CDS GC%: 46.8% tRNA GC%: 55.2% rRNA GC%: 51.6%

IGS#	Up stream Locus	Up stream Product	Down Stream Locus	Down Stream Product	Gene Dir type	Start	End	IGS Len	GC%	IS NT	IS AA	NR	PT-Pair	Intra Spp. IGS	Inter Spp. IGS	Conserved Inter-spp IGS Start	Conserved Inter-spp IGS End	Blast Result	Conserved IGS Seq
1	TF3165	thiol:disulfide interchange protein, thioredoxin family protein	TF0001	hypothetical protein	->->	1	3405543	163	46.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
4	TF0011	conserved hypothetical protein	TF0012	conserved hypothetical protein	->->	5458	5651	194	33%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
5	TF0018	hypothetical protein	TF0019	heat shock protein ClpB	->->	12152	12589	438	46.8%	0	0	0	+: 0/3/0 \| -: 0/1/0	10	0	0	0	Result
6	TF0019	heat shock protein ClpB	TF0020	possible glycoprotein endopeptidase	->->	15176	15372	197	37.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
7	TF0021	outer membrane phospholipase A	TF0022	two-component system sensor histidine kinase	->->	16980	17434	455	41.8%	0	0	0	+: 0/0/0 \| -: 0/1/0	11	1	240	346	Result	atattactatgtatttaatgacaccaacagcggtgtatggataaaggtaaaccaaagaaactgtgtgtattacaggtttgagataactgcgtacttgtggcgtcgat
8	TF0024	conserved hypothetical protein; possible ATPase	TF0025	hypothetical protein	->->	21687	21798	112	37.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
9	TF0027	conserved hypothetical protein	TF0028	hypothetical protein	->->	24260	24388	129	41.9%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
10	TF0029	hypothetical protein	TF0030	N-acetylneuraminate lyase	->->	25123	25909	787	40.9%	0	0	0	+: 0/1/0 \| -: 0/2/0	28	0	0	0	Result
11	TF0038	conserved hypothetical protein	TF0039	conserved hypothetical protein	->->	41274	41546	273	39.2%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
12	TF0045	outer membrane protein, TonB dependent receptor	TF0046	thiamin biosynthesis lipoprotein, ApbE	->->	52151	52661	511	40.9%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
13	TF0046	thiamin biosynthesis lipoprotein, ApbE	TF0047	hypothetical protein	->->	53838	53983	146	37%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
14	TF0054	possible flavodoxin	TF0055	integrase fragment, N-terminal	->->	58521	58845	325	34.2%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
15	TF0057	conserved hypothetical protein	TF0058	conserved hypothetical protein	->->	59808	59972	165	40%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
16	TF0058	conserved hypothetical protein	TF0059	hypothetical protein	->->	60675	61468	794	35.6%	0	24	0	+: 0/3/0 \| -: 1/3/3	1	0	0	0	Result
17	TF0066	conserved hypothetical protein	TF0067	hypothetical protein	->->	73182	73382	201	23.4%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
18	TF0069	conserved hypothetical protein	TF0070	possible regulatory element	->->	76942	77081	140	27.9%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
19	TF0070	possible regulatory element	TF0071	conserved hypothetical protein	->->	77796	78147	352	35.5%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
21	TF0075	transcriptional regulator	TF0076	probable carbohydrate kinase, PfkB family	->->	83179	83418	240	38.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
22	TF0077	hypothetical protein	TF0078	aminopeptidase C, peptidase C1-like family	->->	84552	84668	117	26.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
23	TF0079	conserved hypothetical protein	TF0080	phosphate ABC transporter, periplasmic phosphate-binding protein	->->	86334	86464	131	36.6%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
24	TF0080	phosphate ABC transporter, periplasmic phosphate-binding protein	TF0081	pantothenate kinase	->->	87422	87603	182	31.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
26	TF0082	transcriptional regulator, TetR family	TF0083	outer membrane efflux protein	->->	89325	89428	104	28.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
27	TF0089	conserved hypothetical protein	TF0090	conserved hypothetical protein	->->	96132	96424	293	31.7%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
28	TF0094	alpha-glucosidase	TF0095	methyltransferase	->->	105825	106032	208	27.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
29	TF0095	methyltransferase	TF0096	tRNA-guanine transglycosylase (queuine tRNA-ribosyltransferase)	->->	106906	107110	205	45.4%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
30	TF0100	conserved hypothetical protein	TF0103	rubredoxin	->->	111764	111989	226	38.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
31	TF0103	rubredoxin	TF0104	redox-sensitive transcriptional activator, OxyR	->->	112149	112426	278	28.8%	0	0	0	+: 1/1/0 \| -: 0/0/0	1	0	0	0	Result
32	TF0104	redox-sensitive transcriptional activator, OxyR	TF0105	DNA-binding stress protein, Dps family	->->	113369	113493	125	23.2%	0	0	0	+: 3/0/0 \| -: 0/0/0	1	0	0	0	Result
33	TF0107	ion channel protein	TF0108	thiamine biosynthesis protein, ThiF family	->->	115154	115307	154	31.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
34	TF0108	thiamine biosynthesis protein, ThiF family	TF0109	diacylglycerol kinase	->->	116061	116212	152	34.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
35	TF0109	diacylglycerol kinase	TF0110	unsaturated glucuronyl hydrolase	->->	116597	116971	375	36.8%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
36	TF0112	outer membrane protein	TF0113	4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase	->->	123088	123288	201	42.3%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
37	TF0120	hexouronate transporter	TF0121	hypothetical protein	->->	132872	133103	232	35.3%	0	0	0	+: 2/1/0 \| -: 0/0/0	1	0	0	0	Result
39	TF0127	conserved hypothetical protein	TF0128	hypothetical protein	->->	139921	140331	411	29.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
40	TF0128	hypothetical protein	TF0129	hypothetical protein	->->	140617	141704	1088	32.1%	0	0	0	+: 0/3/0 \| -: 1/1/1	1	0	0	0	Result
42	TF0135	hypothetical protein	TF0137	conserved hypothetical protein	->->	146615	146724	110	31.8%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
43	TF0137	conserved hypothetical protein	TF0139	4-diphosphocytidyl-2c-methyl-D-erythritol synthase (MEP cytidylyltransferase) (MCT)	->->	147301	147666	366	38.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
44	TF0145	glutamine synthetase	TF0146	glutamine-dependent NAD(+) synthetase	->->	154779	154994	216	45.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	4	0	0	0	Result
46	TF0152	RNA polymerase ECF-type sigma factor	TF0153	conserved hypothetical protein	->->	162743	162877	135	25.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
48	TF0170	possible CRISPR-associated protein Cas2	TF0171	hypothetical protein	->->	179967	180085	119	31.1%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
50	TF0175	hypothetical protein	TF0176	hypothetical protein	->->	185968	186659	692	36.3%	0	47	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
51	TF0176	hypothetical protein	TF0177	hypothetical protein	->->	186840	187064	225	40%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
52	TF0177	hypothetical protein	TF0178	ferritin	->->	187215	187752	538	32.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
53	TF0178	ferritin	TF0179	pyrophosphate-energized proton pump	->->	188284	188552	269	46.5%	0	0	0	+: 0/2/0 \| -: 0/3/0	1	0	0	0	Result
54	TF0179	pyrophosphate-energized proton pump	TF0180	carboxynorspermidine decarboxylase	->->	190752	191406	655	40%	0	0	0	+: 0/1/0 \| -: 1/1/1	19	0	0	0	Result
55	TF0181	ATP-dependent DNA helicase	TF0182	DNA-binding protein, HU-related	->->	194924	195318	395	31.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
56	TF0182	DNA-binding protein, HU-related	TF0184	dihydroneopterin aldolase	->->	195589	195768	180	37.8%	0	0	0	+: 0/1/0 \| -: 1/1/0	1	0	0	0	Result
57	TF0186	ribonucleotide reductase, alpha subunit	TF0187	ferredoxin	->->	201873	202290	418	33.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
58	TF0187	ferredoxin	TF0188	membrane-associated porT protein	->->	202459	202598	140	22.9%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
61	TF0199	conserved hypothetical protein	TF0200	2-nitropropane dioxygenase	->->	224125	225200	1076	39.1%	0	27	0	+: 0/2/0 \| -: 1/3/2	1	0	0	0	Result
62	TF0202	folylpolyglutamate synthase	TF0203	PhoH-like protein	->->	229165	229394	230	28.7%	0	0	0	+: 2/0/0 \| -: 0/0/0	1	0	0	0	Result
63	TF0206	conserved hypothetical protein	TF0207	conserved hypothetical protein	->->	233054	233244	191	41.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
67	TF0215	tRNA/rRNA methyltransferase, TrmH family	TF0216	50S ribosomal protein L20	->->	242395	242615	221	33.5%	0	0	0	+: 0/1/0 \| -: 1/1/0	1	0	0	0	Result
68	TF0219	threonyl-tRNA synthetase	TF0220	conserved hypothetical protein	->->	245939	246369	431	34.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
69	TF0225	iron-containing alcohol dehydrogenase	TF0227	transcriptional regulator, Crp/Fnr family	->->	252799	252959	161	34.8%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
70	TF0228	probable integral outer membrane protein	TF0229	beta-galactosidase	->->	254870	254996	127	45.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
71	TF0234	5,10-methylenetetrahydrofolate reductase	TF0235	hypothetical protein	->->	261573	261705	133	37.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
72	TF0236	multidrug resistance protein	TF0237	outer membrane protein, TonB dependent receptor	->->	263275	263808	534	25.8%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
73	TF0246	saccharopine dehydrogenase	TF0247	conserved hypothetical protein	->->	277591	277718	128	27.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
74	TF0254	hypothetical protein	TF0255	conserved hypothetical protein	->->	285745	285946	202	33.2%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	1	1	181	Result	taaataactcctctggattaccttgtagaactcttggaattctctgggcaaagtatttctattttccaaggggctttaactaattcagaattgaaatataaatagctaaggagtattttattatgttacatactccaactgttttatactccaactgtttttgtaaagaaatttctccgtt
75	TF0256	conserved hypothetical protein	TF0257	hypothetical protein	->->	287649	287749	101	42.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
76	TF0258	hypothetical protein	TF0259	conserved hypothetical protein	->->	289595	289889	295	40.7%	0	0	0	+: 0/2/0 \| -: 0/2/0	1	0	0	0	Result
78	TF0260	conserved hypothetical protein	TF0261	conserved hypothetical protein	->->	291655	291923	269	39%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
81	TF0266	conserved hypothetical protein	TF0267	conserved hypothetical protein	->->	295795	295942	148	31.8%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
84	TF0272	outer membrane protein	TF0273	DNA polymerase III, epsilon chain	->->	299788	299908	121	34.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
85	TF0274	hypothetical protein	TF0276	hypothetical protein	->->	300549	300823	275	29.5%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
86	TF0279	conserved hypothetical protein	TF0280	hypothetical protein	->->	308740	308946	207	55.1%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
87	TF0294	possible translation factor	TF0296	hypothetical protein	->->	321963	322080	118	44.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
88	TF0297	RNA polymerase sigma-70 factor, ECF subfamily	TF0298	dipeptidase	->->	322977	323266	290	34.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
89	TF0301	outer membrane protein, TonB dependent receptor	TF0303	conserved hypothetical protein	->->	328237	328470	234	37.2%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
90	TF0305	peptidyl-prolyl cis-trans isomerase	TF0306	transglutaminase-like enzyme/cysteine protease	->->	331173	331372	200	34%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
91	TF0306	transglutaminase-like enzyme/cysteine protease	TF0307	conserved hypothetical protein	->->	332810	332922	113	41.6%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
92	TF0308	hypothetical protein	TF0309	conserved hypothetical protein	->->	334143	334313	171	45.6%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
93	TF0311	conserved hypothetical protein	TF0312	outer membrane protein	->->	336444	336612	169	37.3%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
94	TF0315	hypothetical protein	TF0317	conserved hypothetical protein	->->	341560	341725	166	28.9%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
95	TF0318	outer membrane protein, TonB dependent receptor	TF0319	tolB protein	->->	344362	344678	317	33.4%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
96	TF0319	tolB protein	TF0320	dihydroorotase	->->	345798	346201	404	28.7%	0	0	0	+: 1/0/0 \| -: 1/1/0	1	0	0	0	Result
97	TF0321	glycosyltransferase	TF0322	possible YngK protein	->->	348358	348484	127	33.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
98	TF0323	NAD-dependent epimerase/dehydratase family protein	TF0324	conserved hypothetical protein	->->	351114	351367	254	45.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
99	TF0339	hypothetical protein	TF0340	hypothetical protein	->->	363808	364032	225	52.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	18	0	0	0	Result
100	TF0340	hypothetical protein	TF0341	conserved hypothetical protein	->->	364318	364487	170	45.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	2	0	0	0	Result
101	TF0344	hypothetical protein	TF0346	hypothetical protein	->->	367024	367187	164	51.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	6	0	0	0	Result
102	TF0346	hypothetical protein	TF0347	possible serine protease	->->	367377	367681	305	46.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	6	0	0	0	Result
103	TF0347	possible serine protease	TF0348	hypothetical protein	->->	369605	370069	465	35.9%	0	0	0	+: 1/2/0 \| -: 0/0/0	1	0	0	0	Result
104	TF0349	hypothetical protein	TF0350	hypothetical protein	->->	370780	370933	154	42.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	7	0	0	0	Result
107	TF0358	hypothetical protein	TF0359	conserved hypothetical protein	->->	376365	377082	718	43.5%	0	0	0	+: 0/4/0 \| -: 0/0/0	20	0	0	0	Result
108	TF0361	hypothetical protein	TF0362	hypothetical protein	->->	379871	380091	221	46.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	9	0	0	0	Result
109	TF0362	hypothetical protein	TF0364	ysyl endopeptidase	->->	380260	380534	275	47.3%	0	0	0	+: 0/0/0 \| -: 0/1/0	5	0	0	0	Result
110	TF0365	hypothetical protein	TF0366	hypothetical protein	->->	383213	383703	491	44.2%	0	0	0	+: 0/0/0 \| -: 1/0/0	11	0	0	0	Result
111	TF0366	hypothetical protein	TF0367	eukaryotic-like metalloproteinase	->->	383872	384146	275	47.6%	0	0	0	+: 0/0/0 \| -: 0/1/0	5	0	0	0	Result
112	TF0367	eukaryotic-like metalloproteinase	TF0368	hypothetical protein	->->	385365	385540	176	30.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
113	TF0368	hypothetical protein	TF0369	hypothetical protein	->->	385895	386072	178	38.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
114	TF0370	hypothetical protein	TF0371	beta-mannosidase precursor	->->	386378	386902	525	45.3%	0	0	0	+: 0/2/0 \| -: 0/1/0	4	0	0	0	Result
115	TF0371	beta-mannosidase precursor	TF0372	transcriptional regulator	->->	390530	390677	148	33.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
116	TF0377	FtsK/SpoIIIE family cell division protein	TF0378	aspartyl-tRNA synthetase	->->	397529	397780	252	36.1%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
118	TF0381	cell cycle protein	TF0382	transcription termination factor	->->	403089	403314	226	35.4%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
119	TF0382	transcription termination factor	TF0384	conserved hypothetical protein	->->	405289	405516	228	40.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
120	TF0383	alkyl hydroperoxide reductase, subunit C	TF0385	conserved hypothetical protein	->->	406117	406350	234	37.6%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
121	TF0386	transcriptional regulator, possible LuxR family	TF0387	hypothetical protein	->->	407640	407751	112	34.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
122	TF0390	conserved hypothetical protein	TF0391	hypothetical protein	->->	410129	410570	442	34.6%	0	8	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
123	TF0391	hypothetical protein	TF0393	conserved hypothetical protein	->->	412149	412423	275	31.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
124	TF0392	hypothetical protein	TF0394	oxaloacetate decarboxylase, alpha subunit (pyruvate carboxylase, C-terminal domain)	->->	413006	413407	402	36.8%	0	0	0	+: 0/2/0 \| -: 0/4/0	1	0	0	0	Result
125	TF0394	oxaloacetate decarboxylase, alpha subunit (pyruvate carboxylase, C-terminal domain)	TF0395	L-lactate permease	->->	415310	415555	246	26.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
