Origin IGS:
tttagctccaatttaaaattttttccagtttactgaaaaaatctaattcggttcatgcggtaggtgtctaaaacagctttccgtaccggtatggcaagtcggtacgacaggactcgccaaaatcaacaacgtatcctgatcatcgcagtccggactcatatccaccacgttcaagaaatttcccgaggtttgctttgcgcccatgaaaagaatgtcactctcttcctcactaaggtttttcaaagtttctctccgggaaattaatatttcacagattatgaaattttgtctgagaacagggaggagattattgcttttttgtatgaattttttcaaagaaaaaatccgttcatta
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
taatgaacggattttttctttgaaaaaattcatacaaaaaagcaataatctcctccctgttctcagacaaaatttcataatctgtgaaatattaatttcccggagagaaactttgaaaaaccttagtgaggaagagagtgacattcttttcatgggcgcaaagcaaacctcgggaaatttcttgaacgtggtggatatgagtccggactgcgatgatcaggatacgttgttgattttggcgagtcctgtcgtaccgacttgccataccggtacggaaagctgttttagacacctaccgcatgaaccgaattagattttttcagtaaactggaaaaaattttaaattggagctaaa

Mask Tandem Repeat Region ================================================
tttagctccaatttaaaattttttccagtttactgaaaaaatctaattcggttcatgcggtaggtgtctaaaacagctttccgtaccggtatggcaagtcggtacgacaggactcgccaaaatcaacaacgtatcctgatcatcgcagtccggactcatatccaccacgttcaagaaatttcccgaggtttgctttgcgcccatgaaaagaatgtcactctcttcctcactaaggtttttcaaagtttctctccgggaaattaatatttcacagattatgaaattttgtctgagaacagggaggagattattgcttttttgtatgaattttttcaaagaaaaaatccgttcatta

Find is-nt database================================================
Query_seq: AA01222:AA01223|AA01222:AA01223:hypothetical protein:branched-chain amino acid carrier protein:->->:834447..834801 355
tttagctccaatttaaaattttttccagtttactgaaaaaatctaattcggttcatgcggtaggtgtctaaaacagctttccgtaccggtatggcaagtcggtacgacaggactcgccaaaatcaacaacgtatcctgatcatcgcagtccggactcatatccaccacgttcaagaaatttcccgaggtttgctttgcgcccatgaaaagaatgtcactctcttcctcactaaggtttttcaaagtttctctccgggaaattaatatttcacagattatgaaattttgtctgagaacagggaggagattattgcttttttgtatgaattttttcaaagaaaaaatccgttcatta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: AA01222:AA01223|AA01222:AA01223:hypothetical protein:branched-chain amino acid carrier protein:->->:834447..834801 355
tttagctccaatttaaaattttttccagtttactgaaaaaatctaattcggttcatgcggtaggtgtctaaaacagctttccgtaccggtatggcaagtcggtacgacaggactcgccaaaatcaacaacgtatcctgatcatcgcagtccggactcatatccaccacgttcaagaaatttcccgaggtttgctttgcgcccatgaaaagaatgtcactctcttcctcactaaggtttttcaaagtttctctccgggaaattaatatttcacagattatgaaattttgtctgagaacagggaggagattattgcttttttgtatgaattttttcaaagaaaaaatccgttcatta
Intra-Species Hit: Count: 0

