Origin IGS:
tagttggaatcaatataaggaatattcactgatagcgcacgcttcatagcgtgtgcttgtagataaaggcacacgttgggaaacatgcgccatcgtaggaaactattggaggaattacatgaaacataacttatttattttatatggtgcggctaatacaggtaaaaccacaacttttaatgagttactaaaaaatgcttgtgatcaattcttagataaattggtgtattttgaacggagtgaaaattgtgctgactttttagctgtctttcaaaataaaaatgtgaaagtagacctatattcttcaggcgata
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
tatcgcctgaagaatataggtctactttcacatttttattttgaaagacagctaaaaagtcagcacaattttcactccgttcaaaatacaccaatttatctaagaattgatcacaagcattttttagtaactcattaaaagttgtggttttacctgtattagccgcaccatataaaataaataagttatgtttcatgtaattcctccaatagtttcctacgatggcgcatgtttcccaacgtgtgcctttatctacaagcacacgctatgaagcgtgcgctatcagtgaatattccttatattgattccaacta

Mask Tandem Repeat Region ================================================
tagttggaatcaatataaggaatattcactgatagcgcacgcttcatagcgtgtgcttgtagataaaggcacacgttgggaaacatgcgccatcgtaggaaactattggaggaattacatgaaacataacttatttattttatatggtgcggctaatacaggtaaaaccacaacttttaatgagttactaaaaaatgcttgtgatcaattcttagataaattggtgtattttgaacggagtgaaaattgtgctgactttttagctgtctttcaaaataaaaatgtgaaagtagacctatattcttcaggcgata

Find is-nt database================================================
Query_seq: AA01169:AA01170|AA01169:AA01170:hypothetical protein:hypothetical protein:->->:802290..802603 314
tagttggaatcaatataaggaatattcactgatagcgcacgcttcatagcgtgtgcttgtagataaaggcacacgttgggaaacatgcgccatcgtaggaaactattggaggaattacatgaaacataacttatttattttatatggtgcggctaatacaggtaaaaccacaacttttaatgagttactaaaaaatgcttgtgatcaattcttagataaattggtgtattttgaacggagtgaaaattgtgctgactttttagctgtctttcaaaataaaaatgtgaaagtagacctatattcttcaggcgata
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: AA01169:AA01170|AA01169:AA01170:hypothetical protein:hypothetical protein:->->:802290..802603 314
tagttggaatcaatataaggaatattcactgatagcgcacgcttcatagcgtgtgcttgtagataaaggcacacgttgggaaacatgcgccatcgtaggaaactattggaggaattacatgaaacataacttatttattttatatggtgcggctaatacaggtaaaaccacaacttttaatgagttactaaaaaatgcttgtgatcaattcttagataaattggtgtattttgaacggagtgaaaattgtgctgactttttagctgtctttcaaaataaaaatgtgaaagtagacctatattcttcaggcgata
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: AA01169:AA01170|AA01169:AA01170:hypothetical protein:hypothetical protein:->->:802290..802603 314
tagttggaatcaatataaggaatattcactgatagcgcacgcttcatagcgtgtgcttgtagataaaggcacacgttgggaaacatgcgccatcgtaggaaactattggaggaattacatgaaacataacttatttattttatatggtgcggctaatacaggtaaaaccacaacttttaatgagttactaaaaaatgcttgtgatcaattcttagataaattggtgtattttgaacggagtgaaaattgtgctgactttttagctgtctttcaaaataaaaatgtgaaagtagacctatattcttcaggcgata
Intra-Species Hit: Count: 0

Inter-species Hit: Count: 2	Min: 131	Max: 313	Len: 183
Subject: UniRef90_A3N1V6 Cluster: Hypothetical protein; n=2; Actinobacillus pleuropneumoniae|Rep: Hypothetical protein - Actinobacillus pleuropneumoniae serotype 5b (strain L20)
HSP  1	e-value: 3.0E-15	bit: 83.2	Len: 183	Query Start:131	Query End:313	Subject Strand: null	Subject Start: 4	Subject End: 64
.................................................................................................................................. L  F  I  L  Y  G  A  A  N  T  G  K  T  T  T  F  N  E  L  L  K  N  A  C  D  Q  F  L  D  K  L  V  Y  F  E  R  S  E  N  C  A  D  F  L  A  V  F  Q  N  K  N  V  K  V  D  L  Y  S  S  G  D .
.................................................................................................................................. L  F  I  L  Y  G  A  G  N  T  G  K  T  T  T  F  N  K  L  L  E  K  I  N  A  K  Y  L  D  K  L  V  Y  F  S  R  H  S  N  N  I  D  F  I  A  V  F  Q  Y  E  N  M  R  I  G  F  Y  S  S  G  D .