126	TF0399	hypothetical protein	TF0401	hypothetical protein	->->	421268	421482	215	31.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
127	TF0410	8-amino-7-oxononanoate synthase	TF0411	methyltransferase	->->	428930	429056	127	37%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
128	TF0412	conserved hypothetical protein	TF0413	succinyl-diaminopimelate desuccinylase	->->	430424	430573	150	34%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
129	TF0419	conserved hypothetical protein	TF0421	alpha-L-fucosidase	->->	435855	436160	306	41.5%	0	0	0	+: 0/3/0 \| -: 0/1/0	1	0	0	0	Result
132	TF0425	outer membrane protein	TF0426	conserved hypothetical protein	->->	444766	444867	102	45.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
133	TF0428	methylmalonyl-CoA mutase, beta subunit	TF0429	ABC transporter, ATP-binding protein	->->	450094	450316	223	37.7%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
134	TF0431	hypothetical protein	TF0432	3-deoxy-manno-octulosonate cytidylyltransferase	->->	452531	452670	140	40%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
135	TF0434	CTP synthetase (UTP ammonia ligase)	TF0435	DNA mismatch repair protein	->->	457088	457321	234	40.6%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
136	TF0435	DNA mismatch repair protein	TF0436	conserved hyothetical protein	->->	459125	459346	222	39.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
137	TF0436	conserved hyothetical protein	TF0437	conserved hypothetical protein	->->	460889	461062	174	35.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
138	TF0447	hypothetical protein	TF0448	hypothetical protein	->->	467655	467803	149	31.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
140	TF0465	cobalamin biosynthesis protein	TF0466	amidophosphoribosyltransferase	->->	483974	484133	160	38.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
141	TF0467	acetyltransferase-related protein	TF0468	hypothetical protein	->->	486604	487068	465	47.7%	0	0	0	+: 0/4/0 \| -: 0/0/0	29	0	0	0	Result
142	TF0469	hypothetical protein	TF0470	hypothetical protein	->->	487289	487392	104	31.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
143	TF0474	outer membrane efflux protein	TF0475	possible transcriptional regulator, AraC family	->->	493723	493868	146	30.1%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
144	TF0475	possible transcriptional regulator, AraC family	TF0476	conserved hypothetical protein	->->	494886	495083	198	43.9%	0	0	0	+: 0/1/0 \| -: 0/1/0	5	0	0	0	Result
145	TF0480	ornithine carbamoyltransferase	TF0481	possible anti-sigma factor	->->	499650	499873	224	33.5%	0	0	0	+: 0/0/0 \| -: 1/0/0	2	0	0	0	Result
147	TF0489	D-xylose-proton symporter	TF0490	conserved hypothetical protein	->->	513130	513673	544	36.6%	0	0	0	+: 0/0/0 \| -: 0/1/0	2	0	0	0	Result
148	TF0496	conserved hypothetical protein	TF0497	conserved hypothetical protein	->->	523930	524197	268	50.4%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
149	TF0498	hypothetical protein	TF0499	hypothetical protein	->->	526016	526396	381	38.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
150	TF0499	hypothetical protein	TF0500	hypothetical protein	->->	526712	526827	116	41.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
151	TF0500	hypothetical protein	TF0501	conserved hypothetical protein, HicB-related	->->	526984	527088	105	32.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
153	TF0515	conserved hypothetical protein	TF0516	conserved hypothetical protein; possible membrane protein	->->	539636	539823	188	28.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
154	TF0518	glutaminyl-tRNA synthetase	TF0519	thiamine monophosphate kinase	->->	543620	543839	220	35.9%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
155	TF0522	hypothetical protein	TF0524	possible cation efflux pump (multidrug resistance protein)	->->	547934	548045	112	31.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
156	TF0525	conserved hypothetical protein	TF0527	prolyl endopeptidase	->->	549645	549811	167	46.1%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
157	TF0527	prolyl endopeptidase	TF0528	two-component system sensor histidine kinase	->->	552011	552496	486	47.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	4	73	265	Result	aaggggctgaccggttttgacagcgggcagaagtggtttgtaagcatgcagtgcgtcgttggccggcactttaatctcggttgatccaattttaactggcgaaaataactacgctctcgctgcttaatcgaagcacagtagattgaagcttaatccttacacaaggtgtttggacgagacatcacccggaagc
158	TF0530	hypothetical protein with TPR domain	TF0531	hypothetical protein	->->	556920	557202	283	32.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
159	TF0531	hypothetical protein	TF0532	hypothetical protein	->->	557530	557648	119	32.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
161	TF0535	surface antigen BspA	TF0536	conserved hypothetical protein	->->	561762	562056	295	43.7%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
162	TF0537	conserved hypothetical protein	TF0539	hypothetical protein	->->	566897	567023	127	56.7%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
163	TF0538	hypothetical protein	TF0540	conserved hypothetical protein; possible surface protein	->->	567196	567425	230	42.2%	0	0	0	+: 0/0/0 \| -: 0/1/0	4	0	0	0	Result
164	TF0541	conserved hypothetical protein	TF0542	hypothetical protein	->->	571919	572057	139	49.6%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
165	TF0546	conserved hypothetical protein	TF0547	DNA gyrase subunit A (topoisomerase)	->->	577366	577667	302	28.8%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
167	TF0550	stationary-phase-upregulated protein, UstA	TF0551	possible membrane-associated phospholipid phosphatase	->->	582985	583123	139	30.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
168	TF0559	methanol dehydrogenase regulator, MoxR-like; magnesium chelatase, subunit I	TF0560	DNA-binding protein	->->	592148	592303	156	26.3%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
169	TF0563	signal recognition particle-docking protein FtsY	TF0564	conserved hypothetical protein	->->	596304	596562	259	34%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
170	TF0566	hypothetical protein	TF0567	conserved hypothetical protein; possible periplasmic solute-binding protein	->->	598919	599129	211	28%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
171	TF0569	indolepyruvate ferredoxin oxidoreductase, beta subunit	TF0570	possible transcriptional regulator	->->	602439	602622	184	27.7%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
172	TF0570	possible transcriptional regulator	TF0571	hypothetical protein	->->	603088	603441	354	22%	0	0	0	+: 2/0/0 \| -: 0/0/0	1	0	0	0	Result
173	TF0572	hypothetical protein	TF0573	DNA polymerase III, delta subunit	->->	603691	603889	199	36.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
174	TF0576	hypothetical protein	TF0577	possible endo-1,4-beta-xylanase B	->->	606997	607114	118	37.3%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
175	TF0578	ribonuclease G	TF0579	DNA-binding protein HU	->->	609651	609863	213	29.1%	0	0	0	+: 0/3/0 \| -: 0/1/0	1	0	0	0	Result
176	TF0579	DNA-binding protein HU	TF0580	A/G-specific adenine glycosylase	->->	610185	610301	117	22.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
177	TF0584	phosphopantetheinyl transferase	TF0585	conserved hypothetical protein	->->	614516	614921	406	33.7%	0	0	0	+: 0/0/0 \| -: 3/0/0	1	0	0	0	Result
178	TF0585	conserved hypothetical protein	TF0586	conserved hypothetical protein	->->	616824	617452	629	42.3%	0	0	0	+: 0/4/0 \| -: 0/1/0	21	0	0	0	Result
179	TF0588	outer membrane protein	TF0589	anti-sigma factor	->->	623481	623685	205	33.2%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
180	TF0596	conserved hypothetical protein	TF0597	hypothetical protein	->->	628713	628927	215	40.5%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
181	TF0598	hypothetical protein	TF0599	hypothetical protein	->->	629561	629974	414	38.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	3	0	0	0	Result
184	TF0603	glycosyltransferase	TF0604	hypothetical protein	->->	634899	635524	626	43.6%	0	0	0	+: 0/1/0 \| -: 0/0/0	14	0	0	0	Result
185	TF0608	isoleucyl-tRNA synthetase	TF0609	conserved hypothetical protein	->->	641479	641805	327	35.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
186	TF0611	lysine decarboxylase	TF0610	conserved hypothetical protein; possible phosphatidylglycerophosphate synthase	->->	643424	643599	176	39.8%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
187	TF0610	conserved hypothetical protein; possible phosphatidylglycerophosphate synthase	TF0612	conserved hypothetical protein	->->	644104	644205	102	45.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
188	TF0613	conserved hypothetical protein	TF0614	UDP-glucose 6-dehydrogenase/UDP-N-acetyl-D-mannosaminuronate dehydrogenase	->->	647482	647660	179	37.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
190	TF0624	Xaa-Pro dipeptidase (aminopeptidase P)	TF0625	hypothetical protein	->->	661076	661282	207	42.5%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
191	TF0631	hypothetical protein	TF0632	hypothetical protein	->->	667687	667791	105	31.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
192	TF0633	hypothetical protein	TF0635	glucosylceramidase precursor	->->	669233	669360	128	28.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
193	TF0638	GTP-binding protein LepA	TF0639	hypothetical protein	->->	677344	678016	673	43.1%	0	0	0	+: 0/2/0 \| -: 0/3/0	2	0	0	0	Result
194	TF0643	probable tRNA methyltransferase	TF0644	pyruvate phosphate dikinase	->->	685751	685923	173	26%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
195	TF0644	pyruvate phosphate dikinase	TF0645	hypothetical protein	->->	688642	688812	171	32.7%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
196	TF0646	conserved hypothetical protein; possible adenylate cyclase	TF0647	hypothetical protein	->->	689856	689983	128	28.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
197	TF0652	conserved hypothetical protein	TF0653	hypothetical protein	->->	696583	696683	101	37.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
198	TF0655	outer membrane protein	TF0656	acetyltransferase, possible GNAT family	->->	701968	702184	217	45.2%	0	0	0	+: 0/3/0 \| -: 0/1/0	1	0	0	0	Result
199	TF0657	conserved hypothetical protein	TF0658	2-amino-3-ketobutyrate coenzyme A ligase	->->	703942	704051	110	42.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
200	TF0658	2-amino-3-ketobutyrate coenzyme A ligase	TF0659	RNA polymerase, ECF-type sigma factor	->->	705240	705567	328	34.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
201	TF0661	hypothetical protein	TF0662	hypothetical protein	->->	708318	708455	138	44.9%	0	0	0	+: 0/1/0 \| -: 0/1/0	3	0	0	0	Result
202	TF0666	conserved hypothetical protein	TF0667	conserved hypothetical protein	->->	711006	711121	116	27.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
203	TF0667	conserved hypothetical protein	TF0668	inorganic pyrophosphatase	->->	712439	712632	194	40.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
204	TF0668	inorganic pyrophosphatase	TF0669	hypothetical protein	->->	713296	713523	228	41.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
206	TF0671	histidine kinase sensor protein	TF0672	RNA polymerase sigma-70 factor, ECF subfamily	->->	716404	716544	141	35.5%	0	0	0	+: 0/1/0 \| -: 1/1/0	1	0	0	0	Result
208	TF0677	ATP-binding protein, Mrp/Nbp35 family, involved in chromosome partitioning	TF0678	hypothetical protein	->->	721043	721242	200	45.5%	0	0	0	+: 0/1/0 \| -: 0/0/0	16	0	0	0	Result
210	TF0684	conserved hypothetical protein	TF0685	hypothetical protein	->->	730625	730991	367	38.7%	0	0	0	+: 0/0/0 \| -: 0/1/0	10	0	0	0	Result
211	TF0685	hypothetical protein	TF0686	hypothetical protein	->->	731193	732338	1146	48.3%	0	0	0	+: 0/1/0 \| -: 0/3/0	45	0	0	0	Result
212	TF0687	hypothetical protein	TF0688	membrane-associated protein, possible sulfatase family	->->	732738	732899	162	32.7%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
213	TF0688	membrane-associated protein, possible sulfatase family	TF0689	hypothetical protein	->->	734421	734558	138	35.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
214	TF0689	hypothetical protein	TF0690	preprotein translocase subunit	->->	735213	735382	170	42.4%	0	0	0	+: 1/0/0 \| -: 0/2/0	1	0	0	0	Result
215	TF0693	sigma-54 dependent transcriptional regulator	TF0694	possible hemolysin, acyltransferase family	->->	738221	738336	116	39.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
216	TF0697	glycerol-3-phosphate cytidyltransferase	TF0699	pyridoxal phosphate biosynthetic protein	->->	741326	741695	370	31.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
217	TF0701	Fe-S-cluster redox enzyme	TF0702	possible peptidyl-prolyl isomerase	->->	744983	745116	134	39.6%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
219	TF0705	hypothetical protein	TF0707	conserved hypothetical protein	->->	750850	751059	210	42.4%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
222	TF0721	aspartate transaminase	TF0722	pyruvate dehydrogenase E3 component(dihydrolipoamide dehydrogenase)	->->	772726	773012	287	33.1%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
223	TF0723	possible aspartate aminotransferase	TF0724	possible transcriptional regulator	->->	775685	775802	118	28%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
224	TF0724	possible transcriptional regulator	TF0725	O-acetylhomoserine (thiol)-lyase	->->	776394	776695	302	43.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
225	TF0737	hypothetical protein	TF0738	conserved hypothetical protein	->->	788637	788782	146	27.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	2	0	0	0	Result
226	TF0739	hypothetical protein	TF0743	conserved hypothetical protein	->->	790329	790466	138	26.8%	0	0	0	+: 1/0/0 \| -: 0/0/0	2	0	0	0	Result
227	TF0745	conserved hypothetical protein	TF0744	DNA polymerase III subunit, gamma/tau	->->	791135	791234	100	50%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
228	TF0748	ATP-dependent protease La	TF0749	protease II	->->	795496	795701	206	43.2%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
229	TF0751	dipeptidyl peptidase IV	TF0752	nucleotide-binding protein; MAF-like protein	->->	800891	801080	190	36.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
230	TF0756	GDP-mannose dehydratase	TF0757	50S ribosomal protein L25; general stress protein	->->	804388	804693	306	37.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
231	TF0759	heat shock protein 15, RNA-binding domain S4	TF0761	conserved hypothetical protein	->->	806427	806551	125	41.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
232	TF0761	conserved hypothetical protein	TF0762	chromate transport protein	->->	809141	809263	123	26.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
233	TF0766	hypothetical protein	TF0767	conserved hypothetical protein	->->	812317	812479	163	41.1%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
234	TF0770	signal peptidase I	TF0771	ABC transporter, ATP-binding/permease component	->->	816668	816787	120	34.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
235	TF0772	conserved hypothetical protein	TF0773	outer membrane efflux protein	->->	821258	821357	100	29%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
236	TF0777	1,4-dihydroxy-2-naphthoate octaprenyltransferase	TF0778	outer membrane protein, TonB dependent receptor	->->	827114	827423	310	34.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
237	TF0779	possible outer membrane protein	TF0780	alpha-L-arabinofuranosidase, precursor A	->->	831935	832083	149	45.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
238	TF0780	alpha-L-arabinofuranosidase, precursor A	TF0781	serine protease inhibitor	->->	834502	834609	108	38.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
239	TF0786	pyridoxal phosphate biosynthetic protein	TF0787	possible inorganic polyphosphate; ATP-NAD kinase	->->	839420	839531	112	28.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
240	TF0787	possible inorganic polyphosphate; ATP-NAD kinase	TF0788	protein-export membrane protein	->->	840405	840701	297	30.3%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
241	TF0789	preprotein translocase, secDF family	TF0790	conserved hypothetical protein	->->	843731	844059	329	43.8%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
244	TF0793	conserved hypothetical protein; possible AAA superfamily ATPase	TF0794	hypothetical protein	->->	851352	851519	168	36.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