Inter-species Hit: Count: 1	Min: 52	Max: 321	Len: 270
Subject: gi|89108847|ref|AP_002627.1| fused phosphoribosyl-AMP cyclohydrolase and phosphoribosyl-ATP pyrophosphatase [Escherichia coli W3110]
HSP  1	e-value: 4.0E-15	bit: 76.6	Len: 270	Query Start:52	Query End:321	Subject Strand: null	Subject Start: 13	Subject End: 111
................................................... Q  K  S  N  N  L  L  P  V  L  R  Q  N  F  I  I  C  E  I  L  I  -  -  -  S  R  R  E  T  L  K  N  L  S  E  E  E  S  D  I  L  F  M  G  A  K  Q  -  -  -  -  -  -  -  T  S  G  N  F  L  N  V  V  D  M  S  P  D  C  D  D  Q  D  T  L  L  I  L  A  S  P  V  V  P  T  C  H  T  G  T  E  S  C  F  R  H  L  P  H  E ..................................
................................................... E  K  T  D  G  L  M  P  V  I  V  Q  H  A  V  S  G  E  V  L  M  L  G  Y  M  N  P  E  A  L  D  K  T  L  E  S  G  K  V  T  F  F  S  R  T  K  Q  R  L  W  T  K  G  E  T  S  G  N  F  L  N  V  V  S  I  A  P  D  C  D  N  -  D  T  L  L  V  L  A  N  P  I  G  P  T  C  H  K  G  T  S  S  C  F  G  D  T  A  H  Q ..................................


Find nr database================================================
Query_seq: AA01222:AA01223|AA01222:AA01223:hypothetical protein:branched-chain amino acid carrier protein:->->:834447..834801 355
tttagctccaatttaaaattttttccagtttactgaaaaaatctaattcggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntatgaattttttcaaagaaaaaatccgttcatta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

tttagctccaatttaaaattttttccagtttactgaaaaaatctaattcggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntatgaattttttcaaagaaaaaatccgttcatta
Predict ORF larger than 30AA ================================================
Protein_Len: 60	Strand: +	Start: 64	End: 261
............................................................... M  S  K  T  A  F  R  T  G  M  A  S  R  Y  D  R  T  R  Q  N  Q  Q  R  I  L  I  I  A  V  R  T  H  I  H  H  V  Q  E  I  S  R  G  L  L  C  A  H  E  K  N  V  T  L  F  L  T  K  V  F  Q ..............................................................................................
Protein_Len: 60	Strand: +	Start: 158	End: 355
............................................................................................................................................................. M  S  T  T  F  K  K  F  P  E  V  C  F  A  P  M  K  R  M  S  L  S  S  S  L  R  F  F  K  V  S  L  R  E  I  N  I  S  Q  I  M  K  F  C  L  R  T  G  R  R  L  L  L  F  C  M  N  F  F  K 
Protein_Len: 60	Strand: -	Start: 46	End: 345
............................................. V  N  L  F  N  G  S  T  Q  K  A  G  M  F  L  I  D  S  E  E  E  S  L  N  K  L  T  E  R  R  S  I  L  I  E  C  I  I  F  N  Q  R  L  V  P  L  L  N  N  S  K  Q  I  F  K  K  L  S  F  M ..........

tttagctccaatttaaaattttttccagtttactgaaaaaatctaattcggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntatgaattttttcaaagaaaaaatccgttcatta
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

tttagctccaatttaaaattttttccagtttactgaaaaaatctaattcggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntatgaattttttcaaagaaaaaatccgttcatta
Predict TransTerm conf > 70================================================

Find igs database================================================
Query_seq: AA01222:AA01223|AA01222:AA01223:hypothetical protein:branched-chain amino acid carrier protein:->->:834447..834801 355
tttagctccaatttaaaattttttccagtttactgaaaaaatctaattcggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntatgaattttttcaaagaaaaaatccgttcatta
Intra-Species Hit: Count: 1	Min: 1	Max: 355	Len: 355
Subject: aact_AA01222_AA01223|hypothetical protein:branched-chain amino acid carrier protein|POSITIVE:POSITIVE|[834447,834801]|355
HSP  1	e-value: 3.0E-19	bit: 97.6	Len: 49	Query Start:1	Query End:49	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 49
tttagctccaatttaaaattttttccagtttactgaaaaaatctaattc..................................................................................................................................................................................................................................................................................................................
tttagctccaatttaaaattttttccagtttactgaaaaaatctaattc..................................................................................................................................................................................................................................................................................................................
HSP  2	e-value: 2.0E-10	bit: 67.9	Len: 34	Query Start:322	Query End:355	Subject Strand: POSITIVE	Subject Start: 322	Subject End: 355
.................................................................................................................................................................................................................................................................................................................................tatgaattttttcaaagaaaaaatccgttcatta
.................................................................................................................................................................................................................................................................................................................................tatgaattttttcaaagaaaaaatccgttcatta

