CDS GC%: 46.8% tRNA GC%: 55.2% rRNA GC%: 51.6%
| IGS# | Up stream Locus | Up stream Product | Down Stream Locus | Down Stream Product | Gene Dir type | Start | End | IGS Len | GC% | IS NT | IS AA | NR | PT-Pair | Intra Spp. IGS | Inter Spp. IGS | Conserved Inter-spp IGS Start | Conserved Inter-spp IGS End | Blast Result | Conserved IGS Seq |
| 1 | TF3165 | thiol:disulfide interchange protein, thioredoxin family protein | TF0001 | hypothetical protein | ->-> | 1 | 3405543 | 163 | 46.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 4 | TF0011 | conserved hypothetical protein | TF0012 | conserved hypothetical protein | ->-> | 5458 | 5651 | 194 | 33% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 5 | TF0018 | hypothetical protein | TF0019 | heat shock protein ClpB | ->-> | 12152 | 12589 | 438 | 46.8% | 0 | 0 | 0 | +: 0/3/0 | -: 0/1/0 | 10 | 0 | 0 | 0 | Result | |
| 6 | TF0019 | heat shock protein ClpB | TF0020 | possible glycoprotein endopeptidase | ->-> | 15176 | 15372 | 197 | 37.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 7 | TF0021 | outer membrane phospholipase A | TF0022 | two-component system sensor histidine kinase | ->-> | 16980 | 17434 | 455 | 41.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 11 | 1 | 240 | 346 | Result | atattactatgtatttaatgacaccaacagcggtgtatggataaaggtaaaccaaagaaactgtgtgtattacaggtttgagataactgcgtacttgtggcgtcgat |
| 8 | TF0024 | conserved hypothetical protein; possible ATPase | TF0025 | hypothetical protein | ->-> | 21687 | 21798 | 112 | 37.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 9 | TF0027 | conserved hypothetical protein | TF0028 | hypothetical protein | ->-> | 24260 | 24388 | 129 | 41.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 10 | TF0029 | hypothetical protein | TF0030 | N-acetylneuraminate lyase | ->-> | 25123 | 25909 | 787 | 40.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 28 | 0 | 0 | 0 | Result | |
| 11 | TF0038 | conserved hypothetical protein | TF0039 | conserved hypothetical protein | ->-> | 41274 | 41546 | 273 | 39.2% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 12 | TF0045 | outer membrane protein, TonB dependent receptor | TF0046 | thiamin biosynthesis lipoprotein, ApbE | ->-> | 52151 | 52661 | 511 | 40.9% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 13 | TF0046 | thiamin biosynthesis lipoprotein, ApbE | TF0047 | hypothetical protein | ->-> | 53838 | 53983 | 146 | 37% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 14 | TF0054 | possible flavodoxin | TF0055 | integrase fragment, N-terminal | ->-> | 58521 | 58845 | 325 | 34.2% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 15 | TF0057 | conserved hypothetical protein | TF0058 | conserved hypothetical protein | ->-> | 59808 | 59972 | 165 | 40% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 16 | TF0058 | conserved hypothetical protein | TF0059 | hypothetical protein | ->-> | 60675 | 61468 | 794 | 35.6% | 0 | 24 | 0 | +: 0/3/0 | -: 1/3/3 | 1 | 0 | 0 | 0 | Result | |
| 17 | TF0066 | conserved hypothetical protein | TF0067 | hypothetical protein | ->-> | 73182 | 73382 | 201 | 23.4% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 18 | TF0069 | conserved hypothetical protein | TF0070 | possible regulatory element | ->-> | 76942 | 77081 | 140 | 27.9% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 19 | TF0070 | possible regulatory element | TF0071 | conserved hypothetical protein | ->-> | 77796 | 78147 | 352 | 35.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 21 | TF0075 | transcriptional regulator | TF0076 | probable carbohydrate kinase, PfkB family | ->-> | 83179 | 83418 | 240 | 38.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 22 | TF0077 | hypothetical protein | TF0078 | aminopeptidase C, peptidase C1-like family | ->-> | 84552 | 84668 | 117 | 26.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 23 | TF0079 | conserved hypothetical protein | TF0080 | phosphate ABC transporter, periplasmic phosphate-binding protein | ->-> | 86334 | 86464 | 131 | 36.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 24 | TF0080 | phosphate ABC transporter, periplasmic phosphate-binding protein | TF0081 | pantothenate kinase | ->-> | 87422 | 87603 | 182 | 31.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 26 | TF0082 | transcriptional regulator, TetR family | TF0083 | outer membrane efflux protein | ->-> | 89325 | 89428 | 104 | 28.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 27 | TF0089 | conserved hypothetical protein | TF0090 | conserved hypothetical protein | ->-> | 96132 | 96424 | 293 | 31.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 28 | TF0094 | alpha-glucosidase | TF0095 | methyltransferase | ->-> | 105825 | 106032 | 208 | 27.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 29 | TF0095 | methyltransferase | TF0096 | tRNA-guanine transglycosylase (queuine tRNA-ribosyltransferase) | ->-> | 106906 | 107110 | 205 | 45.4% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 30 | TF0100 | conserved hypothetical protein | TF0103 | rubredoxin | ->-> | 111764 | 111989 | 226 | 38.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 31 | TF0103 | rubredoxin | TF0104 | redox-sensitive transcriptional activator, OxyR | ->-> | 112149 | 112426 | 278 | 28.8% | 0 | 0 | 0 | +: 1/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 32 | TF0104 | redox-sensitive transcriptional activator, OxyR | TF0105 | DNA-binding stress protein, Dps family | ->-> | 113369 | 113493 | 125 | 23.2% | 0 | 0 | 0 | +: 3/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 33 | TF0107 | ion channel protein | TF0108 | thiamine biosynthesis protein, ThiF family | ->-> | 115154 | 115307 | 154 | 31.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 34 | TF0108 | thiamine biosynthesis protein, ThiF family | TF0109 | diacylglycerol kinase | ->-> | 116061 | 116212 | 152 | 34.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 35 | TF0109 | diacylglycerol kinase | TF0110 | unsaturated glucuronyl hydrolase | ->-> | 116597 | 116971 | 375 | 36.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 36 | TF0112 | outer membrane protein | TF0113 | 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase | ->-> | 123088 | 123288 | 201 | 42.3% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 37 | TF0120 | hexouronate transporter | TF0121 | hypothetical protein | ->-> | 132872 | 133103 | 232 | 35.3% | 0 | 0 | 0 | +: 2/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 39 | TF0127 | conserved hypothetical protein | TF0128 | hypothetical protein | ->-> | 139921 | 140331 | 411 | 29.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 40 | TF0128 | hypothetical protein | TF0129 | hypothetical protein | ->-> | 140617 | 141704 | 1088 | 32.1% | 0 | 0 | 0 | +: 0/3/0 | -: 1/1/1 | 1 | 0 | 0 | 0 | Result | |
| 42 | TF0135 | hypothetical protein | TF0137 | conserved hypothetical protein | ->-> | 146615 | 146724 | 110 | 31.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 43 | TF0137 | conserved hypothetical protein | TF0139 | 4-diphosphocytidyl-2c-methyl-D-erythritol synthase (MEP cytidylyltransferase) (MCT) | ->-> | 147301 | 147666 | 366 | 38.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 44 | TF0145 | glutamine synthetase | TF0146 | glutamine-dependent NAD(+) synthetase | ->-> | 154779 | 154994 | 216 | 45.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 4 | 0 | 0 | 0 | Result | |
| 46 | TF0152 | RNA polymerase ECF-type sigma factor | TF0153 | conserved hypothetical protein | ->-> | 162743 | 162877 | 135 | 25.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 48 | TF0170 | possible CRISPR-associated protein Cas2 | TF0171 | hypothetical protein | ->-> | 179967 | 180085 | 119 | 31.1% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 50 | TF0175 | hypothetical protein | TF0176 | hypothetical protein | ->-> | 185968 | 186659 | 692 | 36.3% | 0 | 47 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 51 | TF0176 | hypothetical protein | TF0177 | hypothetical protein | ->-> | 186840 | 187064 | 225 | 40% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 52 | TF0177 | hypothetical protein | TF0178 | ferritin | ->-> | 187215 | 187752 | 538 | 32.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 53 | TF0178 | ferritin | TF0179 | pyrophosphate-energized proton pump | ->-> | 188284 | 188552 | 269 | 46.5% | 0 | 0 | 0 | +: 0/2/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 54 | TF0179 | pyrophosphate-energized proton pump | TF0180 | carboxynorspermidine decarboxylase | ->-> | 190752 | 191406 | 655 | 40% | 0 | 0 | 0 | +: 0/1/0 | -: 1/1/1 | 19 | 0 | 0 | 0 | Result | |