245	TF0795	hypothetical protein	TF0797	conserved hypothetical protein	->->	853260	853435	176	43.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	3	0	0	0	Result
246	TF0800	conserved hypothetical protein	TF0801	transport permease	->->	858566	858725	160	34.4%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
247	TF0810	possible outer membrane efflux protein	TF0811	conserved hypothetical protein; posible sugar phosphate isomerase	->->	869757	869926	170	47.1%	0	0	0	+: 0/2/0 \| -: 0/2/0	1	0	0	0	Result
248	TF0815	conserved hypothetical protein	TF0816	hypothetical protein	->->	874035	874356	322	53.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	1	139	272	Result	gaggaaagtccgggcaacacagggcgccatccttcctaacgggaagctgtctgcgagggcagagtaacgtagcagaaaagaaccgccgcgccgtaaggcgaggtaagggtgaaaaggtgaggtaagagcttacc
249	TF0817	ribonuclease, BN-like family	TF0818	bifunctional protein: aspartokinase I; homoserine dehydrogenase	->->	875902	876141	240	36.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
250	TF0821	hypothetical protein	TF0822	hypothetical protein	->->	880256	880626	371	51.5%	0	0	0	+: 0/0/0 \| -: 0/1/0	18	0	0	0	Result
251	TF0827	conserved hypothetical protein	TF0828	hypothetical protein	->->	886980	887229	250	42.4%	0	0	0	+: 0/0/0 \| -: 0/1/0	10	0	0	0	Result
252	TF0828	hypothetical protein	TF0830	hypothetical protein	->->	887569	887749	181	49.2%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
253	TF0839	aminopeptidasem M28 family	TF0840	hypothetical protein	->->	891590	891700	111	28.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
256	TF0847	hypothetical protein	TF0849	hypothetical protein	->->	898073	898230	158	29.1%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
257	TF0850	hypothetical protein	TF0851	helicase SNF2 family	->->	899001	899625	625	38.2%	0	0	8	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
258	TF0851	helicase SNF2 family	TF0852	transcriptional regulator, TetR family	->->	903229	903385	157	35%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
259	TF0862	conserved hypothetical protein fragment	TF0864	O-succinylbenzoate--CoA ligase	->->	914520	914709	190	52.6%	0	0	0	+: 0/4/0 \| -: 0/0/0	2	3	9	186	Result	ttttgccgaggacgacgtattgttccggttaggacgaccctccgtctgttttaggtcgtcctaatcgttctgttaggtcgacctaaatgctccgcaaggtcgaccttaccggccgtttaggtcgaccttactttttgtcggggtcggcgtgtgtggtttattgtctcgtagtgtgcag
260	TF0869	conserved hypothetical protein; possible transcriptional regulator	TF0870	conserved hypothetical protein	->->	922075	922265	191	23.6%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	1	1	188	Result	gtgcctatttatatcggcaaatatactccaaataaatgaaaatattttttgcgataggatttattaaaagataaattccgatttgtcaatccgataatctttatttcgatatatatagttatcttattttgtttatgataaccccaataaataaagatatgcttttaaccgttttatttctatttcat
265	TF0880	conserved hypothetical protein	TF0881	conserved hypothetical protein	->->	934432	934598	167	46.1%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
266	TF0882	hypothetical protein	TF0883	hypothetical protein	->->	936602	937274	673	35.8%	0	0	0	+: 0/0/0 \| -: 2/0/0	1	0	0	0	Result
267	TF0883	hypothetical protein	TF0884	hypothetical protein	->->	937533	937742	210	51.4%	0	0	0	+: 0/5/0 \| -: 0/0/0	2	3	1	210	Result	taaagagaaacgagagaaacgcaatcggcatttctctcgttttgcaaagacgacgtgccgctccggttaggacgaccttccgtccgttttaggtcgacctaaccgctctgtaaggacgacctatttgctccgtaaggtcgacctaaacgctcggttaggtcgacctgactttctgtcagggtcgacgtatgcggtttattccctcgtagt
269	TF0891	hypothetical protein	TF0892	conserved hypothetical protein	->->	940856	940975	120	30%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	1	3	107	Result	atagttttgagtgcattctttatctttgagtataatctccgaaatgcaatcatttgaaaattagcaacttgtattttctcgaaatttttgatgcggttgccctgt
270	TF0892	conserved hypothetical protein	TF0893	conserved hypothetical protein	->->	941420	941893	474	36.7%	0	0	0	+: 1/1/1 \| -: 1/1/1	1	0	0	0	Result
272	TF0894	conserved hypothetical protein	TF0895	hypothetical protein	->->	943836	944594	759	32.9%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
273	TF0896	hypothetical protein	TF0897	hypothetical protein	->->	945274	945498	225	38.2%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
274	TF0898	hypothetical protein	TF0899	hypothetical protein	->->	945791	945919	129	31%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
275	TF0899	hypothetical protein	TF0901	conserved hypothetical protein	->->	946220	946820	601	31.8%	0	0	0	+: 0/0/0 \| -: 0/1/0	7	0	0	0	Result
276	TF0904	conserved hypothetical protein	TF0906	conserved hypothetical protein	->->	949217	949814	598	44.1%	0	0	0	+: 0/4/0 \| -: 0/1/0	2	1	1	511	Result	acctttttcttattatttgagtttacaaaactatacaagtggaatatcgtttgcaatcgccaatagtggctattttcacagtccggaatccctatttcttagggtttgtcgattcgtcaatcagtaactcatatcctcaaaattcaacctttaataatctgtttggcattggctctctgccggattgcgacccatcgcatgaagggattttgatgtgtcgggacgacctgtcatctgcattaggacgacctgttatttgttttaggtcgacctaatcgttcagttaggtcgacctaaacagtctgtaaggacgacgtaaacggtctgcaaggtcgacctaaacggcctgtaaggtcgacctaacattcatgtaaggacgacctgactttctgccggggtctttttgcacatcgtcagccttcaatacggactgtgatacattgcattatcggcagtccgggatcgaagacaacaagtggaagatttggagacggaaaagatgctcccgaaa
277	TF0908	integrase fragment	TF0909	Tn5520-like integrase (transfer factor)	->->	951085	951356	272	39.7%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
279	TF0914	conserved hypothetical protein; possible ketosteroid isomerase-related protein	TF0915	possible transcriptional regulator	->->	955874	956006	133	27.8%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	3	6	129	Result	tgtatttttaattgttagaaccactgcaaagttatacctttgcactacaatctgcaagtacctacaatattgtaggatacataccgtattattagatttattgattatcaagaataaaaaagtt
280	TF0919	conserved hypothetical protein	TF0920	conserved hypothetical protein	->->	957834	958287	454	37.2%	0	0	3	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
281	TF0922	MATE efflux family protein	TF0923	tetracycline resistance element mobilization regulatory protein	->->	961147	961395	249	34.9%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	3	7	187	Result	tgaacttaaaagatatgattatgctaagacttactcaaacagaaaactttaagataatgctctctttttgttctacaaaagaacagatacaaaaggcgtcagacaactttatattgaaggttgttgctctatgtgatacagaagaagatactgtctcgttgtttcgtatcctccgctatac
282	TF0923	tetracycline resistance element mobilization regulatory protein	TF0925	hypothetical protein	->->	961765	961875	111	47.7%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
283	TF0925	hypothetical protein	TF0926	conserved hypothetical protein; possible TraB protein	->->	962188	962574	387	40.3%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
284	TF0926	conserved hypothetical protein; possible TraB protein	TF0927	conserved hypothetical protein; possible ATPase of the AAA superfamily	->->	962998	963595	598	38.3%	0	0	1	+: 0/1/0 \| -: 0/1/0	1	1	1	276	Result	taaatccctatcttcagatgttttaaatggaactgtttttctccttgtcgtattgccctacaacaccgaagggttagcttactgagatgcggcaaacatcccacgagcagaatgttaccgaagatagagtcgggagacaggaatttgtctctttctgccgatacaaggcaaagtcctgcgaggactagtcgaacgacgaaatgtggagtgtgccctgttttatgtaaatacacctcttgcgacatttttatgctccgcaaggggcatgttcttgcc
286	TF0934	hypothetical protein	TF0936	subtilisin-like serine protease	->->	975268	976007	740	37.7%	0	0	0	+: 0/2/0 \| -: 0/2/0	1	3	153	587	Result	agggcttaggacaaacaaggttttacggcgagaatactacctgcaatgaaatggaagtgtggagattgtcgtcgtaacggcttgccgctccgaccttttttgtccgtgaaagcccaaaactacctttgtcactgacaacgaacaaccgagcccgacatgatatacgggcataagtggaggatgtgcagggagagaagcaggacaaaacaaaaaacacagtctttaaggactcattttatcataagaatagaatacacaaaaacaaaaagctgccccaatgacggcttaaggaaaaaatcaagagagaaaattcttttttctcacgatatacctttatctttgcaacaggttattcgagttatgtaaagcgttgtatatcattacggaagataggtcgcccaatcattacctatagcattttataactcattaggc
292	TF0947	extracellular protease	TF0948	50S ribosomal protein L34	->->	993611	993825	215	31.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
293	TF0955	conserved hypothetical protein	TF0957	hypothetical protein	->->	1002784	1002892	109	28.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
294	TF0957	hypothetical protein	TF0958	conserved hypothetical protein	->->	1003940	1004057	118	27.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
295	TF0958	conserved hypothetical protein	TF0959	periplasmic protease	->->	1004970	1005357	388	46.6%	0	0	0	+: 0/2/0 \| -: 0/0/0	4	0	0	0	Result
296	TF0959	periplasmic protease	TF0960	beta-galactosidase	->->	1008601	1008757	157	45.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
297	TF0964	conserved hypothetical protein	TF0965	glycogen synthase	->->	1013437	1013543	107	34.6%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
298	TF0966	hypothetical protein	TF0967	alpha glycan phosphorylase	->->	1015998	1016370	373	27.3%	0	0	0	+: 0/2/0 \| -: 0/2/0	1	0	0	0	Result
299	TF0967	alpha glycan phosphorylase	TF0968	hypothetical protein	->->	1018933	1019047	115	39.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
300	TF0972	conserved hypothetical protein	TF0973	conserved hypothetical protein	->->	1023271	1023402	132	28%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
305	TF0983	nitroreductase family protein, possible NADH dehydrogenase/NAD(P)H nitroreductase	TF0984	possible mucin-desulfating sulfatase (MdsC protein)	->->	1040095	1040398	304	43.8%	0	0	0	+: 0/1/0 \| -: 0/2/0	4	0	0	0	Result
306	TF0986	50S ribosomal protein L31	TF0985	fructose-bisphosphate aldolase	->->	1041818	1042040	223	29.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
307	TF0985	fructose-bisphosphate aldolase	TF0987	DNA repair protein	->->	1043034	1043229	196	40.8%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
308	TF0989	conserved hypothetical protein	TF0990	hypothetical protein	->->	1045288	1045534	247	45.7%	0	0	2	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
309	TF0993	hypothetical protein	TF0994	maltose O-acetyltransferase	->->	1048843	1049266	424	41.3%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
310	TF0998	[acyl-carrier-protein] S-malonyltransferase	TF0999	hypothetical protein	->->	1053038	1053167	130	24.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
311	TF1011	cell division protein; rod shape-determining protein	TF1012	lysyl-tRNA synthetase (lysine--tRNA ligase)	->->	1068230	1068382	153	39.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
312	TF1014	glucose-6-phosphate isomerase	TF1015	conserved hypothetical protein	->->	1072535	1072651	117	53%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
313	TF1015	conserved hypothetical protein	TF1016	30S ribosomal protein S6	->->	1074176	1074290	115	35.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
314	TF1018	50S ribosomal protein L9	TF1019	N-acetylmuramoyl-L-alanine amidase	->->	1075399	1075506	108	29.6%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
315	TF1020	conserved hypothetical protein; possible ABC transporter permease	TF1021	hypothetical protein	->->	1077553	1077652	100	29%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
316	TF1023	ABC transporter, permease component	TF1024	50S ribosomal protein L19	->->	1081728	1082087	360	34.7%	0	0	0	+: 0/5/0 \| -: 0/3/0	1	0	0	0	Result
317	TF1027	hypothetical protein	TF1028	1-acyl-sn-glycerol-3-phosphate acyltransferase	->->	1085958	1086076	119	21%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
318	TF1030	3-oxoacyl-[acyl-carrier-protein] synthase	TF1031	conserved hypothetical protein	->->	1089593	1089699	107	31.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
319	TF1033	endothelin converting enzyme, endopeptidase	TF1034	conserved hypothetical protein	->->	1094943	1095202	260	40.4%	0	0	14	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
320	TF1044	Mg(2)+ transport-related protein, MgtC family	TF1045	conserved hypothetical protein	->->	1107400	1107804	405	37.8%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
321	TF1046	hypothetical protein	TF1047	tRNA pseudouridylate synthetase A (pseudouridylate synthase I)	->->	1108507	1108622	116	44.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
324	TF1057	possible outer membrane receptor, TonB-linked	TF1058	N-acetylglucosamine kinase	->->	1125664	1126002	339	24.2%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
325	TF1058	N-acetylglucosamine kinase	TF1059	possible xanthan lyase	->->	1126909	1127320	412	34.5%	0	0	0	+: 0/0/0 \| -: 0/3/0	1	0	0	0	Result
326	TF1071	hypothetical protein	TF1072	conserved hypothetical protein	->->	1141748	1142530	783	36.7%	0	0	0	+: 0/1/0 \| -: 0/1/0	6	0	0	0	Result
327	TF1075	conserved hypothetical protein; possible lantibiotic biosynthesis protein	TF1076	possible glycerol kinase	->->	1145462	1145564	103	29.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
328	TF1076	possible glycerol kinase	TF1077	conserved hypothetical protein	->->	1145742	1146521	780	36.4%	0	0	0	+: 0/2/0 \| -: 1/1/1	5	0	0	0	Result
333	TF1090	hypothetical protein	TF1091	conserved hypothetical protein	->->	1159421	1159568	148	32.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
334	TF1092	glycosyltransferase	TF1093	hypothetical protein	->->	1161506	1162691	1186	34%	0	250	0	+: 0/1/0 \| -: 1/0/0	5	0	0	0	Result
335	TF1093	hypothetical protein	TF1094	conserved hypothetical protein	->->	1162980	1163215	236	19.9%	0	0	0	+: 0/2/0 \| -: 0/2/0	1	0	0	0	Result
336	TF1096	conserved hypothetical protein	TF1097	hypothetical protein	->->	1165418	1165707	290	36.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	6	0	0	0	Result
337	TF1097	hypothetical protein	TF1098	conserved hypothetical protein	->->	1165954	1166059	106	26.4%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
339	TF1104	hypothetical protein	TF1105	arylsulfatase regulator; Fe-S oxidoreductase	->->	1172255	1172855	601	38.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	6	0	0	0	Result
340	TF1106	conserved hypothetical protein	TF1107	ABC transporter ATP-binding/permease component, bacteriocin/lantibiotic exporter	->->	1175887	1176431	545	27.9%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
341	TF1107	ABC transporter ATP-binding/permease component, bacteriocin/lantibiotic exporter	TF1108	conserved hypothetical protein; possible lipoprotein	->->	1177686	1177954	269	33.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
342	TF1109	lipoprotein	TF1110	conserved hypothetical protein	->->	1180058	1180243	186	39.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
345	TF1116	conserved hypothetical protein	TF1117	conserved hypothetical protein	->->	1187003	1187243	241	28.6%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
346	TF1117	conserved hypothetical protein	TF1118	conserved hypothetical protein	->->	1189512	1191445	1934	35.2%	0	250	0	+: 0/1/0 \| -: 0/1/0	6	0	0	0	Result
347	TF1127	conserved hypothetical protein; possible NADPH:quinone reductase	TF1128	possible lantibiotic biosynthesis protein (modification)	->->	1202218	1202436	219	30.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
348	TF1136	glycosyltransferase	TF1137	asparaginyl-tRNA synthetase (asparagine--tRNA ligase)	->->	1212458	1212582	125	36%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
349	TF1139	adenylosuccinate lyase	TF1140	transcriptional regulator, AraC family	->->	1216728	1216994	267	39%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
350	TF1140	transcriptional regulator, AraC family	TF1141	conserved hypothetical protein	->->	1217973	1218111	139	30.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
351	TF1142	outer membrane cobalamin receptor protein	TF1143	ABC transporter, ATP-binding/permease component	->->	1221720	1221843	124	36.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
354	TF1149	conserved hypothetical protein; possible branched-chain amino acid aminotransferase	TF1150	pyruvate-formate lyase	->->	1229988	1230303	316	25.9%	0	0	0	+: 1/1/1 \| -: 0/0/0	1	0	0	0	Result
355	TF1152	permease, major facilitator superfamily	TF1153	pyruvate-formate lyase-activating enzyme	->->	1234679	1234782	104	34.6%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
356	TF1153	pyruvate-formate lyase-activating enzyme	TF1154	RNA pseudouridylate synthetase	->->	1235734	1235919	186	34.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
358	TF1162	Na+/H+ antiporter	TF1163	two-component system response regulator	->->	1242904	1243084	181	32.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
359	TF1164	two-component system sensor histidine kinase	TF1165	conserved hypothetical protein	->->	1244839	1245012	174	37.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
360	TF1165	conserved hypothetical protein	TF1166	ABC transporter, permease component	->->	1245982	1246293	312	45.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
362	TF1169	lipoprotein ABC transporter, permease component	TF1171	ABC transporter, ATP-binding protein	->->	1251634	1251989	356	48.3%	0	0	0	+: 0/3/0 \| -: 0/0/0	6	0	0	0	Result
