_1103915..1104065_POSITIVE
261	70	22	41	1	aact:AA00613|3end_lipid-A-disaccharide_synthase_419974..420124_POSITIVE
257	56	11	147	97	aact:AA01495|3end_probable_oxidoreductase_1004927..1005077_POSITIVE
250	56	12	55	8	aact:AA00448|3end_C-terminal_region_of_competence_protein_M_313058..313208_POSITIVE
248	53	11	48	11	aact:AA01881|3end_adenylate_kinase_1269765..1269915_POSITIVE
245	57	12	91	45	aact:AA02810|3end_glycine_hydroxymethyltransferase;_serine_hydroxymethyltransferase_1979524..1979674_POSITIVE
245	55	13	70	24	aact:AA01127|3end_energy_transducer_protein_773520..773670_POSITIVE
242	54	11	62	20	aact:AA00507|3end_hypothetical_protein_353201..353351_POSITIVE
241	54	22	128	86	aact:AA02823|3end_exodeoxyribonuclease_V_gamma_chain_1986169..1986319_POSITIVE
239	72	31	58	21	aact:AA02480|3end_excinuclease_ABC_subunit_B_1718442..1718592_POSITIVE
236	90	48	71	30	aact:AA00730|3end_hypothetical_protein_501382..501532_POSITIVE
233	67	21	96	60	aact:AA01337|3end_cell_division_protein_N_905031..905181_POSITIVE
232	40	10	81	43	aact:AA01120|3end_conserved_hypothetical_protein_770320..770470_POSITIVE
228	53	17	66	32	aact:AA02251|3end_biotin_sulfoxide_reductase;_Trimethylamine-N-oxide_reductase_precursor_1533843..1533993_POSITIVE
228	65	21	117	78	aact:AA00574|3end_regulatory_protein_392381..392531_POSITIVE
227	54	11	145	90	aact:AA01685|3end_molybdenum_ABC_transporter,_ATP-binding_protein_1137916..1138066_POSITIVE
226	46	3	131	90	aact:AA02602|3end_conserved_hypothetical_protein_1814302..1814452_POSITIVE