| 55 | TF0181 | ATP-dependent DNA helicase | TF0182 | DNA-binding protein, HU-related | ->-> | 194924 | 195318 | 395 | 31.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 56 | TF0182 | DNA-binding protein, HU-related | TF0184 | dihydroneopterin aldolase | ->-> | 195589 | 195768 | 180 | 37.8% | 0 | 0 | 0 | +: 0/1/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
| 57 | TF0186 | ribonucleotide reductase, alpha subunit | TF0187 | ferredoxin | ->-> | 201873 | 202290 | 418 | 33.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 58 | TF0187 | ferredoxin | TF0188 | membrane-associated porT protein | ->-> | 202459 | 202598 | 140 | 22.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 61 | TF0199 | conserved hypothetical protein | TF0200 | 2-nitropropane dioxygenase | ->-> | 224125 | 225200 | 1076 | 39.1% | 0 | 27 | 0 | +: 0/2/0 | -: 1/3/2 | 1 | 0 | 0 | 0 | Result | |
| 62 | TF0202 | folylpolyglutamate synthase | TF0203 | PhoH-like protein | ->-> | 229165 | 229394 | 230 | 28.7% | 0 | 0 | 0 | +: 2/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 63 | TF0206 | conserved hypothetical protein | TF0207 | conserved hypothetical protein | ->-> | 233054 | 233244 | 191 | 41.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 67 | TF0215 | tRNA/rRNA methyltransferase, TrmH family | TF0216 | 50S ribosomal protein L20 | ->-> | 242395 | 242615 | 221 | 33.5% | 0 | 0 | 0 | +: 0/1/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
| 68 | TF0219 | threonyl-tRNA synthetase | TF0220 | conserved hypothetical protein | ->-> | 245939 | 246369 | 431 | 34.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 69 | TF0225 | iron-containing alcohol dehydrogenase | TF0227 | transcriptional regulator, Crp/Fnr family | ->-> | 252799 | 252959 | 161 | 34.8% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 70 | TF0228 | probable integral outer membrane protein | TF0229 | beta-galactosidase | ->-> | 254870 | 254996 | 127 | 45.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 71 | TF0234 | 5,10-methylenetetrahydrofolate reductase | TF0235 | hypothetical protein | ->-> | 261573 | 261705 | 133 | 37.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 72 | TF0236 | multidrug resistance protein | TF0237 | outer membrane protein, TonB dependent receptor | ->-> | 263275 | 263808 | 534 | 25.8% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 73 | TF0246 | saccharopine dehydrogenase | TF0247 | conserved hypothetical protein | ->-> | 277591 | 277718 | 128 | 27.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 74 | TF0254 | hypothetical protein | TF0255 | conserved hypothetical protein | ->-> | 285745 | 285946 | 202 | 33.2% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 1 | 1 | 181 | Result | taaataactcctctggattaccttgtagaactcttggaattctctgggcaaagtatttctattttccaaggggctttaactaattcagaattgaaatataaatagctaaggagtattttattatgttacatactccaactgttttatactccaactgtttttgtaaagaaatttctccgtt |
| 75 | TF0256 | conserved hypothetical protein | TF0257 | hypothetical protein | ->-> | 287649 | 287749 | 101 | 42.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 76 | TF0258 | hypothetical protein | TF0259 | conserved hypothetical protein | ->-> | 289595 | 289889 | 295 | 40.7% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 78 | TF0260 | conserved hypothetical protein | TF0261 | conserved hypothetical protein | ->-> | 291655 | 291923 | 269 | 39% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 81 | TF0266 | conserved hypothetical protein | TF0267 | conserved hypothetical protein | ->-> | 295795 | 295942 | 148 | 31.8% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 84 | TF0272 | outer membrane protein | TF0273 | DNA polymerase III, epsilon chain | ->-> | 299788 | 299908 | 121 | 34.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 85 | TF0274 | hypothetical protein | TF0276 | hypothetical protein | ->-> | 300549 | 300823 | 275 | 29.5% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 86 | TF0279 | conserved hypothetical protein | TF0280 | hypothetical protein | ->-> | 308740 | 308946 | 207 | 55.1% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 87 | TF0294 | possible translation factor | TF0296 | hypothetical protein | ->-> | 321963 | 322080 | 118 | 44.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 88 | TF0297 | RNA polymerase sigma-70 factor, ECF subfamily | TF0298 | dipeptidase | ->-> | 322977 | 323266 | 290 | 34.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 89 | TF0301 | outer membrane protein, TonB dependent receptor | TF0303 | conserved hypothetical protein | ->-> | 328237 | 328470 | 234 | 37.2% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 90 | TF0305 | peptidyl-prolyl cis-trans isomerase | TF0306 | transglutaminase-like enzyme/cysteine protease | ->-> | 331173 | 331372 | 200 | 34% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 91 | TF0306 | transglutaminase-like enzyme/cysteine protease | TF0307 | conserved hypothetical protein | ->-> | 332810 | 332922 | 113 | 41.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 92 | TF0308 | hypothetical protein | TF0309 | conserved hypothetical protein | ->-> | 334143 | 334313 | 171 | 45.6% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 93 | TF0311 | conserved hypothetical protein | TF0312 | outer membrane protein | ->-> | 336444 | 336612 | 169 | 37.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 94 | TF0315 | hypothetical protein | TF0317 | conserved hypothetical protein | ->-> | 341560 | 341725 | 166 | 28.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 95 | TF0318 | outer membrane protein, TonB dependent receptor | TF0319 | tolB protein | ->-> | 344362 | 344678 | 317 | 33.4% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 96 | TF0319 | tolB protein | TF0320 | dihydroorotase | ->-> | 345798 | 346201 | 404 | 28.7% | 0 | 0 | 0 | +: 1/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
| 97 | TF0321 | glycosyltransferase | TF0322 | possible YngK protein | ->-> | 348358 | 348484 | 127 | 33.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 98 | TF0323 | NAD-dependent epimerase/dehydratase family protein | TF0324 | conserved hypothetical protein | ->-> | 351114 | 351367 | 254 | 45.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 99 | TF0339 | hypothetical protein | TF0340 | hypothetical protein | ->-> | 363808 | 364032 | 225 | 52.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 18 | 0 | 0 | 0 | Result | |
| 100 | TF0340 | hypothetical protein | TF0341 | conserved hypothetical protein | ->-> | 364318 | 364487 | 170 | 45.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
| 101 | TF0344 | hypothetical protein | TF0346 | hypothetical protein | ->-> | 367024 | 367187 | 164 | 51.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 6 | 0 | 0 | 0 | Result | |
| 102 | TF0346 | hypothetical protein | TF0347 | possible serine protease | ->-> | 367377 | 367681 | 305 | 46.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 6 | 0 | 0 | 0 | Result | |
| 103 | TF0347 | possible serine protease | TF0348 | hypothetical protein | ->-> | 369605 | 370069 | 465 | 35.9% | 0 | 0 | 0 | +: 1/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 104 | TF0349 | hypothetical protein | TF0350 | hypothetical protein | ->-> | 370780 | 370933 | 154 | 42.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 7 | 0 | 0 | 0 | Result | |
| 107 | TF0358 | hypothetical protein | TF0359 | conserved hypothetical protein | ->-> | 376365 | 377082 | 718 | 43.5% | 0 | 0 | 0 | +: 0/4/0 | -: 0/0/0 | 20 | 0 | 0 | 0 | Result | |
| 108 | TF0361 | hypothetical protein | TF0362 | hypothetical protein | ->-> | 379871 | 380091 | 221 | 46.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 9 | 0 | 0 | 0 | Result | |
| 109 | TF0362 | hypothetical protein | TF0364 | ysyl endopeptidase | ->-> | 380260 | 380534 | 275 | 47.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 5 | 0 | 0 | 0 | Result | |
| 110 | TF0365 | hypothetical protein | TF0366 | hypothetical protein | ->-> | 383213 | 383703 | 491 | 44.2% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 11 | 0 | 0 | 0 | Result | |
| 111 | TF0366 | hypothetical protein | TF0367 | eukaryotic-like metalloproteinase | ->-> | 383872 | 384146 | 275 | 47.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 5 | 0 | 0 | 0 | Result | |
| 112 | TF0367 | eukaryotic-like metalloproteinase | TF0368 | hypothetical protein | ->-> | 385365 | 385540 | 176 | 30.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 113 | TF0368 | hypothetical protein | TF0369 | hypothetical protein | ->-> | 385895 | 386072 | 178 | 38.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 114 | TF0370 | hypothetical protein | TF0371 | beta-mannosidase precursor | ->-> | 386378 | 386902 | 525 | 45.3% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 4 | 0 | 0 | 0 | Result | |