363	TF1172	ABC transporter, permease component	TF1173	ABC transporter, permease component	->->	1255274	1255583	310	38.1%	0	0	0	+: 0/3/0 \| -: 0/0/0	2	0	0	0	Result
364	TF1174	ABC transporter, permease component	TF1175	membrane-fusion protein	->->	1257957	1258279	323	36.5%	0	0	0	+: 0/1/0 \| -: 0/0/0	2	0	0	0	Result
365	TF1175	membrane-fusion protein	TF1176	outer membrane protein	->->	1259531	1259694	164	34.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
366	TF1176	outer membrane protein	TF1177	conserved hypothetical protein; possible ribosomal protein S1	->->	1261039	1261314	276	28.6%	0	0	0	+: 0/1/0 \| -: 1/3/3	1	0	0	0	Result
367	TF1179	two-component sensor histidine kinase	TF1181	methylated-DNA--[protein]-cysteine S-methyltransferase	->->	1267508	1267661	154	42.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
368	TF1181	methylated-DNA--[protein]-cysteine S-methyltransferase	TF1183	hypothetical protein	->->	1268052	1268530	479	43%	0	0	0	+: 0/0/0 \| -: 0/1/0	13	0	0	0	Result
369	TF1182	hypothetical protein	TF1184	hypothetical protein	->->	1268999	1269143	145	47.6%	0	0	0	+: 0/0/0 \| -: 0/2/0	11	0	0	0	Result
370	TF1187	hypothetical protein	TF1188	conserved hypothetical protein	->->	1269933	1270295	363	35%	0	0	0	+: 0/1/0 \| -: 0/0/0	15	0	0	0	Result
371	TF1191	possible transcriptional regulator	TF1192	alpha-amylase	->->	1274040	1274146	107	38.3%	0	0	0	+: 0/0/0 \| -: 0/3/0	1	0	0	0	Result
372	TF1195	hypothetical protein	TF1196	acetyl-coenzyme A synthetase	->->	1278906	1279203	298	39.9%	0	0	0	+: 0/0/0 \| -: 0/5/0	1	0	0	0	Result
373	TF1197	transcriptional regulator	TF1198	conserved hypothetical protein	->->	1281475	1281603	129	50.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
374	TF1202	antitermination factor, NusB family	TF1203	L-asparaginase I	->->	1285216	1285371	156	36.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
375	TF1204	possible metal-dependent membrane protease	TF1205	beta-glucanase/beta-glucan synthetase; endoglucanase related	->->	1287522	1287695	174	37.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
376	TF1207	outer membrane receptor, TonB-dependent	TF1208	anti-sigma factor	->->	1293613	1293735	123	24.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
377	TF1209	RNA polymerase ECF-type sigma factor	TF1210	conserved hypothetical protein	->->	1295441	1295834	394	34.5%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
378	TF1210	conserved hypothetical protein	TF1211	phosphoserine aminotransferase	->->	1298712	1298839	128	31.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
379	TF1215	haloacid dehalogenase-like hydrolase	TF1216	possible ECF-family RNA polymerase sigma factor	->->	1303277	1303416	140	37.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
380	TF1218	hypothetical protein	TF1219	conserved hypothetical protein	->->	1304444	1304543	100	42%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
381	TF1219	conserved hypothetical protein	TF1220	conserved hypothetical protein	->->	1305867	1306297	431	28.1%	0	0	0	+: 2/1/2 \| -: 1/2/0	1	0	0	0	Result
382	TF1225	conserved hypothetical protein	TF1227	hypothetical protein	->->	1313752	1313886	135	28.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
383	TF1228	conserved hypothetical protein	TF1229	hypothetical protein	->->	1314609	1314758	150	41.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
384	TF1229	hypothetical protein	TF1230	hypothetical protein	->->	1314915	1315044	130	33.1%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
386	TF1239	RNA polymerase ECF-type sigma factor	TF1240	conserved hypothetical protein	->->	1324281	1324443	163	45.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
387	TF1242	3-methyl-2-oxobutanoate hydroxymethyltransferase	TF1243	periplasmic protease	->->	1327175	1327382	208	43.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
388	TF1247	alanyl-tRNA synthetase (alanine--tRNA ligase)	TF1249	phosphoglycerate kinase (cytosolic phosphoglycerate kinase)	->->	1330989	1331156	168	44.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
389	TF1253	hypothetical protein	TF1254	conserved hypothetical protein; possible transcriptional regulator	->->	1336272	1336387	116	26.7%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
390	TF1259	hypothetical protein	TF1260	chaperone protein DnaJ	->->	1345265	1345464	200	46%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
391	TF1261	GrpE-related chaperonin; HSP-70 cofactor	TF1262	PDZ domain protein	->->	1347253	1347472	220	34.5%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
394	TF1273	hypothetical protein	TF1274	hypothetical protein	->->	1357523	1357760	238	47.5%	0	0	0	+: 0/1/0 \| -: 0/2/0	9	0	0	0	Result
395	TF1280	electron transfer flavoprotein, beta subunit	TF1281	2-dehydro-3-deoxyphosphooctonate aldolase (3-deoxy-D-manno-2-octulosonate-8-phosphate synthase) (KDO-8-phosphate synthetase) (KDO 8-P synthase)	->->	1365318	1365743	426	34.7%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
396	TF1283	hypothetical protein	TF1284	glyceraldehyde 3-phosphate dehydrogenase	->->	1367808	1368078	271	38%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
397	TF1288	hypothetical protein	TF1289	ribosomal protein L11 methyltransferase	->->	1370338	1370441	104	24%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
398	TF1289	ribosomal protein L11 methyltransferase	TF1290	hypothetical protein	->->	1371294	1371527	234	31.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
399	TF1290	hypothetical protein	TF1291	response regulator (fimR protein)	->->	1371882	1372098	217	39.2%	0	0	0	+: 0/0/0 \| -: 0/1/0	2	0	0	0	Result
400	TF1292	sensor histidine protein kinase	TF1293	ATPase, possible AAA superfamily	->->	1374615	1374718	104	41.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
401	TF1294	conserved hypothetical protein	TF1296	possible DNA-binding protein, histone-like family	->->	1378392	1378571	180	41.1%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
402	TF1296	possible DNA-binding protein, histone-like family	TF1297	hypothetical protein	->->	1379043	1379163	121	48.8%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
403	TF1297	hypothetical protein	TF1298	possible membrane protein	->->	1379584	1380246	663	41%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
404	TF1302	conserved hypothetical protein; possible tetracycline resistance element	TF1303	conserved hypothetical protein	->->	1383897	1384008	112	37.5%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
405	TF1303	conserved hypothetical protein	TF1304	conserved hypothetical protein	->->	1384759	1385147	389	43.7%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	1	113	237	Result	gcccacaagcaggtgaaaggagcggtgaagactcctatgatgacaaagaggaggagtttgaagatatagtaaaatacccactgccagtttgttcctgcaatcattttatagggaatgaacttttc
408	TF1312	hypothetical protein	TF1313	conserved hypothetical protein	->->	1388842	1389019	178	39.3%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
410	TF1316	conserved hypothetical protein; possible TPR-repeat-containing protein	TF1318	outer membrane receptor	->->	1393557	1393823	267	24%	0	0	0	+: 1/1/1 \| -: 0/0/0	1	0	0	0	Result
411	TF1322	conserved hypothetical protein; possible surface protein	TF1323	metallo-beta-lactamase superfamily protein	->->	1402628	1402789	162	47.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
412	TF1327	L-fucose permease	TF1328	possible cytidylyltransferase	->->	1407256	1407573	318	36.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
413	TF1331	outer membrane protein	TF1332	cytochrome c-type synthesis protein (cytochrome c biogenesis protein); ABC transporter, permease	->->	1410995	1411096	102	36.3%	0	0	0	+: 0/2/0 \| -: 0/2/0	1	0	0	0	Result
414	TF1340	pantoate--beta-alanine ligase	TF1341	glycogen synthase	->->	1422257	1422390	134	32.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
415	TF1343	hypothetical protein	TF1344	conserved hypothetical protein	->->	1424920	1425390	471	38.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
416	TF1350	possible transcriptional regulator	TF1351	conserved hypothetical protein	->->	1430697	1430907	211	38.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
417	TF1352	polysaccharide deacetylase-like protein	TF1353	conserved hypothetical protein; possible penicillinase repressor	->->	1432923	1433047	125	31.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
418	TF1354	TonB protein	TF1355	serine O-acetyltransferase	->->	1435277	1435720	444	36.3%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
419	TF1358	hypothetical protein	TF1359	hypothetical protein	->->	1438940	1439116	177	31.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
420	TF1360	conserved hypothetical protein	TF1361	conserved hypothetical protein	->->	1441303	1441587	285	29.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
421	TF1361	conserved hypothetical protein	TF1362	hypothetical protein	->->	1443556	1443798	243	23.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
422	TF1362	hypothetical protein	TF1363	conserved hypothetical protein	->->	1444120	1444222	103	37.9%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
423	TF1369	hypothetical protein	TF1370	conserved hypothetical protein	->->	1447647	1447991	345	30.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	7	0	0	0	Result
427	TF1382	hypothetical protein	TF1384	hypothetical protein	->->	1457838	1458149	312	48.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
428	TF1385	conserved hypothetical protein	TF1386	hypothetical protein	->->	1459545	1460242	698	31.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
429	TF1387	conserved hypothetical protein	TF1388	hypothetical protein	->->	1461650	1461924	275	28.7%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
431	TF1391	hypothetical protein	TF1392	conserved hypothetical protein	->->	1464303	1464831	529	33.6%	0	0	0	+: 0/1/0 \| -: 2/2/4	1	0	0	0	Result
432	TF1396	conserved hypothetical protein	TF1397	glucosyltransferase	->->	1470461	1470604	144	38.2%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
433	TF1401	Holliday junction DNA helicase	TF1403	hypothetical protein	->->	1477671	1477914	244	38.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
434	TF1412	conserved hypothetical protein	TF1413	possible transmembrane protein	->->	1493317	1493496	180	39.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
435	TF1416	outer membrane protein	TF1417	conserved hypothetical protein	->->	1499474	1499683	210	40.5%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
438	TF1436	phosphoglycolate phosphatase	TF1437	hypothetical protein	->->	1521928	1522079	152	40.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
440	TF1442	hypothetical protein	TF1443	hypothetical protein	->->	1526669	1526898	230	28.7%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
441	TF1444	conserved hypothetical protein; possible hemin receptor	TF1445	RNA polymerase sigma factor	->->	1529971	1530187	217	35%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
442	TF1448	possible competence protein	TF1449	RNA polymerase sigma factor, RpoD	->->	1533111	1533263	153	38.6%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
443	TF1449	RNA polymerase sigma factor, RpoD	TF1450	periplasmic serine protease	->->	1534122	1534241	120	35%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
444	TF1450	periplasmic serine protease	TF1451	conserved hypothetical protein	->->	1535748	1536015	268	35.8%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
445	TF1452	conserved hypothetical protein; possible transglutaminase-like enzyme	TF1454	sugar phosphate epimerase/isomerase	->->	1539718	1539835	118	39.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
446	TF1455	conserved hypothetical protein	TF1456	GMP synthase	->->	1541722	1541829	108	38.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
447	TF1457	conserved hypothetical protein; possible transporter	TF1458	conserved hypothetical protein	->->	1544311	1544574	264	29.2%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
448	TF1458	conserved hypothetical protein	TF1459	possible protease	->->	1548442	1548573	132	38.6%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
449	TF1460	6-phosphogluconate dehydrogenase	TF1461	DNA-damage-inducible protein F	->->	1550851	1550984	134	35.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
450	TF1464	conserved hypothetical protein	TF1465	modulator of DNA gyrase	->->	1554177	1554287	111	41.4%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
451	TF1468	beta-galactosidase	TF1469	2-methylthioadenine synthetase	->->	1561312	1561432	121	50.4%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
452	TF1469	2-methylthioadenine synthetase	TF1470	phosphohydrolase, Icc family	->->	1562786	1563283	498	31.3%	0	0	0	+: 1/3/0 \| -: 0/1/0	1	0	0	0	Result
453	TF1473	hypothetical protein	TF1474	6-phosphogluconolactonase	->->	1567027	1567481	455	44.6%	0	0	0	+: 0/0/0 \| -: 0/1/0	21	0	0	0	Result
454	TF1475	glucose-6-phosphate 1-dehydrogenase	TF1476	outer membrane protein P49	->->	1569749	1569862	114	50%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
455	TF1481	ABC transporter, ATP-binding protein	TF1482	alpha-amylase	->->	1575592	1576000	409	39.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
456	TF1482	alpha-amylase	TF1483	glycosyltransferase family protein	->->	1577933	1578099	167	28.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
457	TF1483	glycosyltransferase family protein	TF1484	penicillin binding protein	->->	1578886	1579698	813	47%	0	0	0	+: 1/0/0 \| -: 0/2/0	32	0	0	0	Result
458	TF1485	conserved hypothetical protein	TF1486	hypothetical protein	->->	1587603	1587755	153	22.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
459	TF1490	hypothetical protein	TF1491	mannosyltransferase	->->	1590843	1590992	150	41.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
460	TF1496	tyrosyl-tRNA synthetase	TF1497	GTP-binding protein, Era/ThdF family	->->	1596130	1596268	139	36.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
462	TF1500	conserved hypothetical protein	TF1501	sugar hydrolase	->->	1600415	1600567	153	26.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
463	TF1504	conserved hypothetical protein	TF1505	conserved hypothetical protein	->->	1610726	1610912	187	43.9%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
464	TF1507	outer membrane receptor, TonB-dependent	TF1508	anti-sigma factor	->->	1616329	1616484	156	41%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
465	TF1508	anti-sigma factor	TF1509	possible acylaminoacyl-peptidase	->->	1617514	1617677	164	34.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
466	TF1512	hypothetical protein	TF1513	hypothetical protein	->->	1624802	1625033	232	28.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
468	TF1517	hypothetical protein	TF1518	peroxiredoxin	->->	1627008	1627175	168	29.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
469	TF1519	hypothetical protein	TF1520	transaldolase	->->	1628083	1628289	207	39.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
471	TF1525	conserved hypothetical protein	TF1527	hypothetical protein	->->	1632593	1632738	146	23.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
472	TF1527	hypothetical protein	TF1528	malate dehydrogenase	->->	1633117	1633426	310	44.2%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
473	TF1529	hypothetical protein	TF1530	1-deoxyxylulose-5-phosphate synthase	->->	1634617	1634748	132	30.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
474	TF1532	potassium uptake system protein	TF1534	conserved hypothetical protein	->->	1639476	1639624	149	44.3%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
475	TF1535	possible outer membrane receptor protein	TF1537	hypothetical protein	->->	1642270	1643045	776	38.3%	0	0	0	+: 1/0/0 \| -: 0/4/0	5	0	0	0	Result
476	TF1536	hypothetical protein	TF1538	conserved hypothetical protein	->->	1643544	1643670	127	41.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
477	TF1539	conserved hypothetical protein	TF1540	possible ATPase	->->	1644402	1644676	275	27.6%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
480	TF1543	conserved hypothetical protein	TF1544	possible transcriptional regulator	->->	1650835	1651049	215	37.7%	0	0	0	+: 0/3/0 \| -: 0/2/0	1	1	3	203	Result	aatacccccgaaaaggggtataattgattcctattccttatatttgccactgataaggtatataatgactttggcggagtgagtcgtgcatagtgatataccttgaatatgtacccaaaagagacaaaatgggtacatatccttgagacgtgtacccgaaaacggcattttgggtacatattcggaatgtggtacttcaag
481	TF1547	conserved hypothetical protein	TF1548	thiophene and furan oxidation protein	->->	1652532	1652640	109	35.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