Subject: UniRef90_A1KRS8 Cluster: Hypothetical protein; n=3; Neisseria meningitidis|Rep: Hypothetical protein - Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 /FAM18)
HSP  1	e-value: 1.0E-10	bit: 67.8	Len: 183	Query Start:131	Query End:313	Subject Strand: null	Subject Start: 6	Subject End: 66
.................................................................................................................................. L  F  I  L  Y  G  A  A  N  T  G  K  T  T  T  F  N  E  L  L  K  N  A  C  D  Q  F  L  D  K  L  V  Y  F  E  R  S  E  N  C  A  D  F  L  A  V  F  Q  N  K  N  V  K  V  D  L  Y  S  S  G  D .
.................................................................................................................................. I  F  I  L  Y  G  A  A  N  K  G  K  S  T  T  L  N  T  L  F  N  Q  I  C  R  K  F  S  K  F  L  V  F  F  E  R  H  G  N  G  L  D  F  V  A  V  F  D  H  E  G  Q  R  I  G  F  Y  S  S  G  D .


tagttggaatcaatataaggaatattcactgatagcgcacgcttcatagcgtgtgcttgtagataaaggcacacgttgggaaacatgcgccatcgtaggaaactattggaggaattacatgaaacataacnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnna
Predict ORF larger than 30AA ================================================
Protein_Len: 60	Strand: +	Start: 53	End: 313
.................................................... M  L  V  D  K  G  T  R  W  E  T  C  A  I  V  G  N  Y  W  R  N  Y  M  K  H  N  L  F  I  L  Y  G  A  A  N  T  G  K  T  T  T  F  N  E  L  L  K  N  A  C  D  Q  F  L  D  K  L  V  Y  F .
Protein_Len: 43	Strand: -	Start: 180	End: 308
................................................................................................................................................................................... H  T  V  L  F  H  K  H  D  I  R  L  Y  I  P  T  N  Q  V  S  H  F  N  H  Q  S  K  L  Q  R  E  F  Y  F  H  S  L  L  G  I  N  K  M ......
Protein_Len: 44	Strand: -	Start: 3	End: 134
.. N  S  D  I  Y  P  I  N  V  S  L  A  R  K  M  A  H  A  Q  L  Y  L  C  V  N  P  F  M  R  W  R  L  F  S  N  S  S  N  C  S  V  Y  S  M ....................................................................................................................................................................................

tagttggaatcaatataaggaatattcactgatagcgcacgcttcatagcgtgtgcttgtagataaaggcacacgttgggaaacatgcgccatcgtaggaaactattggaggaattacatgaaacataacnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnna
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

tagttggaatcaatataaggaatattcactgatagcgcacgcttcatagcgtgtgcttgtagataaaggcacacgttgggaaacatgcgccatcgtaggaaactattggaggaattacatgaaacataacnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnna
Predict TransTerm conf > 70================================================
TransTerm Strand: -	Conf: 87	HP_score: -9.6	Tail_Score: -4.03234	Start: 68	End: 91	Full_Region: atagtttcctacgat ggcgcatgtt tccc aacgtgtgcc tttatctacaagcac
...................................................................ggcgcatgtttcccaacgtgtgcc...............................................................................................................................................................................................................................

Find igs database================================================
Query_seq: AA01169:AA01170|AA01169:AA01170:hypothetical protein:hypothetical protein:->->:802290..802603 314
tagttggaatcaatataaggaatattcactgatagcgcacgcttcatagcgtgtgcttgtagataaaggcacacgttgggaaacatgcgccatcgtaggaaactattggaggaattacatgaaacataacnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnna
Intra-Species Hit: Count: 1	Min: 1	Max: 130	Len: 130
Subject: aact_AA01169_AA01170|hypothetical protein:hypothetical protein|POSITIVE:POSITIVE|[802290,802603]|314
HSP  1	e-value: 1.0E-67	bit: 258.0	Len: 130	Query Start:1	Query End:130	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 130
tagttggaatcaatataaggaatattcactgatagcgcacgcttcatagcgtgtgcttgtagataaaggcacacgttgggaaacatgcgccatcgtaggaaactattggaggaattacatgaaacataac........................................................................................................................................................................................
tagttggaatcaatataaggaatattcactgatagcgcacgcttcatagcgtgtgcttgtagataaaggcacacgttgggaaacatgcgccatcgtaggaaactattggaggaattacatgaaacataac........................................................................................................................................................................................