| 115 | TF0371 | beta-mannosidase precursor | TF0372 | transcriptional regulator | ->-> | 390530 | 390677 | 148 | 33.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 116 | TF0377 | FtsK/SpoIIIE family cell division protein | TF0378 | aspartyl-tRNA synthetase | ->-> | 397529 | 397780 | 252 | 36.1% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 118 | TF0381 | cell cycle protein | TF0382 | transcription termination factor | ->-> | 403089 | 403314 | 226 | 35.4% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 119 | TF0382 | transcription termination factor | TF0384 | conserved hypothetical protein | ->-> | 405289 | 405516 | 228 | 40.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 120 | TF0383 | alkyl hydroperoxide reductase, subunit C | TF0385 | conserved hypothetical protein | ->-> | 406117 | 406350 | 234 | 37.6% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 121 | TF0386 | transcriptional regulator, possible LuxR family | TF0387 | hypothetical protein | ->-> | 407640 | 407751 | 112 | 34.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 122 | TF0390 | conserved hypothetical protein | TF0391 | hypothetical protein | ->-> | 410129 | 410570 | 442 | 34.6% | 0 | 8 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 123 | TF0391 | hypothetical protein | TF0393 | conserved hypothetical protein | ->-> | 412149 | 412423 | 275 | 31.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 124 | TF0392 | hypothetical protein | TF0394 | oxaloacetate decarboxylase, alpha subunit (pyruvate carboxylase, C-terminal domain) | ->-> | 413006 | 413407 | 402 | 36.8% | 0 | 0 | 0 | +: 0/2/0 | -: 0/4/0 | 1 | 0 | 0 | 0 | Result | |
| 125 | TF0394 | oxaloacetate decarboxylase, alpha subunit (pyruvate carboxylase, C-terminal domain) | TF0395 | L-lactate permease | ->-> | 415310 | 415555 | 246 | 26.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 126 | TF0399 | hypothetical protein | TF0401 | hypothetical protein | ->-> | 421268 | 421482 | 215 | 31.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 127 | TF0410 | 8-amino-7-oxononanoate synthase | TF0411 | methyltransferase | ->-> | 428930 | 429056 | 127 | 37% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 128 | TF0412 | conserved hypothetical protein | TF0413 | succinyl-diaminopimelate desuccinylase | ->-> | 430424 | 430573 | 150 | 34% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 129 | TF0419 | conserved hypothetical protein | TF0421 | alpha-L-fucosidase | ->-> | 435855 | 436160 | 306 | 41.5% | 0 | 0 | 0 | +: 0/3/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 132 | TF0425 | outer membrane protein | TF0426 | conserved hypothetical protein | ->-> | 444766 | 444867 | 102 | 45.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 133 | TF0428 | methylmalonyl-CoA mutase, beta subunit | TF0429 | ABC transporter, ATP-binding protein | ->-> | 450094 | 450316 | 223 | 37.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 134 | TF0431 | hypothetical protein | TF0432 | 3-deoxy-manno-octulosonate cytidylyltransferase | ->-> | 452531 | 452670 | 140 | 40% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 135 | TF0434 | CTP synthetase (UTP ammonia ligase) | TF0435 | DNA mismatch repair protein | ->-> | 457088 | 457321 | 234 | 40.6% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 136 | TF0435 | DNA mismatch repair protein | TF0436 | conserved hyothetical protein | ->-> | 459125 | 459346 | 222 | 39.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 137 | TF0436 | conserved hyothetical protein | TF0437 | conserved hypothetical protein | ->-> | 460889 | 461062 | 174 | 35.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 138 | TF0447 | hypothetical protein | TF0448 | hypothetical protein | ->-> | 467655 | 467803 | 149 | 31.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 140 | TF0465 | cobalamin biosynthesis protein | TF0466 | amidophosphoribosyltransferase | ->-> | 483974 | 484133 | 160 | 38.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 141 | TF0467 | acetyltransferase-related protein | TF0468 | hypothetical protein | ->-> | 486604 | 487068 | 465 | 47.7% | 0 | 0 | 0 | +: 0/4/0 | -: 0/0/0 | 29 | 0 | 0 | 0 | Result | |
| 142 | TF0469 | hypothetical protein | TF0470 | hypothetical protein | ->-> | 487289 | 487392 | 104 | 31.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 143 | TF0474 | outer membrane efflux protein | TF0475 | possible transcriptional regulator, AraC family | ->-> | 493723 | 493868 | 146 | 30.1% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 144 | TF0475 | possible transcriptional regulator, AraC family | TF0476 | conserved hypothetical protein | ->-> | 494886 | 495083 | 198 | 43.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 5 | 0 | 0 | 0 | Result | |
| 145 | TF0480 | ornithine carbamoyltransferase | TF0481 | possible anti-sigma factor | ->-> | 499650 | 499873 | 224 | 33.5% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 2 | 0 | 0 | 0 | Result | |
| 147 | TF0489 | D-xylose-proton symporter | TF0490 | conserved hypothetical protein | ->-> | 513130 | 513673 | 544 | 36.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 2 | 0 | 0 | 0 | Result | |
| 148 | TF0496 | conserved hypothetical protein | TF0497 | conserved hypothetical protein | ->-> | 523930 | 524197 | 268 | 50.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 149 | TF0498 | hypothetical protein | TF0499 | hypothetical protein | ->-> | 526016 | 526396 | 381 | 38.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 150 | TF0499 | hypothetical protein | TF0500 | hypothetical protein | ->-> | 526712 | 526827 | 116 | 41.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 151 | TF0500 | hypothetical protein | TF0501 | conserved hypothetical protein, HicB-related | ->-> | 526984 | 527088 | 105 | 32.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 153 | TF0515 | conserved hypothetical protein | TF0516 | conserved hypothetical protein; possible membrane protein | ->-> | 539636 | 539823 | 188 | 28.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 154 | TF0518 | glutaminyl-tRNA synthetase | TF0519 | thiamine monophosphate kinase | ->-> | 543620 | 543839 | 220 | 35.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 155 | TF0522 | hypothetical protein | TF0524 | possible cation efflux pump (multidrug resistance protein) | ->-> | 547934 | 548045 | 112 | 31.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 156 | TF0525 | conserved hypothetical protein | TF0527 | prolyl endopeptidase | ->-> | 549645 | 549811 | 167 | 46.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 157 | TF0527 | prolyl endopeptidase | TF0528 | two-component system sensor histidine kinase | ->-> | 552011 | 552496 | 486 | 47.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 4 | 73 | 265 | Result | aaggggctgaccggttttgacagcgggcagaagtggtttgtaagcatgcagtgcgtcgttggccggcactttaatctcggttgatccaattttaactggcgaaaataactacgctctcgctgcttaatcgaagcacagtagattgaagcttaatccttacacaaggtgtttggacgagacatcacccggaagc |
| 158 | TF0530 | hypothetical protein with TPR domain | TF0531 | hypothetical protein | ->-> | 556920 | 557202 | 283 | 32.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 159 | TF0531 | hypothetical protein | TF0532 | hypothetical protein | ->-> | 557530 | 557648 | 119 | 32.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 161 | TF0535 | surface antigen BspA | TF0536 | conserved hypothetical protein | ->-> | 561762 | 562056 | 295 | 43.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 162 | TF0537 | conserved hypothetical protein | TF0539 | hypothetical protein | ->-> | 566897 | 567023 | 127 | 56.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 163 | TF0538 | hypothetical protein | TF0540 | conserved hypothetical protein; possible surface protein | ->-> | 567196 | 567425 | 230 | 42.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 4 | 0 | 0 | 0 | Result | |