482	TF1552	conserved hypothetical protein	TF1553	copper homeostasis protein	->->	1658887	1659012	126	38.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
484	TF1565	polysaccharide export protein, BexD/CtrA/VexA family	TF1566	H+-transporting ATP synthase, subunit K	->->	1673807	1674098	292	29.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
485	TF1573	ATP synthase, subunit E	TF1574	two-component system response regulator	->->	1681683	1681946	264	33%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
486	TF1574	two-component system response regulator	TF1575	DNA-binding response regulator	->->	1685106	1685316	211	32.7%	0	0	0	+: 1/0/0 \| -: 2/2/2	1	0	0	0	Result
487	TF1578	hypothetical protein	TF1579	hypothetical protein	->->	1686477	1687028	552	48.6%	0	0	0	+: 0/0/0 \| -: 0/1/0	35	0	0	0	Result
488	TF1585	hypothetical protein	TF1586	hypothetical protein	->->	1690671	1691110	440	52.3%	0	0	0	+: 0/3/0 \| -: 0/0/0	19	0	0	0	Result
489	TF1587	conserved hypothetical protein	TF1588	hypothetical protein	->->	1702083	1702407	325	41.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
490	TF1588	hypothetical protein	TF1589	surface antigen BspA	->->	1702621	1703328	708	49.7%	0	0	0	+: 0/1/0 \| -: 0/1/0	23	0	0	0	Result
492	TF1590	hypothetical protein	TF1591	surface antigen BspA	->->	1706104	1706526	423	48.7%	0	0	0	+: 0/0/0 \| -: 0/1/0	6	0	0	0	Result
493	TF1591	surface antigen BspA	TF1592	hypothetical protein	->->	1708327	1708464	138	32.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	2	0	0	0	Result
494	TF1592	hypothetical protein	TF1593	hypothetical protein	->->	1708618	1708998	381	48.8%	0	0	0	+: 0/0/0 \| -: 1/1/0	4	0	0	0	Result
495	TF1593	hypothetical protein	TF1594	hypothetical protein	->->	1709638	1710042	405	32.1%	0	0	0	+: 1/1/1 \| -: 0/1/0	1	0	0	0	Result
496	TF1601	conserved hypothetical protein	TF1602	L-aspartate oxidase	->->	1715600	1715718	119	37.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
497	TF1604	possible anti-sigma factor	TF1605	outer membrane protein, TonB dependent receptor	->->	1718977	1719099	123	33.3%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
498	TF1607	conserved hypothetical protein	TF1608	sulfate transporter	->->	1725899	1726756	858	35.1%	0	250	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
500	TF1616	conserved hypothetical protein; possible transcriptional regulator	TF1617	conserved hypothetical protein; possible methyltransferase	->->	1732925	1733289	365	31.8%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
501	TF1620	TPR domain protein	TF1621	DNA replication and repair protein RecF	->->	1735284	1735432	149	26.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
502	TF1629	hypothetical protein	TF1630	mobilization protein	->->	1741976	1742161	186	31.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	1	5	117	Result	gatttggaaacgagcgaagtgctttctgtcgcatgtttctacatcaacaaagaacgcttgttattctatattgcaaagataatcatttgctttgaataacaagcgtttttgat
503	TF1631	hypothetical protein	TF1632	conserved hypothetical protein	->->	1743594	1743999	406	39.2%	0	0	0	+: 1/0/0 \| -: 0/3/0	1	2	66	332	Result	ataagcttctttgaaagttaatcattatagatgattcattgtctcttaattcttgaatactgaccgatgagaacggagtgattacggtcttatctccccgacaatctaacgaggggagctgggcgcagtttgtgggtacaaactgacgtcttgcaatgctaccgaacaaattatatacgcttaaaacgttttatagcctaaaaacgaatgccgtgcattctatgactaactgcgttcgtggcattctcacagagaactaagctgaag
504	TF1633	mobilizable transposon, excision protein	TF1635	conserved hypothetical protein; possible helicase	->->	1745409	1745592	184	27.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	1	1	184	Result	tgttttgatactttaatgggttgaatgataattatttatgtttgtctgtttttatggttttaccttttccaaagttttcccctccaaactttttcatctttcttcttactacatactattttgtgataagtgattgataatcagtattactttgtagtataagacaatactacacattctacta
505	TF1634	hypothetical protein	TF1637	hypothetical protein	->->	1747139	1747245	107	42.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	1	1	107	Result	tgattggagcatattttatctcggattactgtgccaacctattccactacgacgccacaagctgccacttgaatggaaagtgatggaataagaaatgcccgatatta
506	TF1640	DNA mismatch endonuclease vsr	TF1641	hypothetical protein	->->	1748653	1748964	312	30.8%	0	0	0	+: 0/0/0 \| -: 2/0/0	1	0	0	0	Result
507	TF1641	hypothetical protein	TF1642	conserved hypothetical protein	->->	1749247	1749407	161	31.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
508	TF1647	cytosine-specific methyltransferase	TF1648	hypothetical protein	->->	1758812	1759477	666	33.8%	0	0	0	+: 0/4/0 \| -: 0/3/0	1	0	0	0	Result
509	TF1648	hypothetical protein	TF1649	hypothetical protein	->->	1759667	1759777	111	36%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
513	TF1654	hypothetical protein	TF1655	long-chain-fatty-acid-CoA ligase	->->	1768766	1769418	653	36.3%	0	0	0	+: 0/1/0 \| -: 0/1/0	11	0	0	0	Result
514	TF1655	long-chain-fatty-acid-CoA ligase	TF1656	possible 2-methylthioadenine synthetase	->->	1771129	1771254	126	44.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
517	TF1659	hypothetical protein	TF1660	hypothetical protein	->->	1775270	1775408	139	46.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	8	0	0	0	Result
518	TF1660	hypothetical protein	TF1661	conserved hypothetical protein	->->	1775661	1776204	544	45.8%	0	0	0	+: 0/0/0 \| -: 0/3/0	1	0	0	0	Result
519	TF1662	possible transcriptional regulator, PadR family	TF1663	ABC transporter, permease component	->->	1777681	1777819	139	33.8%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
521	TF1667	biotin acetyl-CoA carboxylase ligase/biotin operon repressor bifunctional protein	TF1668	possible glycosylhydrolase	->->	1780372	1780480	109	41.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
522	TF1677	ATP synthase, beta subunit	TF1678	periplasmic protease	->->	1790982	1791236	255	33.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
523	TF1682	hydrolase	TF1684	zinc protease	->->	1797404	1797535	132	38.6%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
524	TF1688	conserved hypothetical protein; possible periplasmic protein	TF1689	conserved hypothetical protein	->->	1804943	1805207	265	41.5%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
525	TF1689	conserved hypothetical protein	TF1690	chaperone protein dnaK	->->	1806675	1806876	202	34.7%	0	0	0	+: 2/0/0 \| -: 0/0/0	1	0	0	0	Result
526	TF1690	chaperone protein dnaK	TF1691	integrase	->->	1808782	1809561	780	38.8%	0	10	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
527	TF1692	conserved hypothetical protein; possible mobilizable transposon, TnpC	TF1693	conserved hypothetical protein; possible thiopurine S-methyltransferase (TPMT) family protein	->->	1811493	1811631	139	35.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
528	TF1693	conserved hypothetical protein; possible thiopurine S-methyltransferase (TPMT) family protein	TF1694	conserved hypothetical protein	->->	1812433	1812632	200	43%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
529	TF1694	conserved hypothetical protein	TF1695	excisionase	->->	1816395	1816661	267	31.1%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
530	TF1696	conserved hypothetical protein	TF1697	mobilizable transposon, excision protein	->->	1818236	1818465	230	33.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
531	TF1697	mobilizable transposon, excision protein	TF1698	mobilization protein	->->	1819354	1819566	213	38%	0	0	0	+: 1/1/0 \| -: 0/1/0	1	0	0	0	Result
532	TF1700	conserved hypothetical protein	TF1701	transcriptional regulator	->->	1821522	1821632	111	30.6%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	1	1	111	Result	taaagcttctttcctgcaccaattaaaatgatttaagggaatgagaaaataaaacctcattccctttttctatgctatttcatttcatatctttgcgctatcaaaagaaca
534	TF1707	conserved hypothetical protein	TF1708	transcriptional regulator	->->	1829143	1829324	182	35.2%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
535	TF1713	hypothetical protein	TF1714	hypothetical protein	->->	1833777	1834264	488	42.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	4	0	0	0	Result
536	TF1715	thermolysin; zinc metalloprotease	TF1716	hypothetical protein	->->	1837263	1837581	319	40.4%	0	0	0	+: 0/1/0 \| -: 0/5/0	10	0	0	0	Result
537	TF1716	hypothetical protein	TF1717	DNA mismatch repair protein	->->	1837771	1837944	174	39.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
538	TF1722	conserved hypothetical protein	TF1723	alpha-rhamnosidase	->->	1848532	1848635	104	27.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
539	TF1730	diaminopimelate decarboxylase	TF1733	conserved hypothetical protein	->->	1855968	1856154	187	48.7%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
540	TF1735	dehydrogenase, possible NADH-dependent dehydrogenase	TF1736	hypothetical protein	->->	1861521	1861822	302	33.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
541	TF1738	outer membrane protein	TF1739	possible sulfatase	->->	1867007	1867122	116	36.2%	0	0	0	+: 0/3/0 \| -: 0/1/0	1	0	0	0	Result
542	TF1739	possible sulfatase	TF1740	hypothetical protein	->->	1868665	1868784	120	46.7%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
543	TF1740	hypothetical protein	TF1741	conserved hypothetical protein	->->	1869253	1869443	191	38.7%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
544	TF1741	conserved hypothetical protein	TF1742	TPR repeat-containing protein	->->	1873074	1873268	195	33.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
545	TF1747	hypothetical protein	TF1748	conserved hypothetical protein	->->	1881558	1882697	1140	36.8%	0	0	16	+: 0/0/0 \| -: 3/0/0	1	0	0	0	Result
546	TF1749	outer membrane protein, TonB dependent receptor	TF1750	hypothetical protein	->->	1885860	1885993	134	36.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
547	TF1750	hypothetical protein	TF1751	two-component system response regulator	->->	1886627	1887021	395	38.7%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
548	TF1751	two-component system response regulator	TF1752	hypothetical protein	->->	1887814	1887995	182	30.2%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
549	TF1755	periplasmic protease	TF1756	chromosome partitioning ATPase, ParA family	->->	1892928	1893217	290	39.7%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
550	TF1762	hypothetical protein	TF1763	K+-dependent Na+/Ca+ exchanger related-protein	->->	1899709	1900545	837	50.1%	0	0	0	+: 0/3/0 \| -: 0/0/0	22	0	0	0	Result
552	TF1771	prolipoprotein diacylglyceryl transferase	TF1773	hypothetical protein	->->	1910668	1911078	411	38%	0	0	0	+: 0/2/0 \| -: 0/2/0	1	0	0	0	Result
553	TF1773	hypothetical protein	TF1774	arylsulfatase precursor	->->	1911466	1911565	100	32%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
554	TF1774	arylsulfatase precursor	TF1775	oxidoreductase, Gfo/Idh/MocA family	->->	1913000	1913274	275	38.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
555	TF1775	oxidoreductase, Gfo/Idh/MocA family	TF1776	urocanate hydratase	->->	1914679	1914799	121	35.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
556	TF1779	conserved hypothetical protein	TF1780	formiminotransferase-cyclodeaminases	->->	1921109	1921253	145	26.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
559	TF1787	conserved hypothetical protein	TF1788	conserved hypothetical protein	->->	1927366	1927554	189	38.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
560	TF1788	conserved hypothetical protein	TF1789	conserved hypothetical protein	->->	1930180	1930358	179	44.1%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
561	TF1789	conserved hypothetical protein	TF1790	conserved hypothetical protein	->->	1931265	1931366	102	35.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
562	TF1797	SNF family transporter	TF1798	aldose 1-epimerase	->->	1938632	1938954	323	35.3%	0	0	0	+: 0/2/0 \| -: 1/0/0	1	0	0	0	Result
563	TF1798	aldose 1-epimerase	TF1799	quinolinate synthetase	->->	1940083	1940415	333	33.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
564	TF1806	hypothetical protein	TF1807	thioesterase family protein	->->	1948935	1949038	104	38.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
565	TF1810	conserved hypothetical protein; possible membrane protein	TF1811	hypothetical protein	->->	1952367	1952662	296	30.1%	0	0	0	+: 0/0/0 \| -: 2/1/0	1	0	0	0	Result
566	TF1812	tryptophan synthase, beta chain	TF1813	peptide methionine sulfoxide reductase	->->	1954195	1954309	115	36.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
567	TF1813	peptide methionine sulfoxide reductase	TF1814	conserved hypothetical protein; possible biotin synthase related domain containing protein	->->	1955354	1955464	111	41.4%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
568	TF1815	conserved hypothetical protein	TF1817	hypothetical protein	->->	1957503	1957763	261	34.9%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
569	TF1824	ABC transporter, ATP-binding protein	TF1825	mannose-6-phosphate isomerase	->->	1973571	1973717	147	45.6%	0	0	0	+: 0/1/0 \| -: 0/0/0	2	0	0	0	Result
570	TF1838	tRNA/rRNA methyltransferase	TF1839	conserved hypothetical protein	->->	1988806	1989486	681	46.4%	0	0	0	+: 0/0/0 \| -: 0/2/0	26	0	0	0	Result
573	TF1841	hypothetical protein	TF1842	hypothetical protein	->->	1992328	1992710	383	45.7%	0	0	0	+: 0/0/0 \| -: 0/2/0	33	0	0	0	Result
574	TF1842	hypothetical protein	TF1843	surface antigen BspA	->->	1992861	1992973	113	31%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
575	TF1843	surface antigen BspA	TF1844	hypothetical protein	->->	1996250	1996528	279	36.2%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
576	TF1846	hypothetical protein	TF1847	hypothetical protein	->->	1997076	1997528	453	43.9%	0	0	0	+: 0/1/0 \| -: 0/2/0	12	0	0	0	Result
577	TF1848	conserved hypothetical protein	TF1850	Na+/H+-exchanging protein	->->	1998005	1998681	677	49.8%	0	0	0	+: 0/1/0 \| -: 0/1/0	30	0	0	0	Result
578	TF1855	O-sialoglycoprotein endopeptidase	TF1856	conserved hypothetical protein	->->	2009918	2010108	191	35.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
579	TF1861	conserved hypothetical protein; possible membrane protein	TF1862	hypothetical protein	->->	2018119	2018685	567	36.7%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
580	TF1862	hypothetical protein	TF1863	Fe-S oxidoreductase	->->	2018845	2018959	115	30.4%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
583	TF1875	conserved hypothetical protein	TF1876	hypothetical protein	->->	2029654	2029883	230	34.8%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
584	TF1876	hypothetical protein	TF1877	hypothetical protein	->->	2030115	2030551	437	37.1%	0	0	0	+: 1/0/0 \| -: 1/1/0	1	0	0	0	Result
585	TF1884	conserved hypothetical protein	TF1885	conserved hypothetical protein	->->	2036657	2037446	790	37.2%	0	0	0	+: 2/0/0 \| -: 0/0/0	1	0	0	0	Result
586	TF1887	hypothetical protein	TF1888	RNA polymerase ECF-type sigma factor	->->	2040861	2041079	219	42.9%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
587	TF1890	hypothetical protein	TF1891	hypothetical protein	->->	2043154	2043528	375	36.3%	0	0	0	+: 0/0/0 \| -: 0/3/0	8	0	0	0	Result
588	TF1894	hypothetical protein	TF1895	hypothetical protein	->->	2047374	2047490	117	37.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
589	TF1896	conserved hypothetical protein; possible phage-related protein	TF1897	conserved hypothetical protein; possible aminopeptidase	->->	2049048	2049398	351	28.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
590	TF1899	anti-sigma factor	TF1900	conserved hypothetical protein	->->	2053876	2054006	131	49.6%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
591	TF1904	two-component system response regulator	TF1905	conserved hypothetical protein	->->	2059796	2060071	276	37.7%	0	0	0	+: 0/0/0 \| -: 0/1/0	2	0	0	0	Result
592	TF1905	conserved hypothetical protein	TF1906	conserved hypothetical protein	->->	2060393	2061094	702	43.3%	0	5	0	+: 1/0/0 \| -: 0/0/0	2	0	0	0	Result
593	TF1910	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	TF1911	conserved hypothetical protein	->->	2065179	2065282	104	37.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
594	TF1911	conserved hypothetical protein	TF1912	transcriptional regulator, TetR family	->->	2065994	2066109	116	37.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
595	TF1914	conserved hypothetical protein	TF1915	NAD-dependent protein deacetylase, SIR2 family	->->	2067717	2067859	143	42.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
596	TF1915	NAD-dependent protein deacetylase, SIR2 family	TF1916	conserved hypothetical protein; possible ATPase	->->	2068550	2068669	120	42.5%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
597	TF1924	prenyltransferase, UbiA family	TF1926	hypothetical protein	->->	2073888	2074554	667	40.8%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