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UAGUUGGAAUCAAUAUAAGGAAUAUUCACUGAUAGCGCACGCUUCAUAGCGUGUGCUUGUAGAUAAAGGCACACGUUGGGAAACAUGCGCCAUCGUAGGAAACUAUUGGAGGAAUUACAUGAAACAUAAC
..((((....))))..........((((..(((.(((((.(.(((.((((((((((((........)))))))))))).))).).))))).))).(((....)))..............))))....... (-37.90)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
GUUAUGUUUCAUGUAAUUCCUCCAAUAGUUUCCUACGAUGGCGCAUGUUUCCCAACGUGUGCCUUUAUCUACAAGCACACGCUAUGAAGCGUGCGCUAUCAGUGAAUAUUCCUUAUAUUGAUUCCAACUA
.........................(((((......(((((((((((((((....(((((((............)))))))....))))))))))))))).((.(((((.....))))).))...))))) (-38.10)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
495	90	43	171	114	aact:AA02450|5end_conserved_hypothetical_protein_1687701..1687931_POSITIVE
395	90	41	144	82	aact:AA01770|5end_hypothetical_protein_1193111..1193341_POSITIVE
387	96	51	180	136	aact:AA02212|5end_ribonucleoside-diphosphate_reductase_beta_chain_1506012..1506242_POSITIVE
377	94	56	56	15	aact:AA02199|5end_hypothetical_protein_1497627..1497857_POSITIVE
361	79	35	45	3	aact:AA00908|5end_probable_sigma-E_factor_regulatory_protein_626076..626306_POSITIVE
360	90	41	205	144	aact:AA02446|5end_conserved_hypothetical_protein_1686841..1687071_POSITIVE
359	99	67	66	22	aact:AA02449|5end_hypothetical_protein_1687575..1687805_POSITIVE
347	56	15	151	114	aact:AA01982|5end_maltodextrin_phosphorylase_1339387..1339617_POSITIVE
346	95	55	153	105	aact:AA01939|5end_NAD(P)_transhydrogenase_subunit_beta_1311039..1311269_POSITIVE
334	99	53	200	140	aact:AA02300|5end_glutamate_racemase_1571348..1571578_POSITIVE
334	80	35	121	63	aact:AA00745|5end_galactokinase_511163..511393_POSITIVE
334	99	53	205	145	aact:AA00623|5end_hypothetical_protein_430457..430687_POSITIVE
334	99	53	197	137	aact:AA00414|5end_possible_histidinol-phosphatase_280899..281129_POSITIVE
324	60	11	211	162	aact:AA02573|5end_ABC_transporter,_ATP-binding_protein_1790409..1790639_POSITIVE
324	90	43	109	62	aact:AA01169|5end_hypothetical_protein_801985..802215_POSITIVE
309	109	69	49	7	aact:AA01408|5end_conserved_hypothetical_protein_950191..950421_POSITIVE
309	96	51	173	128	aact:AA00482|5end_hydrolase_(haloacid_dehalogenase-like)_(HAD_superfamily)_335232..335462_POSITIVE
308	97	51	164	128	aact:AA01458|5end_aminotransferase_978820..979050_POSITIVE
308	105	63	143	102	aact:AA01173|5end_VapD-homolog_803850..804080_POSITIVE
302	60	23	144	105	aact:AA02570|5end_conserved_hypothetical_protein_1789150..1789380_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
395	90	41	85	23	aact:AA01769|3end_hypothetical_protein_1193132..1193282_POSITIVE
368	94	61	41	8	aact:AA02196|3end_oxaloacetate_decarboxylase_beta_chain_1497692..1497842_POSITIVE
361	96	52	44	1	aact:AA02210|3end_ribonucleoside-diphosphate_reductase_alpha_chain_1505956..1506106_POSITIVE
360	90	41	56	3	aact:AA01169|3end_hypothetical_protein_802229..802379_POSITIVE
347	56	15	38	1	aact:AA01981|3end_4-alpha-glucanotransferase_1339354..1339504_POSITIVE
346	95	55	139	91	aact:AA01938|3end_NAD(P)_transhydrogenase_subunit_alpha_1311105..1311255_POSITIVE
334	80	35	124	66	aact:AA00744|3end_aldose_1-epimerase_(mutarotase)_511246..511396_POSITIVE
324	90	43	62	15	aact:AA01168|3end_6-phosphogluconolactonase_802018..802168_POSITIVE
321	79	34	79	25	aact:AA01001|3end_conserved_hypothetical_protein_699974..700124_POSITIVE
321	53	11	123	74	aact:AA00026|3end_conserved_hypothetical_protein_20542..20692_POSITIVE
313	120	71	76	16	aact:AA02954|3end_penicillin_tolerance_protein;_hydroxymethylbutenyl_pyrophosphate_reductase_2066631..2066781_POSITIVE
309	96	51	60	15	aact:AA00480|3end_mannose-specific_phosphotransferase_system_IID_335199..335349_POSITIVE
308	97	51	72	36	aact:AA01457|3end_D-xylose_ABC_transporter,_membrane_spanning_protein_978808..978958_POSITIVE
308	105	63	60	19	aact:AA01172|3end_conserved_hypothetical_protein_803847..803997_POSITIVE
303	79	32	73	28	aact:AA02444|3end_hypothetical_protein_1686635..1686785_POSITIVE
302	60	23	98	59	aact:AA02569|3end_hypothetical_protein_1789184..1789334_POSITIVE
299	66	25	78	34	aact:AA01054|3end_conserved_hypothetical_protein_733940..734090_POSITIVE
298	116	72	85	47	aact:AA00530|3end_hypothetical_protein_362668..362818_POSITIVE
287	80	36	146	97	aact:AA02208|3end_tryptophan_synthase,__alpha_subunit_1503996..1504146_POSITIVE
284	46	4	133	96	aact:AA01601|3end_PTS_system,_glucose-specific_IIA_componen_1082846..1082996_POSITIVE