| 164 | TF0541 | conserved hypothetical protein | TF0542 | hypothetical protein | ->-> | 571919 | 572057 | 139 | 49.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 165 | TF0546 | conserved hypothetical protein | TF0547 | DNA gyrase subunit A (topoisomerase) | ->-> | 577366 | 577667 | 302 | 28.8% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 167 | TF0550 | stationary-phase-upregulated protein, UstA | TF0551 | possible membrane-associated phospholipid phosphatase | ->-> | 582985 | 583123 | 139 | 30.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 168 | TF0559 | methanol dehydrogenase regulator, MoxR-like; magnesium chelatase, subunit I | TF0560 | DNA-binding protein | ->-> | 592148 | 592303 | 156 | 26.3% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 169 | TF0563 | signal recognition particle-docking protein FtsY | TF0564 | conserved hypothetical protein | ->-> | 596304 | 596562 | 259 | 34% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 170 | TF0566 | hypothetical protein | TF0567 | conserved hypothetical protein; possible periplasmic solute-binding protein | ->-> | 598919 | 599129 | 211 | 28% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 171 | TF0569 | indolepyruvate ferredoxin oxidoreductase, beta subunit | TF0570 | possible transcriptional regulator | ->-> | 602439 | 602622 | 184 | 27.7% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 172 | TF0570 | possible transcriptional regulator | TF0571 | hypothetical protein | ->-> | 603088 | 603441 | 354 | 22% | 0 | 0 | 0 | +: 2/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 173 | TF0572 | hypothetical protein | TF0573 | DNA polymerase III, delta subunit | ->-> | 603691 | 603889 | 199 | 36.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 174 | TF0576 | hypothetical protein | TF0577 | possible endo-1,4-beta-xylanase B | ->-> | 606997 | 607114 | 118 | 37.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 175 | TF0578 | ribonuclease G | TF0579 | DNA-binding protein HU | ->-> | 609651 | 609863 | 213 | 29.1% | 0 | 0 | 0 | +: 0/3/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 176 | TF0579 | DNA-binding protein HU | TF0580 | A/G-specific adenine glycosylase | ->-> | 610185 | 610301 | 117 | 22.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 177 | TF0584 | phosphopantetheinyl transferase | TF0585 | conserved hypothetical protein | ->-> | 614516 | 614921 | 406 | 33.7% | 0 | 0 | 0 | +: 0/0/0 | -: 3/0/0 | 1 | 0 | 0 | 0 | Result | |
| 178 | TF0585 | conserved hypothetical protein | TF0586 | conserved hypothetical protein | ->-> | 616824 | 617452 | 629 | 42.3% | 0 | 0 | 0 | +: 0/4/0 | -: 0/1/0 | 21 | 0 | 0 | 0 | Result | |
| 179 | TF0588 | outer membrane protein | TF0589 | anti-sigma factor | ->-> | 623481 | 623685 | 205 | 33.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 180 | TF0596 | conserved hypothetical protein | TF0597 | hypothetical protein | ->-> | 628713 | 628927 | 215 | 40.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 181 | TF0598 | hypothetical protein | TF0599 | hypothetical protein | ->-> | 629561 | 629974 | 414 | 38.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 3 | 0 | 0 | 0 | Result | |
| 184 | TF0603 | glycosyltransferase | TF0604 | hypothetical protein | ->-> | 634899 | 635524 | 626 | 43.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 14 | 0 | 0 | 0 | Result | |
| 185 | TF0608 | isoleucyl-tRNA synthetase | TF0609 | conserved hypothetical protein | ->-> | 641479 | 641805 | 327 | 35.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 186 | TF0611 | lysine decarboxylase | TF0610 | conserved hypothetical protein; possible phosphatidylglycerophosphate synthase | ->-> | 643424 | 643599 | 176 | 39.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 187 | TF0610 | conserved hypothetical protein; possible phosphatidylglycerophosphate synthase | TF0612 | conserved hypothetical protein | ->-> | 644104 | 644205 | 102 | 45.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 188 | TF0613 | conserved hypothetical protein | TF0614 | UDP-glucose 6-dehydrogenase/UDP-N-acetyl-D-mannosaminuronate dehydrogenase | ->-> | 647482 | 647660 | 179 | 37.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 190 | TF0624 | Xaa-Pro dipeptidase (aminopeptidase P) | TF0625 | hypothetical protein | ->-> | 661076 | 661282 | 207 | 42.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 191 | TF0631 | hypothetical protein | TF0632 | hypothetical protein | ->-> | 667687 | 667791 | 105 | 31.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 192 | TF0633 | hypothetical protein | TF0635 | glucosylceramidase precursor | ->-> | 669233 | 669360 | 128 | 28.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 193 | TF0638 | GTP-binding protein LepA | TF0639 | hypothetical protein | ->-> | 677344 | 678016 | 673 | 43.1% | 0 | 0 | 0 | +: 0/2/0 | -: 0/3/0 | 2 | 0 | 0 | 0 | Result | |
| 194 | TF0643 | probable tRNA methyltransferase | TF0644 | pyruvate phosphate dikinase | ->-> | 685751 | 685923 | 173 | 26% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 195 | TF0644 | pyruvate phosphate dikinase | TF0645 | hypothetical protein | ->-> | 688642 | 688812 | 171 | 32.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 196 | TF0646 | conserved hypothetical protein; possible adenylate cyclase | TF0647 | hypothetical protein | ->-> | 689856 | 689983 | 128 | 28.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 197 | TF0652 | conserved hypothetical protein | TF0653 | hypothetical protein | ->-> | 696583 | 696683 | 101 | 37.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 198 | TF0655 | outer membrane protein | TF0656 | acetyltransferase, possible GNAT family | ->-> | 701968 | 702184 | 217 | 45.2% | 0 | 0 | 0 | +: 0/3/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 199 | TF0657 | conserved hypothetical protein | TF0658 | 2-amino-3-ketobutyrate coenzyme A ligase | ->-> | 703942 | 704051 | 110 | 42.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 200 | TF0658 | 2-amino-3-ketobutyrate coenzyme A ligase | TF0659 | RNA polymerase, ECF-type sigma factor | ->-> | 705240 | 705567 | 328 | 34.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 201 | TF0661 | hypothetical protein | TF0662 | hypothetical protein | ->-> | 708318 | 708455 | 138 | 44.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 3 | 0 | 0 | 0 | Result | |
| 202 | TF0666 | conserved hypothetical protein | TF0667 | conserved hypothetical protein | ->-> | 711006 | 711121 | 116 | 27.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 203 | TF0667 | conserved hypothetical protein | TF0668 | inorganic pyrophosphatase | ->-> | 712439 | 712632 | 194 | 40.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 204 | TF0668 | inorganic pyrophosphatase | TF0669 | hypothetical protein | ->-> | 713296 | 713523 | 228 | 41.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 206 | TF0671 | histidine kinase sensor protein | TF0672 | RNA polymerase sigma-70 factor, ECF subfamily | ->-> | 716404 | 716544 | 141 | 35.5% | 0 | 0 | 0 | +: 0/1/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
| 208 | TF0677 | ATP-binding protein, Mrp/Nbp35 family, involved in chromosome partitioning | TF0678 | hypothetical protein | ->-> | 721043 | 721242 | 200 | 45.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 16 | 0 | 0 | 0 | Result | |
| 210 | TF0684 | conserved hypothetical protein | TF0685 | hypothetical protein | ->-> | 730625 | 730991 | 367 | 38.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 10 | 0 | 0 | 0 | Result | |
| 211 | TF0685 | hypothetical protein | TF0686 | hypothetical protein | ->-> | 731193 | 732338 | 1146 | 48.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/3/0 | 45 | 0 | 0 | 0 | Result | |
| 212 | TF0687 | hypothetical protein | TF0688 | membrane-associated protein, possible sulfatase family | ->-> | 732738 | 732899 | 162 | 32.7% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 213 | TF0688 | membrane-associated protein, possible sulfatase family | TF0689 | hypothetical protein | ->-> | 734421 | 734558 | 138 | 35.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 214 | TF0689 | hypothetical protein | TF0690 | preprotein translocase subunit | ->-> | 735213 | 735382 | 170 | 42.4% | 0 | 0 | 0 | +: 1/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 215 | TF0693 | sigma-54 dependent transcriptional regulator | TF0694 | possible hemolysin, acyltransferase family | ->-> | 738221 | 738336 | 116 | 39.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 216 | TF0697 | glycerol-3-phosphate cytidyltransferase | TF0699 | pyridoxal phosphate biosynthetic protein | ->-> | 741326 | 741695 | 370 | 31.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 217 | TF0701 | Fe-S-cluster redox enzyme | TF0702 | possible peptidyl-prolyl isomerase | ->-> | 744983 | 745116 | 134 | 39.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 219 | TF0705 | hypothetical protein | TF0707 | conserved hypothetical protein | ->-> | 750850 | 751059 | 210 | 42.4% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 222 | TF0721 | aspartate transaminase | TF0722 | pyruvate dehydrogenase E3 component(dihydrolipoamide dehydrogenase) | ->-> | 772726 | 773012 | 287 | 33.1% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 223 | TF0723 | possible aspartate aminotransferase | TF0724 | possible transcriptional regulator | ->-> | 775685 | 775802 | 118 | 28% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 224 | TF0724 | possible transcriptional regulator | TF0725 | O-acetylhomoserine (thiol)-lyase | ->-> | 776394 | 776695 | 302 | 43.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 225 | TF0737 | hypothetical protein | TF0738 | conserved hypothetical protein | ->-> | 788637 | 788782 | 146 | 27.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