598	TF1933	methionyl-tRNA synthetase	TF1935	ATP-dependent RNA helicase, DEAD/DEAH-related helicase	->->	2081945	2082141	197	38.6%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
599	TF1937	conserved hypothetical protein	TF1938	hypothetical protein	->->	2085648	2085856	209	33.5%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
600	TF1938	hypothetical protein	TF1939	hypothetical protein	->->	2086331	2086438	108	38%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
601	TF1940	TPR-repeat-containing protein	TF1941	3-phosphoshikimate-1-carboxyvinyltransferase	->->	2088875	2089001	127	34.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
602	TF1942	conserved hypothetical protein	TF1943	phosphoenolpyruvate carboxykinase	->->	2090707	2090935	229	33.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
603	TF1943	phosphoenolpyruvate carboxykinase	TF1944	conserved hypothetical protein	->->	2092526	2092655	130	45.4%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
604	TF1948	conserved hypothetical protein	TF1949	leucyl-tRNA synthetase	->->	2096856	2097088	233	37.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
605	TF1953	methlytransferase, possible UbiE/COQ5 family	TF1954	long-chain-fatty-acid--CoA ligase	->->	2104933	2105095	163	30.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
606	TF1959	conserved hypothetical protein	TF1960	TonB protein	->->	2110567	2110770	204	29.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
608	TF1965	conserved hypothetical protein	TF1966	conserved hypothetical protein	->->	2114924	2115128	205	41%	0	0	1	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
609	TF1968	conserved hypothetical protein	TF1969	transcriptional regulator, AsnC family	->->	2116020	2116175	156	34%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
610	TF1969	transcriptional regulator, AsnC family	TF1970	oxaloacetate decarboxylase, beta subunit	->->	2116695	2116943	249	41.4%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
611	TF1974	glyoxalase I related protein (lactoylglutathione lyase)	TF1975	uridylate kinase	->->	2121489	2121675	187	39%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
612	TF1975	uridylate kinase	TF1976	RNA polymerase ECF-type sigma factor	->->	2122420	2122659	240	34.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
613	TF1977	anti-sigma factor	TF1978	outer membrane protein, TonB dependent receptor	->->	2124488	2124622	135	33.3%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
614	TF1980	conserved hypothetical protein	TF1981	mannose-6-phosphate isomerase	->->	2130921	2131035	115	47%	0	0	0	+: 0/2/0 \| -: 0/0/0	2	0	0	0	Result
615	TF1982	1,4-alpha-glucan branching enzyme	TF1983	conserved hypothetical protein	->->	2134191	2134823	633	35.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	2	0	0	0	Result
617	TF1984	conserved hypothetical protein	TF1985	surface antigen BspA	->->	2135640	2135798	159	32.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
618	TF1985	surface antigen BspA	TF1986	hypothetical protein	->->	2136966	2137160	195	36.9%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
619	TF1987	hypothetical protein	TF1989	outer membrane protein, possible TonB dependent receptor	->->	2137793	2137962	170	30.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
620	TF1991	hypothetical protein	TF1992	hypothetical protein	->->	2143645	2144231	587	41.2%	0	0	0	+: 0/6/0 \| -: 0/2/0	1	0	0	0	Result
621	TF1993	hypothetical protein	TF1994	acyl-CoA synthetase	->->	2144583	2145119	537	49.7%	0	0	8	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
622	TF1996	ATP-dependent exonuclease SbcC	TF1997	ROK family transcriptional regulator	->->	2151652	2151777	126	26.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
623	TF1997	ROK family transcriptional regulator	TF1999	ArgK protein with ATPase and kinase domains	->->	2152747	2152908	162	40.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
624	TF2004	thymidylate synthase	TF2006	uracil permease	->->	2157304	2157418	115	37.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
627	TF2013	polysaccharide deacetylase	TF2014	dipeptidyl aminopeptidase IV	->->	2169402	2169537	136	39.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
628	TF2020	muconate cycloisomerase	TF2021	hypothetical protein	->->	2177613	2177841	229	36.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
629	TF2025	hypothetical protein	TF2026	hypothetical protein	->->	2182241	2182798	558	38.2%	0	19	0	+: 0/0/0 \| -: 0/0/0	7	0	0	0	Result
630	TF2027	conserved hypothetical protein	TF2028	hypothetical protein	->->	2184237	2184481	245	26.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
631	TF2030	hypothetical protein	TF2031	conserved hypothetical protein	->->	2186185	2186744	560	38.6%	0	0	0	+: 0/3/0 \| -: 1/4/1	1	0	0	0	Result
632	TF2032	outer membrane protein, TonB dependent receptor	TF2033	conserved hypothetical protein	->->	2191478	2191668	191	30.9%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
633	TF2035	conserved hypothetical protein	TF2036	possible pyruvate formate-lyase activating enzyme	->->	2195912	2196441	530	36.4%	0	0	0	+: 0/3/0 \| -: 0/4/0	3	0	0	0	Result
634	TF2038	hypothetical protein	TF2039	possible cell-cycle regulation histidine triad (HIT) protein	->->	2199283	2199457	175	42.9%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
635	TF2040	transcription elongation factor	TF2041	conserved hypothetical protein	->->	2200341	2200534	194	31.4%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
636	TF2047	hypothetical protein	TF2048	conserved hypothetical protein	->->	2210359	2210782	424	46.7%	0	0	0	+: 0/2/0 \| -: 0/0/0	20	0	0	0	Result
637	TF2051	hypothetical protein	TF2052	acetyl transferase	->->	2215770	2216646	877	34.5%	0	250	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
638	TF2055	UDP-N-acetyl-D-mannosaminuronic acid dehydrogenase	TF2056	conserved hypothetical protein	->->	2220845	2221011	167	34.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
639	TF2056	conserved hypothetical protein	TF2057	hypothetical protein	->->	2222131	2222234	104	26%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
640	TF2058	possible ATP-dependent DNA helicase	TF2059	asparagine synthase, glutamine-hydrolyzing	->->	2223859	2224066	208	41.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
641	TF2060	glycosyltransferase	TF2061	hypothetical protein	->->	2227035	2227540	506	32%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
643	TF2078	dehydrogenase	TF2079	permease	->->	2245532	2245724	193	54.4%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
646	TF2086	transglutaminase-related protein	TF2087	conserved hypothetical protein	->->	2256828	2256995	168	41.7%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
647	TF2092	ribonuclease III	TF2093	conserved hypothetical protein	->->	2261884	2262111	228	47.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
648	TF2093	conserved hypothetical protein	TF2094	6-phosphofructokinase	->->	2262463	2262576	114	35.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
649	TF2094	6-phosphofructokinase	TF2095	5'-nucleotidase precursor	->->	2263585	2263730	146	24.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
650	TF2096	possible OmpA, outer membrane-related protein	TF2097	glucose inhibited division protein A	->->	2268516	2269276	761	26.5%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
652	TF2108	hypothetical protein	TF2109	possible metallo-beta-lactamase family protein	->->	2277750	2278081	332	40.4%	0	0	0	+: 0/2/0 \| -: 0/0/0	7	0	0	0	Result
654	TF2115	conserved hypothetical protein; possible carboxylesterase	TF2116	conserved hypothetical protein; possible hemagglutinin/hemolysin	->->	2285832	2285938	107	31.8%	0	0	0	+: 0/2/0 \| -: 0/2/0	1	0	0	0	Result
655	TF2117	hypothetical protein	TF2118	conserved hypothetical protein	->->	2289975	2290100	126	28.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
657	TF2121	phosphoenolpyruvate synthase	TF2123	conserved hypothetical protein; TPR-repeat protein	->->	2297286	2297407	122	36.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
658	TF2125	conserved hypothetical protein	TF2126	S-adenosylhomocysteine hydrolase	->->	2302526	2302640	115	45.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
659	TF2126	S-adenosylhomocysteine hydrolase	TF2127	hypothetical protein	->->	2304057	2304177	121	38.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
660	TF2134	conserved hypothetical protein	TF2133	aspartate-semialdehyde dehydrogenase	->->	2310248	2310414	167	36.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
661	TF2135	conserved hypothetical protein	TF2136	conserved hypothetical protein	->->	2311696	2311950	255	31.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
662	TF2138	conserved hypothetical protein	TF2139	hypothetical protein	->->	2315507	2315800	294	36.4%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
663	TF2139	hypothetical protein	TF2140	hypothetical protein	->->	2316239	2316511	273	36.6%	0	0	0	+: 0/2/0 \| -: 1/0/0	1	0	0	0	Result
664	TF2141	conserved hypothetical protein	TF2142	hypothetical protein	->->	2318353	2318555	203	28.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
665	TF2142	hypothetical protein	TF2143	S-adenosylmethionine:tRNA ribosyltransferase-isomerase	->->	2319273	2319470	198	36.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
666	TF2143	S-adenosylmethionine:tRNA ribosyltransferase-isomerase	TF2145	conserved hypothetical protein; possible rhodanese-domain protein	->->	2319765	2319903	139	53.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
667	TF2152	uronate isomerase	TF2153	6-phosphofructokinase	->->	2328122	2328251	130	40.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
670	TF2161	conserved hypothetical protein	TF2162	thermolysin precursor	->->	2338423	2338808	386	44.3%	0	0	0	+: 0/1/0 \| -: 0/1/0	10	0	0	0	Result
671	TF2162	thermolysin precursor	TF2163	hypothetical protein	->->	2340774	2340941	168	23.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
672	TF2165	hypothetical protein	TF2166	hypothetical protein	->->	2341983	2342254	272	47.8%	0	0	0	+: 0/1/0 \| -: 0/0/0	12	0	0	0	Result
673	TF2166	hypothetical protein	TF2167	hypothetical protein	->->	2342423	2342725	303	46.2%	0	0	0	+: 0/0/0 \| -: 0/1/0	6	0	0	0	Result
674	TF2169	hypothetical protein	TF2171	hypothetical protein	->->	2345415	2345624	210	48.1%	0	0	0	+: 0/1/0 \| -: 0/0/0	10	0	0	0	Result
675	TF2171	hypothetical protein	TF2173	hypothetical protein	->->	2345853	2345955	103	58.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	4	0	0	0	Result
676	TF2172	hypothetical protein	TF2174	possible endopeptidase precursor	->->	2346196	2346431	236	45.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	9	0	0	0	Result
677	TF2175	hypothetical protein	TF2176	hypothetical protein	->->	2348876	2349050	175	28%	0	0	0	+: 0/0/0 \| -: 0/0/0	7	0	0	0	Result
678	TF2176	hypothetical protein	TF2177	hypothetical protein	->->	2349246	2349420	175	40%	0	0	0	+: 0/0/0 \| -: 0/0/0	4	0	0	0	Result
679	TF2179	integral membrane protein, MarC family	TF2180	phosphoribosylamine--glycine ligase	->->	2352430	2352719	290	42.4%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
680	TF2184	conserved hypothetical protein	TF2185	outer membrane protein, TonB dependent receptor	->->	2357104	2357401	298	40.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
681	TF2189	conserved hypothetical protein	TF2190	conserved hypothetical protein	->->	2364945	2365151	207	33.3%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
682	TF2190	conserved hypothetical protein	TF2191	hypothetical protein	->->	2365707	2366073	367	40.1%	0	0	0	+: 0/1/0 \| -: 0/0/0	16	0	0	0	Result
683	TF2196	hypothetical protein	TF2197	conserved hypothetical protein	->->	2372241	2372541	301	39.9%	0	0	0	+: 0/4/0 \| -: 0/0/0	1	0	0	0	Result
684	TF2201	hypothetical protein	TF2202	hypothetical protein	->->	2378345	2378821	477	39.4%	0	0	0	+: 0/2/0 \| -: 0/1/0	14	0	0	0	Result
686	TF2229.1	rteR regulatory ortholog (with internal stop)	TF2230	CTn excision protein	->->	2399788	2399938	151	41.7%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
687	TF2231	DNA methylase, site-specific DNA-methyltransferase (adenine-specific)	TF2233	conserved hypothetical protein	->->	2406309	2406894	586	29.2%	0	0	15	+: 1/1/0 \| -: 1/2/0	1	0	0	0	Result
688	TF2234	acetyltransferase, GNAT family	TF2235	tetracycline resistance protein related to CtnDOT tetQ	->->	2408139	2408385	247	30%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
689	TF2237	two-component system response regulator involved in CTn	TF2238	conserved hypothetical protein	->->	2413954	2414237	284	46.5%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	1	4	283	Result	cccgcaattcgctgaaaatggctatctttgcatgacatattagaaggtaacggcgactggcagagccttttgccgcctatatataacataagaccgcaaggcgtttcgagcgaaaatctggtaaattgacactacggagacgattgcgtgatgcttatgctatgcctacgcatagcgtgcattcacgtactctccgtaaaaggctttaccagagccgtcgcttgaaagtagtgtgatttgcacgctacttttttgcccttgcccaacgaaaggaaacgat
690	TF2250	transfer region-related protein, TraD	TF2251	conjugative transposon protein, TraE	->->	2424234	2424411	178	48.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	1	79	178	Result	cgcaacggacacacccaagtccgtagaaacaaacgggcaacccactaaaccaaagtaaagtaatcgagtatcaaccgcccgacaaaggaccatccaccct
691	TF2270	conserved hypothetical protein	TF2271	conserved hypothetical protein	->->	2435822	2435941	120	47.5%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
692	TF2281	hypothetical protein	TF2283	hypothetical protein	->->	2440056	2440405	350	33.1%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	3	49	196	Result	gttacttttgcatacgaagagttctttgaaggttacgcaacgcgcagaaggatgatgcagtagataactaactaaatcgtaacctattactatcatgagcaattaacctacgctcagttccaataaattacactcttttcgtaacttc
693	TF2283	hypothetical protein	TF2284	hypothetical protein	->->	2440586	2440696	111	33.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
694	TF2287	hypothetical protein	TF2288	hypothetical protein	->->	2441520	2442472	953	35.7%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
695	TF2288	hypothetical protein	TF2289	secretion protein, possible HlyD family	->->	2442659	2442864	206	40.3%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
696	TF2295	hypothetical protein	TF2296	hypothetical protein	->->	2448778	2449031	254	35.8%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
697	TF2298	hypothetical protein	TF2299	hypothetical protein	->->	2449989	2450133	145	28.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
698	TF2299	hypothetical protein	TF2300	conserved hypothetical protein	->->	2450308	2450760	453	35.8%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
699	TF2302	conserved hypothetical protein; possible outer membrane protein	TF2303	conserved hypothetical protein	->->	2458124	2458391	268	33.2%	0	0	0	+: 0/4/0 \| -: 0/5/0	1	0	0	0	Result
700	TF2308	conserved hypothetical protein	TF2309	cysteinyl-tRNA synthetase	->->	2468920	2469031	112	42.9%	0	0	0	+: 0/1/0 \| -: 0/3/0	1	0	0	0	Result
701	TF2319	acyl carrier protein	TF2320	hypothetical protein	->->	2476649	2476793	145	40.7%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
702	TF2321	hypothetical protein	TF2322	conserved hypothetical protein; possible lipoprotein	->->	2482718	2482882	165	36.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
703	TF2325	conserved hypothetical protein	TF2326	conserved hypothetical protein	->->	2484720	2484825	106	32.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
704	TF2338	conserved hypothetical protein	TF2339	hypothetical protein	->->	2500067	2500395	329	35.9%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
705	TF2340	hypothetical protein	TF2341	hypothetical protein	->->	2500976	2505874	4899	48.7%	0	0	0	+: 0/3/0 \| -: 2/9/7	1	0	0	0	Result
706	TF2342	glutathione peroxidase	TF2343	ribosome recycling factor	->->	2506700	2507001	302	38.7%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
707	TF2346	hypothetical protein	TF2347	outer membrane protein, TonB dependent receptor	->->	2510034	2510294	261	31.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
708	TF2349	conserved hypothetical protein	TF2350	hypothetical protein	->->	2514982	2515202	221	40.7%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
709	TF2350	hypothetical protein	TF2351	acetate kinase	->->	2515425	2515619	195	46.7%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
713	TF2362	conserved hypothetical protein	TF2363	conserved hypothetical protein	->->	2529229	2529410	182	39.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
714	TF2363	conserved hypothetical protein	TF2364	conserved hypothetical protein; possible DNA binding protein, excisionase family	->->	2530341	2530501	161	38.5%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