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UUUAGCUCCAAUUUAAAAUUUUUUCCAGUUUACUGAAAAAAUCUAAUUCGGUUCAUGCGGUAGGUGUCUAAAACAGCUUUCCGUACCGGUAUGGCAAGUCGGUACGACAGGACUCGCCAAAAUCAACAACGUAUCCUGAUCAUCGCAGUCCGGACUCAUAUCCACCACGUUCAAGAAAUUUCCCGAGGUUUGCUUUGCGCCCAUGAAAAGAAUGUCACUCUCUUCCUCACUAAGGUUUUUCAAAGUUUCUCUCCGGGAAAUUAAUAUUUCACAGAUUAUGAAAUUUUGUCUGAGAACAGGGAGGAGAUUAUUGCUUUUUUGUAUGAAUUUUUUCAAAGAAAAAAUCCGUUCAUUA
.....((((........((((((((.((....))))))))))....(((((....((((((.(.(((.....))).)....((((((((.........)))))))).(((((..((.............))..)))))...))))))..)))))..........((..((((....(((((((((..(...((((((.(((..(((.((((.........))))..)))....)))....))))))....)..))))))))).........(((((...........))))).))))..)).)))).............((.(((.((((((((...)))))))).))).))... (-80.92)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UAAUGAACGGAUUUUUUCUUUGAAAAAAUUCAUACAAAAAAGCAAUAAUCUCCUCCCUGUUCUCAGACAAAAUUUCAUAAUCUGUGAAAUAUUAAUUUCCCGGAGAGAAACUUUGAAAAACCUUAGUGAGGAAGAGAGUGACAUUCUUUUCAUGGGCGCAAAGCAAACCUCGGGAAAUUUCUUGAACGUGGUGGAUAUGAGUCCGGACUGCGAUGAUCAGGAUACGUUGUUGAUUUUGGCGAGUCCUGUCGUACCGACUUGCCAUACCGGUACGGAAAGCUGUUUUAGACACCUACCGCAUGAACCGAAUUAGAUUUUUUCAGUAAACUGGAAAAAAUUUUAAAUUGGAGCUAAA
........((((((((((...))))))))))..........((.......(((.((.(((((..(((....(((((((.....)))))))...(((((((((..(.....(((((.....(((.......(((((((((...)))))))))..)))..)))))....)..)))))))))))).))))).)).))).....(((.(((((((.(.((((((.(.....).)))))).).)).)))))..((((((((...........))))))))............))).......)).....((((.((((((((((((((....)))))))))..))))).))))....... (-93.00)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
387	117	79	215	160	aact:AA01419|5end_D-ribulose-phosphate-3_epimerase_954378..954608_POSITIVE
385	130	82	178	127	aact:AA00163|5end_type_IV_prepilin_peptidase;_type_II_secretion_pathway_related_protein_116006..116236_POSITIVE
376	118	76	46	1	aact:AA01519.1|5end_conserved_hypothetical_protein_1022466..1022696_POSITIVE
368	150	101	218	152	aact:AA01054|5end_conserved_hypothetical_protein_733678..733908_POSITIVE
367	118	75	224	179	aact:AA00123|5end_hypothetical_protein_90221..90451_POSITIVE
367	118	75	215	170	aact:AA00122|5end_hypothetical_protein_90212..90442_POSITIVE
359	160	114	86	40	aact:AA00574|5end_regulatory_protein_392113..392343_POSITIVE
355	200	151	207	148	aact:AA01730|5end_conserved_hypothetical_protein_(possible_transcriptional_regulator)_1168725..1168955_POSITIVE
355	200	151	67	8	aact:AA01729|5end_hypothetical_protein_1168585..1168815_POSITIVE
347	129	81	207	147	aact:AA00528|5end_conserved_hypothetical_protein_361396..361626_POSITIVE
344	107	63	162	120	aact:AA00409|5end_methionyl-tRNA_formyltransferase_273611..273841_POSITIVE
342	230	181	109	60	aact:AA01724|5end_valyl-tRNA_synthetase_1164446..1164676_POSITIVE
342	119	75	56	16	aact:AA01547|5end_deoxyribose-phosphate_aldolase_1036271..1036501_POSITIVE