| 226 | TF0739 | hypothetical protein | TF0743 | conserved hypothetical protein | ->-> | 790329 | 790466 | 138 | 26.8% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
| 227 | TF0745 | conserved hypothetical protein | TF0744 | DNA polymerase III subunit, gamma/tau | ->-> | 791135 | 791234 | 100 | 50% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 228 | TF0748 | ATP-dependent protease La | TF0749 | protease II | ->-> | 795496 | 795701 | 206 | 43.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 229 | TF0751 | dipeptidyl peptidase IV | TF0752 | nucleotide-binding protein; MAF-like protein | ->-> | 800891 | 801080 | 190 | 36.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 230 | TF0756 | GDP-mannose dehydratase | TF0757 | 50S ribosomal protein L25; general stress protein | ->-> | 804388 | 804693 | 306 | 37.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 231 | TF0759 | heat shock protein 15, RNA-binding domain S4 | TF0761 | conserved hypothetical protein | ->-> | 806427 | 806551 | 125 | 41.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 232 | TF0761 | conserved hypothetical protein | TF0762 | chromate transport protein | ->-> | 809141 | 809263 | 123 | 26.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 233 | TF0766 | hypothetical protein | TF0767 | conserved hypothetical protein | ->-> | 812317 | 812479 | 163 | 41.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 234 | TF0770 | signal peptidase I | TF0771 | ABC transporter, ATP-binding/permease component | ->-> | 816668 | 816787 | 120 | 34.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 235 | TF0772 | conserved hypothetical protein | TF0773 | outer membrane efflux protein | ->-> | 821258 | 821357 | 100 | 29% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 236 | TF0777 | 1,4-dihydroxy-2-naphthoate octaprenyltransferase | TF0778 | outer membrane protein, TonB dependent receptor | ->-> | 827114 | 827423 | 310 | 34.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 237 | TF0779 | possible outer membrane protein | TF0780 | alpha-L-arabinofuranosidase, precursor A | ->-> | 831935 | 832083 | 149 | 45.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 238 | TF0780 | alpha-L-arabinofuranosidase, precursor A | TF0781 | serine protease inhibitor | ->-> | 834502 | 834609 | 108 | 38.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 239 | TF0786 | pyridoxal phosphate biosynthetic protein | TF0787 | possible inorganic polyphosphate; ATP-NAD kinase | ->-> | 839420 | 839531 | 112 | 28.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 240 | TF0787 | possible inorganic polyphosphate; ATP-NAD kinase | TF0788 | protein-export membrane protein | ->-> | 840405 | 840701 | 297 | 30.3% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 241 | TF0789 | preprotein translocase, secDF family | TF0790 | conserved hypothetical protein | ->-> | 843731 | 844059 | 329 | 43.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 244 | TF0793 | conserved hypothetical protein; possible AAA superfamily ATPase | TF0794 | hypothetical protein | ->-> | 851352 | 851519 | 168 | 36.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 245 | TF0795 | hypothetical protein | TF0797 | conserved hypothetical protein | ->-> | 853260 | 853435 | 176 | 43.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 3 | 0 | 0 | 0 | Result | |
| 246 | TF0800 | conserved hypothetical protein | TF0801 | transport permease | ->-> | 858566 | 858725 | 160 | 34.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 247 | TF0810 | possible outer membrane efflux protein | TF0811 | conserved hypothetical protein; posible sugar phosphate isomerase | ->-> | 869757 | 869926 | 170 | 47.1% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 248 | TF0815 | conserved hypothetical protein | TF0816 | hypothetical protein | ->-> | 874035 | 874356 | 322 | 53.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 1 | 139 | 272 | Result | gaggaaagtccgggcaacacagggcgccatccttcctaacgggaagctgtctgcgagggcagagtaacgtagcagaaaagaaccgccgcgccgtaaggcgaggtaagggtgaaaaggtgaggtaagagcttacc |
| 249 | TF0817 | ribonuclease, BN-like family | TF0818 | bifunctional protein: aspartokinase I; homoserine dehydrogenase | ->-> | 875902 | 876141 | 240 | 36.2% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 250 | TF0821 | hypothetical protein | TF0822 | hypothetical protein | ->-> | 880256 | 880626 | 371 | 51.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 18 | 0 | 0 | 0 | Result | |
| 251 | TF0827 | conserved hypothetical protein | TF0828 | hypothetical protein | ->-> | 886980 | 887229 | 250 | 42.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 10 | 0 | 0 | 0 | Result | |
| 252 | TF0828 | hypothetical protein | TF0830 | hypothetical protein | ->-> | 887569 | 887749 | 181 | 49.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 253 | TF0839 | aminopeptidasem M28 family | TF0840 | hypothetical protein | ->-> | 891590 | 891700 | 111 | 28.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 256 | TF0847 | hypothetical protein | TF0849 | hypothetical protein | ->-> | 898073 | 898230 | 158 | 29.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 257 | TF0850 | hypothetical protein | TF0851 | helicase SNF2 family | ->-> | 899001 | 899625 | 625 | 38.2% | 0 | 0 | 8 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 258 | TF0851 | helicase SNF2 family | TF0852 | transcriptional regulator, TetR family | ->-> | 903229 | 903385 | 157 | 35% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 259 | TF0862 | conserved hypothetical protein fragment | TF0864 | O-succinylbenzoate--CoA ligase | ->-> | 914520 | 914709 | 190 | 52.6% | 0 | 0 | 0 | +: 0/4/0 | -: 0/0/0 | 2 | 3 | 9 | 186 | Result | ttttgccgaggacgacgtattgttccggttaggacgaccctccgtctgttttaggtcgtcctaatcgttctgttaggtcgacctaaatgctccgcaaggtcgaccttaccggccgtttaggtcgaccttactttttgtcggggtcggcgtgtgtggtttattgtctcgtagtgtgcag |
| 260 | TF0869 | conserved hypothetical protein; possible transcriptional regulator | TF0870 | conserved hypothetical protein | ->-> | 922075 | 922265 | 191 | 23.6% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 1 | 1 | 188 | Result | gtgcctatttatatcggcaaatatactccaaataaatgaaaatattttttgcgataggatttattaaaagataaattccgatttgtcaatccgataatctttatttcgatatatatagttatcttattttgtttatgataaccccaataaataaagatatgcttttaaccgttttatttctatttcat |
| 265 | TF0880 | conserved hypothetical protein | TF0881 | conserved hypothetical protein | ->-> | 934432 | 934598 | 167 | 46.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 266 | TF0882 | hypothetical protein | TF0883 | hypothetical protein | ->-> | 936602 | 937274 | 673 | 35.8% | 0 | 0 | 0 | +: 0/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
| 267 | TF0883 | hypothetical protein | TF0884 | hypothetical protein | ->-> | 937533 | 937742 | 210 | 51.4% | 0 | 0 | 0 | +: 0/5/0 | -: 0/0/0 | 2 | 3 | 1 | 210 | Result | taaagagaaacgagagaaacgcaatcggcatttctctcgttttgcaaagacgacgtgccgctccggttaggacgaccttccgtccgttttaggtcgacctaaccgctctgtaaggacgacctatttgctccgtaaggtcgacctaaacgctcggttaggtcgacctgactttctgtcagggtcgacgtatgcggtttattccctcgtagt |
| 269 | TF0891 | hypothetical protein | TF0892 | conserved hypothetical protein | ->-> | 940856 | 940975 | 120 | 30% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 1 | 3 | 107 | Result | atagttttgagtgcattctttatctttgagtataatctccgaaatgcaatcatttgaaaattagcaacttgtattttctcgaaatttttgatgcggttgccctgt |
| 270 | TF0892 | conserved hypothetical protein | TF0893 | conserved hypothetical protein | ->-> | 941420 | 941893 | 474 | 36.7% | 0 | 0 | 0 | +: 1/1/1 | -: 1/1/1 | 1 | 0 | 0 | 0 | Result | |
| 272 | TF0894 | conserved hypothetical protein | TF0895 | hypothetical protein | ->-> | 943836 | 944594 | 759 | 32.9% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 273 | TF0896 | hypothetical protein | TF0897 | hypothetical protein | ->-> | 945274 | 945498 | 225 | 38.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 274 | TF0898 | hypothetical protein | TF0899 | hypothetical protein | ->-> | 945791 | 945919 | 129 | 31% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 275 | TF0899 | hypothetical protein | TF0901 | conserved hypothetical protein | ->-> | 946220 | 946820 | 601 | 31.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 7 | 0 | 0 | 0 | Result | |