715	TF2366	conserved hypothetical protein	TF2367	delta-1-pyrroline-5-carboxylate dehydrogenase	->->	2531953	2532141	189	46.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
716	TF2374	UDP-3-O-(R-3-hydoxymyristoyl)-glucosamine-N-acylt ransferase	TF2375	conserved hypothetical protein	->->	2540953	2541092	140	42.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
719	TF2383	hypothetical protein	TF2384	thiol:disulfide interchange protein	->->	2548626	2548740	115	33%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
720	TF2385	conserved hypothetical protein; possible MazG family protein	TF2386	beta-galactosidase	->->	2551605	2551815	211	37.4%	0	0	0	+: 0/1/0 \| -: 0/4/0	1	0	0	0	Result
722	TF2392	alpha-galactosidase	TF2394	integrase/recombinase XerD	->->	2565567	2565747	181	43.1%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
723	TF2395	conserved hypothetical protein	TF2396	dimethyladenosine transferase	->->	2567725	2567864	140	38.6%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
724	TF2398	magnesium chelatase, D/I family	TF2399	precorrin-2 methyltransferase	->->	2571267	2571389	123	35.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
725	TF2413	hypothetical protein	TF2414	hypothetical protein	->->	2590741	2590864	124	37.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
726	TF2417	outer membrane protein, TonB dependent receptor	TF2418	GTP-binding protein	->->	2597021	2597343	323	29.1%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
727	TF2419	conserved hypothetical protein; possible DNA uptake-related protein	TF2420	hypothetical protein	->->	2599236	2599374	139	42.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
728	TF2421	cytocidal toxin protein	TF2422	hypothetical protein	->->	2601298	2601437	140	38.6%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
729	TF2423	papain family cysteine protease	TF2424	hypothetical protein	->->	2602558	2603171	614	39.6%	0	0	0	+: 0/0/0 \| -: 0/1/0	2	0	0	0	Result
730	TF2426	conserved hypothetical protein; possible TonB receptor	TF2427	arylsulfatase regulator (Fe-S oxidoreductase)	->->	2605992	2606868	877	38.7%	0	0	0	+: 0/2/0 \| -: 0/1/0	2	0	0	0	Result
731	TF2437	elongation factor P	TF2438	hypothetical protein	->->	2615805	2615920	116	35.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
732	TF2438	hypothetical protein	TF2439	conserved hypothetical protein	->->	2616218	2616519	302	45.4%	0	0	0	+: 0/1/0 \| -: 0/0/0	18	0	0	0	Result
733	TF2440	conserved hypothetical protein; possible DNA mismatch repair protein	TF2441	10 kDa chaperonin	->->	2618198	2618378	181	35.9%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
734	TF2446	riboflavin-specific deaminase	TF2447	lipoprotein	->->	2623581	2623688	108	31.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
735	TF2458	ribosome-binding factor A	TF2459	conserved hypothetical protein	->->	2635706	2635926	221	38%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
736	TF2459	conserved hypothetical protein	TF2460	outer membrane protein, possibly involved in nutrient binding	->->	2636719	2636896	178	39.3%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
738	TF2470	possible heme biosynthesis-related protein	TF2471	conserved hypothetical protein	->->	2648780	2649358	579	32.6%	0	0	0	+: 0/4/0 \| -: 0/2/0	1	0	0	0	Result
739	TF2477	phosphatase	TF2478	hypothetical protein	->->	2655026	2655514	489	44.2%	0	0	0	+: 0/1/0 \| -: 0/0/0	9	0	0	0	Result
740	TF2478	hypothetical protein	TF2479	conserved hypothetical protein	->->	2655674	2656131	458	28.4%	0	0	0	+: 0/2/0 \| -: 1/1/0	1	0	0	0	Result
741	TF2479	conserved hypothetical protein	TF2480	hypothetical protein	->->	2657104	2657234	131	21.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
742	TF2482	hypothetical protein	TF2483	hypothetical protein	->->	2659246	2659824	579	38.5%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
743	TF2484	hypothetical protein	TF2485	conserved hypothetical protein	->->	2660367	2660742	376	39.1%	0	0	0	+: 0/2/0 \| -: 0/0/0	2	0	0	0	Result
746	TF2489	hypothetical protein	TF2491	hypothetical protein	->->	2664759	2665092	334	40.1%	0	0	0	+: 0/2/0 \| -: 0/0/0	2	0	0	0	Result
747	TF2500	ABC transporter, ATP-binding protein	TF2501	DNA mismatch repair protein	->->	2675363	2676419	1057	46.9%	0	0	0	+: 0/3/0 \| -: 0/6/0	33	0	0	0	Result
748	TF2510	trigger factor, peptidyl prolyl cis-trans isomerase	TF2511	RNA binding protein	->->	2689740	2690049	310	28.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
749	TF2515	outer membrane protein, TonB dependent receptor	TF2517	hypothetical protein	->->	2694926	2695228	303	43.9%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
750	TF2517	hypothetical protein	TF2518	ATP-dependent DNA helicase	->->	2695541	2695680	140	36.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
751	TF2528	anti-sigma factor	TF2527	RNA polymerase ECF-type sigma factor	->->	2710115	2710236	122	32.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
752	TF2530	conserved hypothetical protein	TF2531	possible dipeptidyl-peptidase III	->->	2712987	2713184	198	40.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
753	TF2533	adenylosuccinate synthetase	TF2534	conserved hypothetical protein	->->	2717075	2717183	109	41.3%	0	0	0	+: 1/1/0 \| -: 0/0/0	1	0	0	0	Result
754	TF2535	histidyl-tRNA synthetase	TF2536	subtilisin-like serine protease	->->	2719239	2719425	187	42.2%	0	0	0	+: 0/1/0 \| -: 0/1/0	2	0	0	0	Result
757	TF2543	RNA polymerase sigma-70 factor, ECF subfamily	TF2544	cytidine deaminase	->->	2728327	2728461	135	33.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
758	TF2544	cytidine deaminase	TF2545	hypothetical protein	->->	2728954	2729192	239	31.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
759	TF2546	S-adenosylmethionine synthetase	TF2547	hypothetical protein	->->	2730664	2730803	140	35.7%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
760	TF2547	hypothetical protein	TF2548	30S ribosomal protein S12	->->	2731008	2731377	370	40.8%	0	0	0	+: 1/0/0 \| -: 0/0/0	6	0	0	0	Result
761	TF2576	translation initiation factor IF-1	TF2577	30S ribosomal protein S13	->->	2746268	2746447	180	37.8%	0	1	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
762	TF2578	30S ribosomal protein S11	TF2579	30S ribosomal protein S4	->->	2747225	2747341	117	42.7%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
763	TF2581	50S ribosomal protein L17	TF2582	ABC transporter, ATP-binding protein	->->	2749431	2749572	142	41.5%	0	0	0	+: 0/2/0 \| -: 0/2/0	1	0	0	0	Result
764	TF2583	possible ABC transporter, permease component	TF2584	hypothetical protein	->->	2751087	2751319	233	41.6%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
768	TF2592	conserved hypothetical protein	TF2593	amino acid transport protein	->->	2762868	2763021	154	42.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
769	TF2597	outer membrane receptor protein; possible TonB dependent receptor	TF2598	conserved hypothetical protein	->->	2770912	2771171	260	34.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
770	TF2599	alpha-amylase family protein	TF2600	ribose-phosphate pyrophosphokinase	->->	2773724	2773827	104	30.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
771	TF2602	tRNA-(5-methylaminomethyl-2-thiouridylate) methyltransferase	TF2603	transcriptional regulator, AraC family	->->	2776561	2776717	157	36.3%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
772	TF2603	transcriptional regulator, AraC family	TF2604	possible membrane transport protein	->->	2777333	2777546	214	33.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
773	TF2604	possible membrane transport protein	TF2605	outer membrane protein, TonB dependent receptor	->->	2779893	2779994	102	34.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
774	TF2606	conserved hypothetical protein	TF2607	conserved hypothetical protein	->->	2783612	2783976	365	38.9%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
776	TF2609	dipeptidase, pathogenicity island-encoded protein D	TF2610	nitroreductase	->->	2786325	2786515	191	37.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
777	TF2613	conserved hypothetical protein	TF2614	conserved hypothetical protein	->->	2789859	2790060	202	33.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
778	TF2615	conserved hypothetical protein	TF2616	outer membrane protein, TonB dependent receptor	->->	2791270	2791609	340	42.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
779	TF2617	conserved hypothetical protein	TF2618	integral membrane protein, possible zinc transporter	->->	2795233	2795354	122	35.2%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
780	TF2636	glutaminase	TF2637	conserved hypothetical protein	->->	2807160	2807283	124	35.5%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
781	TF2637	conserved hypothetical protein	TF2638	cation transport protein	->->	2808016	2808124	109	39.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
782	TF2640	hypothetical protein	TF2641	riboflavin kinase/FAD synthase	->->	2809594	2809820	227	48.9%	0	0	0	+: 0/1/0 \| -: 0/0/0	8	0	0	0	Result
783	TF2646	conserved hypothetical protein	TF2647	transcriptional regulator, possible arylsulfatase regulator	->->	2816758	2816935	178	46.1%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
784	TF2647	transcriptional regulator, possible arylsulfatase regulator	TF2648	conserved hypothetical protein	->->	2818196	2818404	209	29.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
785	TF2653	hypothetical protein	TF2654	arginyl-tRNA synthetase	->->	2822521	2822831	311	42.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
786	TF2655	DNA topoisomerase I	TF2656	valyl-tRNA synthetase	->->	2827023	2827215	193	37.3%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
790	TF2662	hypothetical protein	TF2663	hypothetical protein	->->	2837192	2837291	100	37%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
791	TF2663	hypothetical protein	TF2664	hypothetical protein	->->	2841384	2841538	155	43.9%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
792	TF2664	hypothetical protein	TF2666	hypothetical protein	->->	2841791	2841957	167	54.5%	0	0	0	+: 0/1/0 \| -: 0/0/0	9	0	0	0	Result
793	TF2665	hypothetical protein	TF2667	hypothetical protein	->->	2842296	2842534	239	48.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	11	0	0	0	Result
794	TF2668	hypothetical protein	TF2670	hypothetical protein	->->	2842794	2842918	125	56.8%	0	0	0	+: 0/1/0 \| -: 0/0/0	9	0	0	0	Result
795	TF2674	conserved hypothetical protein; possible phosphoesterase	TF2675	conserved hypothetical protein	->->	2848838	2849003	166	25.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
796	TF2675	conserved hypothetical protein	TF2676	conserved hypothetical protein	->->	2849682	2849784	103	34%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
797	TF2680	conserved hypothetical protein	TF2681	conserved hypothetical protein	->->	2855777	2855935	159	27.7%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
798	TF2696	oxidoreductase, short chain dehydrogenase/reductase family	TF2697	small heat shock protein	->->	2871672	2871817	146	42.5%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
799	TF2697	small heat shock protein	TF2698	hypothetical protein	->->	2872250	2872614	365	40%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
800	TF2699	hypothetical protein	TF2700	possible nifS-like aminotransferase	->->	2872834	2872994	161	34.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
801	TF2700	possible nifS-like aminotransferase	TF2701	conserved hypothetical protein	->->	2874195	2874313	119	30.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
802	TF2714	hypothetical protein	TF2715	glycosyltransferase	->->	2888711	2889258	548	34.9%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
804	TF2720	conserved hypothetical protein	TF2721	conserved hypothetical protein	->->	2895002	2895729	728	37.4%	0	0	2	+: 1/1/1 \| -: 1/2/0	1	0	0	0	Result
807	TF2727	outer membrane protein, possibly involved in nutrient binding	TF2728	outer membrane protein, TonB dependent receptor	->->	2904595	2904747	153	30.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
808	TF2730	thiol:disulfide interchange protein	TF2731	Fe2+/Zn2+ uptake regulation protein	->->	2911007	2911335	329	44.7%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
809	TF2731	Fe2+/Zn2+ uptake regulation protein	TF2732	thioredoxin M	->->	2911747	2911906	160	38.1%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
810	TF2733	DNA polymerase III, alpha subunit	TF2734	conserved hypothetical protein	->->	2916034	2916180	147	29.9%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
811	TF2738	30S ribosomal protein S16	TF2739	thioredoxin	->->	2920145	2920265	121	41.3%	0	0	0	+: 0/0/0 \| -: 0/3/0	1	0	0	0	Result
812	TF2742	single-strand DNA-specific exonuclease	TF2743	conserved hypothetical protein	->->	2925664	2925896	233	31.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
813	TF2744	methionyl-tRNA formyltransferase	TF2745	hypothetical protein	->->	2927439	2927701	263	46%	0	0	0	+: 0/1/0 \| -: 0/2/0	3	0	0	0	Result
814	TF2745	hypothetical protein	TF2746	hypothetical protein	->->	2928008	2928135	128	47.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	9	0	0	0	Result
815	TF2746	hypothetical protein	TF2747	heat shock protein, HSP90 family	->->	2928307	2928418	112	51.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
816	TF2747	heat shock protein, HSP90 family	TF2748	ATP-dependent Clp protease	->->	2930477	2930598	122	38.5%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
817	TF2752	endonuclease III	TF2753	zinc protease	->->	2937572	2937682	111	32.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
818	TF2757	hypothetical protein	TF2758	hypothetical protein	->->	2942396	2942531	136	39%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
819	TF2758	hypothetical protein	TF2759	xylose repressor, ROK family	->->	2943531	2943707	177	38.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
820	TF2759	xylose repressor, ROK family	TF2760	MarR family transcriptional regulator	->->	2944914	2945158	245	46.5%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
821	TF2763	pyridine nucleotide-disulphide oxidoreductase family protein	TF2764	hypothetical protein	->->	2948655	2948896	242	24.4%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
822	TF2765	subtilisin-like serine protease	TF2766	shikimate kinase	->->	2951521	2951758	238	41.2%	0	0	0	+: 0/1/0 \| -: 0/1/0	2	0	0	0	Result
823	TF2768	ferredoxin oxidoreductase, beta subunit	TF2769	cell-division protein; ftsX family permease	->->	2955230	2955487	258	42.6%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
824	TF2775	conserved hypothetical protein; possible mucoidy inhibitor-related protein	TF2776	hypothetical protein	->->	2961419	2961609	191	34%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
825	TF2778	outer membrane protein, TonB dependent receptor	TF2779	fucose permease	->->	2964312	2964705	394	40.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
826	TF2782	conserved hypothetical protein	TF2783	aminotransferase, PatB family	->->	2967417	2968178	762	44%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
827	TF2786	hypothetical protein	TF2787	30S ribosomal protein S1	->->	2970363	2970515	153	27.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
828	TF2789	enoyl-[acyl-carrier-protein] reductase	TF2790	prismane protein, hybrid-cluster protein	->->	2973426	2973536	111	48.6%	0	0	0	+: 0/2/0 \| -: 0/2/0	1	0	0	0	Result
829	TF2790	prismane protein, hybrid-cluster protein	TF2791	GTP-binding protein TypA	->->	2975211	2975437	227	43.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
831	TF2792	30S ribosomal protein S15	TF2793	possible L-lysine 2,3-aminomutase	->->	2977660	2977800	141	39%	0	0	0	+: 1/1/0 \| -: 0/1/0	1	0	0	0	Result
832	TF2793	possible L-lysine 2,3-aminomutase	TF2794	possible transcriptional regulator	->->	2979949	2980077	129	44.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
833	TF2795	hypothetical protein	TF2796	cytochrome D ubiquinol oxidase, subunit II	->->	2980970	2981408	439	41.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	2	0	0	0	Result
834	TF2798	conserved hypothetical protein	TF2799	RNA polymerase ECF-type sigma factor	->->	2984394	2984524	131	30.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
835	TF2799	RNA polymerase ECF-type sigma factor	TF2800	anti-sigma factor	->->	2985113	2985284	172	36%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
836	TF2802	possible outer membrane protein	TF2803	dehydrogenase, possible NADH-dependent dehydrogenase	->->	2991875	2992048	174	27%	0	0	0	+: 1/1/0 \| -: 0/0/0	1	0	0	0	Result