341	110	64	61	19	aact:AA00479|5end_mannose-specific_phosphotransferase_system_IIC_333475..333705_POSITIVE
340	116	77	146	99	aact:AA01950|5end_ABC_transporter,_membrane_spanning_protein_1318116..1318346_POSITIVE
339	117	74	186	127	aact:AA02199|5end_hypothetical_protein_1497627..1497857_POSITIVE
337	206	167	135	95	aact:AA01996|5end_prephenate_dehydrogenase_1355314..1355544_POSITIVE
337	129	82	231	177	aact:AA01383|5end_DNA_processing_chain_A_934171..934401_POSITIVE
325	129	81	174	131	aact:AA01418|5end_conserved_hypothetical_protein_953951..954181_POSITIVE
324	124	81	195	152	aact:AA02439|5end_integral_membrane_protein;_possible_ABC_transporter_permease_1683902..1684132_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
387	117	79	63	8	aact:AA01418|3end_conserved_hypothetical_protein_954306..954456_POSITIVE
355	200	151	67	8	aact:AA01728|3end_conserved_hypothetical_protein(related_to_HipA_protein)_1168665..1168815_POSITIVE
345	119	76	146	115	aact:AA00377|3end_acetyl-CoA_acetyltransferase_(Beta-ketothiolase,3-ketoacyl-CoA_thiolase)_254300..254450_POSITIVE
344	118	74	113	70	aact:AA01291|3end_excinuclease_ABC_subunit_A_876001..876151_POSITIVE
340	116	77	146	99	aact:AA01948|3end_ABC_transporter_permease,_membrane_spanning_protein_1318196..1318346_POSITIVE
337	110	62	53	1	aact:AA02552|3end_iron_(chelated)_ABC_transporter,_permease_protein_1779420..1779570_POSITIVE
337	206	167	135	95	aact:AA01995|3end_conserved_hypothetical_protein_(possible_chorismate_mutase)_1355394..1355544_POSITIVE
332	66	24	143	102	aact:AA01305|3end_conserved_hypothetical_protein_886520..886670_POSITIVE
328	114	73	47	9	aact:AA00478|3end_mannose-specific_phosphotransferase_element_333534..333684_POSITIVE
319	130	81	127	68	aact:AA01046|3end_conserved_hypothetical_protein_729280..729430_POSITIVE
318	119	74	50	2	aact:AA01422|3end_cell_division_protein_E,_ABC_system_ATP-binding_protein_956736..956886_POSITIVE
315	188	141	59	5	aact:AA01976|3end_colicin_V_production_protein_1337132..1337282_POSITIVE
314	117	74	90	39	aact:AA01183|3end_conserved_hypothetical_protein_810902..811052_POSITIVE
313	126	81	89	48	aact:AA01829|3end_hypothetical_protein_1231662..1231812_POSITIVE
312	133	94	55	22	aact:AA01692|3end_hexulose-6-phosphate_synthase_1149929..1150079_POSITIVE
306	119	75	76	19	aact:AA00740|3end_citrate_lyase_related_biosynthesis_protein_(2-(5'-triphosphoribosyl)-3'-dephosphocoenzyme-A_synthase)_506749..506899_POSITIVE
299	189	141	53	4	aact:AA02205|3end_short_chain_dehydrogenase/reductase_1501984..1502134_POSITIVE
299	104	62	78	35	aact:AA02019|3end_hypothetical_protein_1373925..1374075_POSITIVE
298	110	64	111	61	aact:AA01875|3end_PTS_system,_glucose-specific_enzyme_II,_A_component_1263506..1263656_POSITIVE
298	116	75	52	7	aact:AA01184|3end_hypothetical_protein_811133..811283_POSITIVE