| 276 | TF0904 | conserved hypothetical protein | TF0906 | conserved hypothetical protein | ->-> | 949217 | 949814 | 598 | 44.1% | 0 | 0 | 0 | +: 0/4/0 | -: 0/1/0 | 2 | 1 | 1 | 511 | Result | acctttttcttattatttgagtttacaaaactatacaagtggaatatcgtttgcaatcgccaatagtggctattttcacagtccggaatccctatttcttagggtttgtcgattcgtcaatcagtaactcatatcctcaaaattcaacctttaataatctgtttggcattggctctctgccggattgcgacccatcgcatgaagggattttgatgtgtcgggacgacctgtcatctgcattaggacgacctgttatttgttttaggtcgacctaatcgttcagttaggtcgacctaaacagtctgtaaggacgacgtaaacggtctgcaaggtcgacctaaacggcctgtaaggtcgacctaacattcatgtaaggacgacctgactttctgccggggtctttttgcacatcgtcagccttcaatacggactgtgatacattgcattatcggcagtccgggatcgaagacaacaagtggaagatttggagacggaaaagatgctcccgaaa |
| 277 | TF0908 | integrase fragment | TF0909 | Tn5520-like integrase (transfer factor) | ->-> | 951085 | 951356 | 272 | 39.7% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 279 | TF0914 | conserved hypothetical protein; possible ketosteroid isomerase-related protein | TF0915 | possible transcriptional regulator | ->-> | 955874 | 956006 | 133 | 27.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 3 | 6 | 129 | Result | tgtatttttaattgttagaaccactgcaaagttatacctttgcactacaatctgcaagtacctacaatattgtaggatacataccgtattattagatttattgattatcaagaataaaaaagtt |
| 280 | TF0919 | conserved hypothetical protein | TF0920 | conserved hypothetical protein | ->-> | 957834 | 958287 | 454 | 37.2% | 0 | 0 | 3 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 281 | TF0922 | MATE efflux family protein | TF0923 | tetracycline resistance element mobilization regulatory protein | ->-> | 961147 | 961395 | 249 | 34.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 3 | 7 | 187 | Result | tgaacttaaaagatatgattatgctaagacttactcaaacagaaaactttaagataatgctctctttttgttctacaaaagaacagatacaaaaggcgtcagacaactttatattgaaggttgttgctctatgtgatacagaagaagatactgtctcgttgtttcgtatcctccgctatac |
| 282 | TF0923 | tetracycline resistance element mobilization regulatory protein | TF0925 | hypothetical protein | ->-> | 961765 | 961875 | 111 | 47.7% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 283 | TF0925 | hypothetical protein | TF0926 | conserved hypothetical protein; possible TraB protein | ->-> | 962188 | 962574 | 387 | 40.3% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
| 284 | TF0926 | conserved hypothetical protein; possible TraB protein | TF0927 | conserved hypothetical protein; possible ATPase of the AAA superfamily | ->-> | 962998 | 963595 | 598 | 38.3% | 0 | 0 | 1 | +: 0/1/0 | -: 0/1/0 | 1 | 1 | 1 | 276 | Result | taaatccctatcttcagatgttttaaatggaactgtttttctccttgtcgtattgccctacaacaccgaagggttagcttactgagatgcggcaaacatcccacgagcagaatgttaccgaagatagagtcgggagacaggaatttgtctctttctgccgatacaaggcaaagtcctgcgaggactagtcgaacgacgaaatgtggagtgtgccctgttttatgtaaatacacctcttgcgacatttttatgctccgcaaggggcatgttcttgcc |
| 286 | TF0934 | hypothetical protein | TF0936 | subtilisin-like serine protease | ->-> | 975268 | 976007 | 740 | 37.7% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 1 | 3 | 153 | 587 | Result | agggcttaggacaaacaaggttttacggcgagaatactacctgcaatgaaatggaagtgtggagattgtcgtcgtaacggcttgccgctccgaccttttttgtccgtgaaagcccaaaactacctttgtcactgacaacgaacaaccgagcccgacatgatatacgggcataagtggaggatgtgcagggagagaagcaggacaaaacaaaaaacacagtctttaaggactcattttatcataagaatagaatacacaaaaacaaaaagctgccccaatgacggcttaaggaaaaaatcaagagagaaaattcttttttctcacgatatacctttatctttgcaacaggttattcgagttatgtaaagcgttgtatatcattacggaagataggtcgcccaatcattacctatagcattttataactcattaggc |
| 292 | TF0947 | extracellular protease | TF0948 | 50S ribosomal protein L34 | ->-> | 993611 | 993825 | 215 | 31.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 293 | TF0955 | conserved hypothetical protein | TF0957 | hypothetical protein | ->-> | 1002784 | 1002892 | 109 | 28.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 294 | TF0957 | hypothetical protein | TF0958 | conserved hypothetical protein | ->-> | 1003940 | 1004057 | 118 | 27.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 295 | TF0958 | conserved hypothetical protein | TF0959 | periplasmic protease | ->-> | 1004970 | 1005357 | 388 | 46.6% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 4 | 0 | 0 | 0 | Result | |
| 296 | TF0959 | periplasmic protease | TF0960 | beta-galactosidase | ->-> | 1008601 | 1008757 | 157 | 45.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 297 | TF0964 | conserved hypothetical protein | TF0965 | glycogen synthase | ->-> | 1013437 | 1013543 | 107 | 34.6% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 298 | TF0966 | hypothetical protein | TF0967 | alpha glycan phosphorylase | ->-> | 1015998 | 1016370 | 373 | 27.3% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 299 | TF0967 | alpha glycan phosphorylase | TF0968 | hypothetical protein | ->-> | 1018933 | 1019047 | 115 | 39.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 300 | TF0972 | conserved hypothetical protein | TF0973 | conserved hypothetical protein | ->-> | 1023271 | 1023402 | 132 | 28% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 305 | TF0983 | nitroreductase family protein, possible NADH dehydrogenase/NAD(P)H nitroreductase | TF0984 | possible mucin-desulfating sulfatase (MdsC protein) | ->-> | 1040095 | 1040398 | 304 | 43.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 4 | 0 | 0 | 0 | Result | |
| 306 | TF0986 | 50S ribosomal protein L31 | TF0985 | fructose-bisphosphate aldolase | ->-> | 1041818 | 1042040 | 223 | 29.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 307 | TF0985 | fructose-bisphosphate aldolase | TF0987 | DNA repair protein | ->-> | 1043034 | 1043229 | 196 | 40.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 308 | TF0989 | conserved hypothetical protein | TF0990 | hypothetical protein | ->-> | 1045288 | 1045534 | 247 | 45.7% | 0 | 0 | 2 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 309 | TF0993 | hypothetical protein | TF0994 | maltose O-acetyltransferase | ->-> | 1048843 | 1049266 | 424 | 41.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 310 | TF0998 | [acyl-carrier-protein] S-malonyltransferase | TF0999 | hypothetical protein | ->-> | 1053038 | 1053167 | 130 | 24.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 311 | TF1011 | cell division protein; rod shape-determining protein | TF1012 | lysyl-tRNA synthetase (lysine--tRNA ligase) | ->-> | 1068230 | 1068382 | 153 | 39.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 312 | TF1014 | glucose-6-phosphate isomerase | TF1015 | conserved hypothetical protein | ->-> | 1072535 | 1072651 | 117 | 53% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 313 | TF1015 | conserved hypothetical protein | TF1016 | 30S ribosomal protein S6 | ->-> | 1074176 | 1074290 | 115 | 35.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 314 | TF1018 | 50S ribosomal protein L9 | TF1019 | N-acetylmuramoyl-L-alanine amidase | ->-> | 1075399 | 1075506 | 108 | 29.6% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
| 315 | TF1020 | conserved hypothetical protein; possible ABC transporter permease | TF1021 | hypothetical protein | ->-> | 1077553 | 1077652 | 100 | 29% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 316 | TF1023 | ABC transporter, permease component | TF1024 | 50S ribosomal protein L19 | ->-> | 1081728 | 1082087 | 360 | 34.7% | 0 | 0 | 0 | +: 0/5/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 317 | TF1027 | hypothetical protein | TF1028 | 1-acyl-sn-glycerol-3-phosphate acyltransferase | ->-> | 1085958 | 1086076 | 119 | 21% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 318 | TF1030 | 3-oxoacyl-[acyl-carrier-protein] synthase | TF1031 | conserved hypothetical protein | ->-> | 1089593 | 1089699 | 107 | 31.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 319 | TF1033 | endothelin converting enzyme, endopeptidase | TF1034 | conserved hypothetical protein | ->-> | 1094943 | 1095202 | 260 | 40.4% | 0 | 0 | 14 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 320 | TF1044 | Mg(2)+ transport-related protein, MgtC family | TF1045 | conserved hypothetical protein | ->-> | 1107400 | 1107804 | 405 | 37.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 321 | TF1046 | hypothetical protein | TF1047 | tRNA pseudouridylate synthetase A (pseudouridylate synthase I) | ->-> | 1108507 | 1108622 | 116 | 44.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 324 | TF1057 | possible outer membrane receptor, TonB-linked | TF1058 | N-acetylglucosamine kinase | ->-> | 1125664 | 1126002 | 339 | 24.2% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
| 325 | TF1058 | N-acetylglucosamine kinase | TF1059 | possible xanthan lyase | ->-> | 1126909 | 1127320 | 412 | 34.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 326 | TF1071 | hypothetical protein | TF1072 | conserved hypothetical protein | ->-> | 1141748 | 1142530 | 783 | 36.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 6 | 0 | 0 | 0 | Result | |