837	TF2803	dehydrogenase, possible NADH-dependent dehydrogenase	TF2804	conserved hypothetical protein	->->	2993528	2993633	106	41.5%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
838	TF2804	conserved hypothetical protein	TF2806	conserved hypothetical protein	->->	2994510	2994614	105	36.2%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
839	TF2809	conserved hypothetical protein; possible translation factor (SUA5)	TF2810	conserved hypothetical protein	->->	3000572	3000722	151	44.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
840	TF2815	meso-diaminopimelate D-dehydrogenase	TF2816	hypothetical protein	->->	3006481	3007064	584	49.3%	0	0	0	+: 0/3/0 \| -: 0/0/0	20	0	0	0	Result
841	TF2816	hypothetical protein	TF2817	hypothetical protein	->->	3007245	3007497	253	37.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	17	0	0	0	Result
842	TF2817	hypothetical protein	TF2818	acetylornithine aminotransferase	->->	3007687	3007878	192	49.5%	0	0	0	+: 0/0/0 \| -: 0/1/0	11	0	0	0	Result
843	TF2823	TPR-containing protein	TF2824	nucleoside-transporting protein nupG	->->	3014398	3014840	443	49.2%	0	0	0	+: 0/2/0 \| -: 0/0/0	22	0	0	0	Result
846	TF2832	possible proton/sodium:glutamate symporter protein	TF2833	lipid A disaccharide synthase	->->	3024000	3024112	113	38.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
847	TF2835	stationary-phase survival protein SurE	TF2834	cardiolipin synthase	->->	3026021	3026125	105	41.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
848	TF2839	ATP-dependent exodeoxyribonuclease	TF2840	hypothetical protein	->->	3031096	3031199	104	41.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
849	TF2840	hypothetical protein	TF2841	conserved hypothetical protein	->->	3031350	3031580	231	39%	0	0	0	+: 0/0/0 \| -: 0/0/0	3	0	0	0	Result
850	TF2850	endoribonuclease L-PSP	TF2852	conserved hypothetical protein	->->	3038932	3039105	174	39.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
851	TF2855	ATPase, AAA family	TF2856	conserved hypothetical protein; possible TPR-repeat-containing protein	->->	3042072	3042257	186	30.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
852	TF2856	conserved hypothetical protein; possible TPR-repeat-containing protein	TF2857	conserved hypothetical protein	->->	3043083	3043221	139	34.5%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
853	TF2860	hypothetical protein	TF2861	conserved hypothetical protein; possible Rhs family protein	->->	3051741	3051877	137	37.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
854	TF2871	hypothetical protein	TF2872	hypothetical protein	->->	3062775	3062907	133	30.1%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
855	TF2872	hypothetical protein	TF2873	conserved hypothetical protein	->->	3063715	3064384	670	30%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
856	TF2879	tRNA (guanine-N-1)-methyltransferase	TF2880	phenylalanyl-tRNA synthetase, beta subunit	->->	3069069	3069191	123	48%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
857	TF2881	conserved hypothetical protein	TF2882	conserved hypothetical protein	->->	3072441	3073558	1118	35.5%	0	0	7	+: 0/3/0 \| -: 1/2/0	1	0	0	0	Result
858	TF2886	RNA methylase SpoU family	TF2887	phosphomannomutase/phosphoglucomutase	->->	3076331	3076466	136	44.1%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
859	TF2887	phosphomannomutase/phosphoglucomutase	TF2888	50S ribosomal protein L21	->->	3077853	3078134	282	36.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
860	TF2889	50S ribosomal protein L27	TF2891	lipoprotein	->->	3078749	3078901	153	43.1%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
861	TF2892	seryl-tRNA synthetase	TF2893	conserved hypothetical protein; possible phosphoesterase	->->	3080787	3080905	119	42%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
862	TF2893	conserved hypothetical protein; possible phosphoesterase	TF2894	conserved hypothetical protein; possible Fic family protein	->->	3082100	3082465	366	31.7%	0	0	0	+: 0/3/0 \| -: 0/1/0	1	0	0	0	Result
863	TF2894	conserved hypothetical protein; possible Fic family protein	TF2895	hypothetical protein	->->	3083648	3084075	428	34.6%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
864	TF2895	hypothetical protein	TF2896	conserved hypothetical protein; possible ATPase, AAA superfamily	->->	3084253	3084532	280	45%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
865	TF2896	conserved hypothetical protein; possible ATPase, AAA superfamily	TF2897	iron(III) ABC transporter, permease component	->->	3085748	3086037	290	29.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
866	TF2900	conserved hypothetical protein	TF2901	conserved hypothetical protein	->->	3090090	3090504	415	44.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
867	TF2902	holliday junction DNA helicase	TF2903	translation initiation factor SUI1	->->	3098541	3098713	173	37.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
868	TF2913	conserved hypothetical protein	TF2914	hypothetical protein	->->	3109178	3109484	307	44%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
869	TF2914	hypothetical protein	TF2915	hypothetical protein	->->	3109704	3110561	858	49.7%	0	0	0	+: 0/1/0 \| -: 0/2/0	33	0	0	0	Result
870	TF2916	conserved hypothetical protein	TF2917	conserved hypothetical protein	->->	3112239	3112394	156	35.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
871	TF2918	hypothetical protein	TF2919	5'-nucleotidase family protein	->->	3114443	3114580	138	43.5%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
872	TF2920	conserved hypothetical protein	TF2921	hypothetical protein	->->	3117231	3118637	1407	49%	0	0	0	+: 0/8/0 \| -: 0/1/0	52	0	0	0	Result
873	TF2921	hypothetical protein	TF2922	surface antigen BspA	->->	3118851	3119261	411	44.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	31	0	0	0	Result
874	TF2922	surface antigen BspA	TF2923	hypothetical protein	->->	3121599	3122307	709	47.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	40	0	0	0	Result
875	TF2923	hypothetical protein	TF2924	DNA-binding response regulator/sensor histidine kinase	->->	3122464	3122723	260	38.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
876	TF2924	DNA-binding response regulator/sensor histidine kinase	TF2925	beta-N-acetylglucosaminidase	->->	3125679	3125839	161	44.1%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
878	TF2928	predicted DNA repair protein	TF2929	conserved hypothetical protein	->->	3131500	3131623	124	36.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
879	TF2929	conserved hypothetical protein	TF2930	glutamyl-tRNA synthetase	->->	3132623	3132825	203	24.6%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
880	TF2934	acetyltransferase/carbonic anhydrase	TF2933	30S ribosomal protein S21	->->	3137306	3137483	178	28.1%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
882	TF2943	50S ribosomal protein L7/L12	TF2944	DNA-directed RNA polymerase, beta subunit	->->	3143628	3143746	119	37.8%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
883	TF2946	conserved hypothetical protein; possible ATPase	TF2947	isochorismate synthase	->->	3153423	3153772	350	40%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
885	TF2954	outer membrane protein, TonB dependent receptor	TF2955	integrase	->->	3162182	3162622	441	29.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
886	TF2956	conserved hypothetical protein	TF2958	type I restriction-modification system R subunit	->->	3166526	3166712	187	33.2%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
887	TF2961	type I restriction enzyme	TF2962	integrase/recombinase	->->	3173434	3173798	365	38.1%	0	0	28	+: 0/1/0 \| -: 1/3/0	1	0	0	0	Result
888	TF2964	type I restriction enzyme	TF2965	conserved hypothetical protein	->->	3176334	3176695	362	35.9%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
889	TF2966	hypothetical protein	TF2967	hypothetical protein	->->	3177733	3177904	172	23.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	7	0	0	0	Result
892	TF2977	candidate b-glycosyltransferase, Glycosyltransferase Family 2 protein	TF2978	conserved hypothetical protein	->->	3186109	3186215	107	33.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
893	TF2980	possible alpha-amylase	TF2981	conserved hypothetical protein	->->	3195875	3196108	234	39.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
895	TF2988	conserved hypothetical protein	TF2989	conserved hypothetical protein	->->	3205013	3205208	196	30.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
896	TF2993	SAM-dependent methyltransferase	TF2994	hypothetical protein	->->	3210478	3210744	267	39.7%	0	0	0	+: 0/1/0 \| -: 0/1/0	4	0	0	0	Result
897	TF2996	hypothetical protein	TF2997	hypothetical protein	->->	3211182	3211547	366	40.7%	0	0	0	+: 0/0/0 \| -: 0/2/0	23	0	0	0	Result
898	TF2997	hypothetical protein	TF2998	surface antigen BspA	->->	3211725	3211950	226	39.8%	0	0	0	+: 0/1/0 \| -: 0/1/0	8	0	0	0	Result
899	TF2998	surface antigen BspA	TF2999	conserved hypothetical protein	->->	3215212	3215705	494	48.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	16	0	0	0	Result
900	TF2999	conserved hypothetical protein	TF3000	hypothetical protein	->->	3215952	3216551	600	44.3%	0	0	0	+: 0/2/0 \| -: 0/0/0	2	0	0	0	Result
904	TF3003	hypothetical protein	TF3004	phosphoribosylformylglycinamidine (FGAM) synthase	->->	3220690	3220958	269	42%	0	0	0	+: 0/0/0 \| -: 0/1/0	14	0	0	0	Result
905	TF3004	phosphoribosylformylglycinamidine (FGAM) synthase	TF3005	histidine kinase sensor protein	->->	3224637	3224944	308	31.2%	0	0	0	+: 1/3/0 \| -: 0/0/0	1	0	0	0	Result
906	TF3006	response regulator, transcriptional regulator RprY	TF3007	conserved hypothetical protein	->->	3227223	3227395	173	37.6%	0	0	0	+: 0/0/0 \| -: 0/3/0	1	0	0	0	Result
908	TF3008	zinc protease	TF3009	RNA polymerase ECF-type sigma factor	->->	3228898	3229232	335	37%	0	0	0	+: 1/1/1 \| -: 0/0/0	1	0	0	0	Result
909	TF3009	RNA polymerase ECF-type sigma factor	TF3010	possible anti-sigma factor	->->	3229770	3229955	186	41.9%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
910	TF3010	possible anti-sigma factor	TF3011	outer membrane protein, TonB dependent receptor	->->	3230949	3231069	121	35.5%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
911	TF3013	conserved hypothetical protein	TF3014	oxidoreductase, short-chain dehydrogenase/reductase family	->->	3237600	3237762	163	46%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
912	TF3015	hypothetical protein	TF3016	conserved hypothetical protein	->->	3238744	3238885	142	21.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
913	TF3017	hypothetical protein	TF3018	polyphosphate kinase	->->	3239964	3240261	298	35.6%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
914	TF3024	periplasmic protease	TF3025	hypothetical protein	->->	3248775	3248911	137	38%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
915	TF3025	hypothetical protein	TF3026	conserved hypothetical protein	->->	3249152	3249276	125	25.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
916	TF3027	zinc metalloprotease	TF3028	1-deoxy-d-xylulose-5-phosphate reductoisomerase	->->	3251680	3251781	102	37.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
917	TF3030	16S rRNA processing protein	TF3031	conserved hypothetical protein	->->	3254357	3254540	184	42.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
918	TF3031	conserved hypothetical protein	TF3032	thiamin biosynthesis protein	->->	3255147	3255359	213	26.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
919	TF3033	S1 RNA binding domain protein, S1 ribosomal protein	TF3034	conserved hypothetical protein	->->	3259044	3259252	209	36.8%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
920	TF3034	conserved hypothetical protein	TF3035	aldose 1-epimerase	->->	3260495	3260677	183	32.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
921	TF3037	galactokinase	TF3038	conserved hypothetical protein	->->	3264327	3264470	144	31.2%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
922	TF3043	conserved hypothetical protein	TF3044	two-component system sensor kinase	->->	3272470	3272830	361	38.8%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
923	TF3045	two-component system response regulator	TF3046	hypothetical protein	->->	3274694	3275087	394	36%	0	0	0	+: 0/3/0 \| -: 0/0/0	1	0	0	0	Result
926	TF3051	conserved hypothetical protein	TF3052	conserved hypothetical protein	->->	3278128	3278462	335	41.2%	0	0	3	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
927	TF3055	hypothetical protein	TF3056	conserved hypothetical protein	->->	3279095	3279583	489	32.9%	0	2	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
928	TF3058	conserved hypothetical protein	TF3059	conserved hypothetical protein	->->	3282102	3282218	117	24.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
929	TF3062	conserved hypothetical protein	TF3063	ferredoxin-type protein	->->	3288173	3288318	146	24.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
930	TF3064	oxidoreductase, aldo/keto reductase family	TF3065	enolase	->->	3291045	3291194	150	41.3%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
931	TF3068	flavodoxin A	TF3069	hypothetical protein	->->	3293444	3293642	199	33.2%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
932	TF3077	tonB-dependent receptor HmuY	TF3078	ribonucleoside diphosphate reductase, alpha subunit	->->	3305827	3306748	922	37.5%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
933	TF3079	ribonucleoside-diphosphate reductase 1, beta subunit	TF3080	conserved hypothetical protein	->->	3310374	3310619	246	30.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
936	TF3082	conserved hypothetical protein	TF3083	hypothetical protein	->->	3317399	3317516	118	22%	0	0	0	+: 0/0/0 \| -: 0/0/0	2	0	0	0	Result
937	TF3084	conserved hypothetical protein	TF3085	hypothetical protein	->->	3318703	3318820	118	22%	0	0	0	+: 0/0/0 \| -: 0/0/0	2	0	0	0	Result
939	TF3092	30S ribosomal protein S9	TF3093	30S ribosomal protein S2	->->	3325240	3325383	144	36.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
940	TF3094	translation elongation factor Ts	TF3095	ABC transporter, ATP-binding protein	->->	3327084	3327220	137	33.6%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
941	TF3099	conserved hypothetical protein	TF3100	conserved hypothetical protein	->->	3331168	3331324	157	39.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
942	TF3101	hypothetical protein	TF3102	hypothetical protein	->->	3332720	3332825	106	33%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
943	TF3104	outer membrane protein, TonB dependent receptor	TF3105	hypothetical protein	->->	3337511	3338207	697	38.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	8	0	0	0	Result
944	TF3114	hypothetical protein	TF3115	possible sugar kinase	->->	3350399	3350567	169	34.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
945	TF3115	possible sugar kinase	TF3116	conserved hypothetical protein	->->	3352086	3352275	190	26.8%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
946	TF3119	conserved hypothetical protein	TF3120	HD superfamily hydrolase	->->	3353193	3353308	116	35.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
947	TF3120	HD superfamily hydrolase	TF3121	nicotinate phosphoribosyltransferase	->->	3354836	3354954	119	35.3%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
951	TF3140	Na+-translocating NADH-quinone reductase, subunit B	TF3141	NADH: ubiquinone oxidoreductase, subunit A	->->	3374634	3374806	173	45.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
952	TF3141	NADH: ubiquinone oxidoreductase, subunit A	TF3142	conserved hypothetical protein	->->	3376328	3376496	169	43.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
953	TF3143	conserved hypothetical protein; possible membrane protein	TF3144	phosphomannomutase/phosphoglucomutase	->->	3379288	3379495	208	37.5%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
954	TF3144	phosphomannomutase/phosphoglucomutase	TF3145	conserved hypothetical protein; possible GTP cyclohydrolase I family	->->	3381245	3381393	149	49.7%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
955	TF3145	conserved hypothetical protein; possible GTP cyclohydrolase I family	TF3146	GTP-binding protein Obg	->->	3381883	3381991	109	40.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
956	TF3148	hypoxanthine-guanine phosphoribosyltransferase	TF3149	conserved hypothetical protein	->->	3384332	3384563	232	41.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
958	TF3163	conserved hypothetical protein	TF3164	hypothetical protein	->->	3403778	3404036	259	29%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
Total:										0	17	0/28		795	23