| 327 | TF1075 | conserved hypothetical protein; possible lantibiotic biosynthesis protein | TF1076 | possible glycerol kinase | ->-> | 1145462 | 1145564 | 103 | 29.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 328 | TF1076 | possible glycerol kinase | TF1077 | conserved hypothetical protein | ->-> | 1145742 | 1146521 | 780 | 36.4% | 0 | 0 | 0 | +: 0/2/0 | -: 1/1/1 | 5 | 0 | 0 | 0 | Result | |
| 333 | TF1090 | hypothetical protein | TF1091 | conserved hypothetical protein | ->-> | 1159421 | 1159568 | 148 | 32.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 334 | TF1092 | glycosyltransferase | TF1093 | hypothetical protein | ->-> | 1161506 | 1162691 | 1186 | 34% | 0 | 250 | 0 | +: 0/1/0 | -: 1/0/0 | 5 | 0 | 0 | 0 | Result | |
| 335 | TF1093 | hypothetical protein | TF1094 | conserved hypothetical protein | ->-> | 1162980 | 1163215 | 236 | 19.9% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 336 | TF1096 | conserved hypothetical protein | TF1097 | hypothetical protein | ->-> | 1165418 | 1165707 | 290 | 36.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 6 | 0 | 0 | 0 | Result | |
| 337 | TF1097 | hypothetical protein | TF1098 | conserved hypothetical protein | ->-> | 1165954 | 1166059 | 106 | 26.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 339 | TF1104 | hypothetical protein | TF1105 | arylsulfatase regulator; Fe-S oxidoreductase | ->-> | 1172255 | 1172855 | 601 | 38.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 6 | 0 | 0 | 0 | Result | |
| 340 | TF1106 | conserved hypothetical protein | TF1107 | ABC transporter ATP-binding/permease component, bacteriocin/lantibiotic exporter | ->-> | 1175887 | 1176431 | 545 | 27.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 341 | TF1107 | ABC transporter ATP-binding/permease component, bacteriocin/lantibiotic exporter | TF1108 | conserved hypothetical protein; possible lipoprotein | ->-> | 1177686 | 1177954 | 269 | 33.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 342 | TF1109 | lipoprotein | TF1110 | conserved hypothetical protein | ->-> | 1180058 | 1180243 | 186 | 39.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 345 | TF1116 | conserved hypothetical protein | TF1117 | conserved hypothetical protein | ->-> | 1187003 | 1187243 | 241 | 28.6% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 346 | TF1117 | conserved hypothetical protein | TF1118 | conserved hypothetical protein | ->-> | 1189512 | 1191445 | 1934 | 35.2% | 0 | 250 | 0 | +: 0/1/0 | -: 0/1/0 | 6 | 0 | 0 | 0 | Result | |
| 347 | TF1127 | conserved hypothetical protein; possible NADPH:quinone reductase | TF1128 | possible lantibiotic biosynthesis protein (modification) | ->-> | 1202218 | 1202436 | 219 | 30.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 348 | TF1136 | glycosyltransferase | TF1137 | asparaginyl-tRNA synthetase (asparagine--tRNA ligase) | ->-> | 1212458 | 1212582 | 125 | 36% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 349 | TF1139 | adenylosuccinate lyase | TF1140 | transcriptional regulator, AraC family | ->-> | 1216728 | 1216994 | 267 | 39% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 350 | TF1140 | transcriptional regulator, AraC family | TF1141 | conserved hypothetical protein | ->-> | 1217973 | 1218111 | 139 | 30.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 351 | TF1142 | outer membrane cobalamin receptor protein | TF1143 | ABC transporter, ATP-binding/permease component | ->-> | 1221720 | 1221843 | 124 | 36.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 354 | TF1149 | conserved hypothetical protein; possible branched-chain amino acid aminotransferase | TF1150 | pyruvate-formate lyase | ->-> | 1229988 | 1230303 | 316 | 25.9% | 0 | 0 | 0 | +: 1/1/1 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 355 | TF1152 | permease, major facilitator superfamily | TF1153 | pyruvate-formate lyase-activating enzyme | ->-> | 1234679 | 1234782 | 104 | 34.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 356 | TF1153 | pyruvate-formate lyase-activating enzyme | TF1154 | RNA pseudouridylate synthetase | ->-> | 1235734 | 1235919 | 186 | 34.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 358 | TF1162 | Na+/H+ antiporter | TF1163 | two-component system response regulator | ->-> | 1242904 | 1243084 | 181 | 32.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 359 | TF1164 | two-component system sensor histidine kinase | TF1165 | conserved hypothetical protein | ->-> | 1244839 | 1245012 | 174 | 37.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 360 | TF1165 | conserved hypothetical protein | TF1166 | ABC transporter, permease component | ->-> | 1245982 | 1246293 | 312 | 45.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 362 | TF1169 | lipoprotein ABC transporter, permease component | TF1171 | ABC transporter, ATP-binding protein | ->-> | 1251634 | 1251989 | 356 | 48.3% | 0 | 0 | 0 | +: 0/3/0 | -: 0/0/0 | 6 | 0 | 0 | 0 | Result | |
| 363 | TF1172 | ABC transporter, permease component | TF1173 | ABC transporter, permease component | ->-> | 1255274 | 1255583 | 310 | 38.1% | 0 | 0 | 0 | +: 0/3/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
| 364 | TF1174 | ABC transporter, permease component | TF1175 | membrane-fusion protein | ->-> | 1257957 | 1258279 | 323 | 36.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
| 365 | TF1175 | membrane-fusion protein | TF1176 | outer membrane protein | ->-> | 1259531 | 1259694 | 164 | 34.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 366 | TF1176 | outer membrane protein | TF1177 | conserved hypothetical protein; possible ribosomal protein S1 | ->-> | 1261039 | 1261314 | 276 | 28.6% | 0 | 0 | 0 | +: 0/1/0 | -: 1/3/3 | 1 | 0 | 0 | 0 | Result | |
| 367 | TF1179 | two-component sensor histidine kinase | TF1181 | methylated-DNA--[protein]-cysteine S-methyltransferase | ->-> | 1267508 | 1267661 | 154 | 42.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 368 | TF1181 | methylated-DNA--[protein]-cysteine S-methyltransferase | TF1183 | hypothetical protein | ->-> | 1268052 | 1268530 | 479 | 43% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 13 | 0 | 0 | 0 | Result | |
| 369 | TF1182 | hypothetical protein | TF1184 | hypothetical protein | ->-> | 1268999 | 1269143 | 145 | 47.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 11 | 0 | 0 | 0 | Result | |
| 370 | TF1187 | hypothetical protein | TF1188 | conserved hypothetical protein | ->-> | 1269933 | 1270295 | 363 | 35% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 15 | 0 | 0 | 0 | Result | |
| 371 | TF1191 | possible transcriptional regulator | TF1192 | alpha-amylase | ->-> | 1274040 | 1274146 | 107 | 38.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 372 | TF1195 | hypothetical protein | TF1196 | acetyl-coenzyme A synthetase | ->-> | 1278906 | 1279203 | 298 | 39.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/5/0 | 1 | 0 | 0 | 0 | Result | |
| 373 | TF1197 | transcriptional regulator | TF1198 | conserved hypothetical protein | ->-> | 1281475 | 1281603 | 129 | 50.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 374 | TF1202 | antitermination factor, NusB family | TF1203 | L-asparaginase I | ->-> | 1285216 | 1285371 | 156 | 36.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 375 | TF1204 | possible metal-dependent membrane protease | TF1205 | beta-glucanase/beta-glucan synthetase; endoglucanase related | ->-> | 1287522 | 1287695 | 174 | 37.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 376 | TF1207 | outer membrane receptor, TonB-dependent | TF1208 | anti-sigma factor | ->-> | 1293613 | 1293735 | 123 | 24.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 377 | TF1209 | RNA polymerase ECF-type sigma factor | TF1210 | conserved hypothetical protein | ->-> | 1295441 | 1295834 | 394 | 34.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 378 | TF1210 | conserved hypothetical protein | TF1211 | phosphoserine aminotransferase | ->-> | 1298712 | 1298839 | 128 | 31.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 379 | TF1215 | haloacid dehalogenase-like hydrolase | TF1216 | possible ECF-family RNA polymerase sigma factor | ->-> | 1303277 | 1303416 | 140 | 37.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 380 | TF1218 | hypothetical protein | TF1219 | conserved hypothetical protein | ->-> | 1304444 | 1304543 | 100 | 42% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 381 | TF1219 | conserved hypothetical protein | TF1220 | conserved hypothetical protein | ->-> | 1305867 | 1306297 | 431 | 28.1% | 0 | 0 | 0 | +: 2/1/2 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
| 382 | TF1225 | conserved hypothetical protein | TF1227 | hypothetical protein | ->-> | 1313752 | 1313886 | 135 | 28.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 383 | TF1228 | conserved hypothetical protein | TF1229 | hypothetical protein | ->-> | 1314609 | 1314758 | 150 | 41.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 384 | TF1229 | hypothetical protein | TF1230 | hypothetical protein | ->-> | 1314915 | 1315044 | 130 | 33.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 386 | TF1239 | RNA polymerase ECF-type sigma factor | TF1240 | conserved hypothetical protein | ->-> | 1324281 | 1324443 | 163 | 45.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 387 | TF1242 | 3-methyl-2-oxobutanoate hydroxymethyltransferase | TF1243 | periplasmic protease | ->-> | 1327175 | 1327382 | 208 | 43.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 388 | TF1247 | alanyl-tRNA synthetase (alanine--tRNA ligase) | TF1249 | phosphoglycerate kinase (cytosolic phosphoglycerate kinase) | ->-> | 1330989 | 1331156 | 168 | 44.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 389 | TF1253 | hypothetical protein | TF1254 | conserved hypothetical protein; possible transcriptional regulator | ->-> | 1336272 | 1336387 | 116 | 26.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 390 | TF1259 | hypothetical protein | TF1260 | chaperone protein DnaJ | ->-> | 1345265 | 1345464 | 200 | 46% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 391 | TF1261 | GrpE-related chaperonin; HSP-70 cofactor | TF1262 | PDZ domain protein | ->-> | 1347253 | 1347472 | 220 | 34.5% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 394 | TF1273 | hypothetical protein | TF1274 | hypothetical protein | ->-> | 1357523 | 1357760 | 238 | 47.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 9 | 0 | 0 | 0 | Result | |
| 395 | TF1280 | electron transfer flavoprotein, beta subunit | TF1281 | 2-dehydro-3-deoxyphosphooctonate aldolase (3-deoxy-D-manno-2-octulosonate-8-phosphate synthase) (KDO-8-phosphate synthetase) (KDO 8-P synthase) | ->-> | 1365318 | 1365743 | 426 | 34.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 396 | TF1283 | hypothetical protein | TF1284 | glyceraldehyde 3-phosphate dehydrogenase | ->-> | 1367808 | 1368078 | 271 | 38% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 397 | TF1288 | hypothetical protein | TF1289 | ribosomal protein L11 methyltransferase | ->-> | 1370338 | 1370441 | 104 | 24% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 398 | TF1289 | ribosomal protein L11 methyltransferase | TF1290 | hypothetical protein | ->-> | 1371294 | 1371527 | 234 | 31.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 399 | TF1290 | hypothetical protein | TF1291 | response regulator (fimR protein) | ->-> | 1371882 | 1372098 | 217 | 39.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 2 | 0 | 0 | 0 | Result | |
| 400 | TF1292 | sensor histidine protein kinase | TF1293 | ATPase, possible AAA superfamily | ->-> | 1374615 | 1374718 | 104 | 41.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 401 | TF1294 | conserved hypothetical protein | TF1296 | possible DNA-binding protein, histone-like family | ->-> | 1378392 | 1378571 | 180 | 41.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 402 | TF1296 | possible DNA-binding protein, histone-like family | TF1297 | hypothetical protein | ->-> | 1379043 | 1379163 | 121 | 48.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 403 | TF1297 | hypothetical protein | TF1298 | possible membrane protein | ->-> | 1379584 | 1380246 | 663 | 41% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 404 | TF1302 | conserved hypothetical protein; possible tetracycline resistance element | TF1303 | conserved hypothetical protein | ->-> | 1383897 | 1384008 | 112 | 37.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 405 | TF1303 | conserved hypothetical protein | TF1304 | conserved hypothetical protein | ->-> | 1384759 | 1385147 | 389 | 43.7% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 1 | 113 | 237 | Result | gcccacaagcaggtgaaaggagcggtgaagactcctatgatgacaaagaggaggagtttgaagatatagtaaaatacccactgccagtttgttcctgcaatcattttatagggaatgaacttttc |
| 408 | TF1312 | hypothetical protein | TF1313 | conserved hypothetical protein | ->-> | 1388842 | 1389019 | 178 | 39.3% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 410 | TF1316 | conserved hypothetical protein; possible TPR-repeat-containing protein | TF1318 | outer membrane receptor | ->-> | 1393557 | 1393823 | 267 | 24% | 0 | 0 | 0 | +: 1/1/1 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 411 | TF1322 | conserved hypothetical protein; possible surface protein | TF1323 | metallo-beta-lactamase superfamily protein | ->-> | 1402628 | 1402789 | 162 | 47.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 412 | TF1327 | L-fucose permease | TF1328 | possible cytidylyltransferase | ->-> | 1407256 | 1407573 | 318 | 36.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 413 | TF1331 | outer membrane protein | TF1332 | cytochrome c-type synthesis protein (cytochrome c biogenesis protein); ABC transporter, permease | ->-> | 1410995 | 1411096 | 102 | 36.3% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 414 | TF1340 | pantoate--beta-alanine ligase | TF1341 | glycogen synthase | ->-> | 1422257 | 1422390 | 134 | 32.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 415 | TF1343 | hypothetical protein | TF1344 | conserved hypothetical protein | ->-> | 1424920 | 1425390 | 471 | 38.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 416 | TF1350 | possible transcriptional regulator | TF1351 | conserved hypothetical protein | ->-> | 1430697 | 1430907 | 211 | 38.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 417 | TF1352 | polysaccharide deacetylase-like protein | TF1353 | conserved hypothetical protein; possible penicillinase repressor | ->-> | 1432923 | 1433047 | 125 | 31.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 418 | TF1354 | TonB protein | TF1355 | serine O-acetyltransferase | ->-> | 1435277 | 1435720 | 444 | 36.3% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 419 | TF1358 | hypothetical protein | TF1359 | hypothetical protein | ->-> | 1438940 | 1439116 | 177 | 31.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 420 | TF1360 | conserved hypothetical protein | TF1361 | conserved hypothetical protein | ->-> | 1441303 | 1441587 | 285 | 29.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 421 | TF1361 | conserved hypothetical protein | TF1362 | hypothetical protein | ->-> | 1443556 | 1443798 | 243 | 23.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 422 | TF1362 | hypothetical protein | TF1363 | conserved hypothetical protein | ->-> | 1444120 | 1444222 | 103 | 37.9% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 423 | TF1369 | hypothetical protein | TF1370 | conserved hypothetical protein | ->-> | 1447647 | 1447991 | 345 | 30.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 7 | 0 | 0 | 0 | Result | |
| 427 | TF1382 | hypothetical protein | TF1384 | hypothetical protein | ->-> | 1457838 | 1458149 | 312 | 48.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 428 | TF1385 | conserved hypothetical protein | TF1386 | hypothetical protein | ->-> | 1459545 | 1460242 | 698 | 31.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 429 | TF1387 | conserved hypothetical protein | TF1388 | hypothetical protein | ->-> | 1461650 | 1461924 | 275 | 28.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 431 | TF1391 | hypothetical protein | TF1392 | conserved hypothetical protein | ->-> | 1464303 | 1464831 | 529 | 33.6% | 0 | 0 | 0 | +: 0/1/0 | -: 2/2/4 | 1 | 0 | 0 | 0 | Result | |
| 432 | TF1396 | conserved hypothetical protein | TF1397 | glucosyltransferase | ->-> | 1470461 | 1470604 | 144 | 38.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 433 | TF1401 | Holliday junction DNA helicase | TF1403 | hypothetical protein | ->-> | 1477671 | 1477914 | 244 | 38.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 434 | TF1412 | conserved hypothetical protein | TF1413 | possible transmembrane protein | ->-> | 1493317 | 1493496 | 180 | 39.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 435 | TF1416 | outer membrane protein | TF1417 | conserved hypothetical protein | ->-> | 1499474 | 1499683 | 210 | 40.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 438 | TF1436 | phosphoglycolate phosphatase | TF1437 | hypothetical protein | ->-> | 1521928 | 1522079 | 152 | 40.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 440 | TF1442 | hypothetical protein | TF1443 | hypothetical protein | ->-> | 1526669 | 1526898 | 230 | 28.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 441 | TF1444 | conserved hypothetical protein; possible hemin receptor | TF1445 | RNA polymerase sigma factor | ->-> | 1529971 | 1530187 | 217 | 35% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 442 | TF1448 | possible competence protein | TF1449 | RNA polymerase sigma factor, RpoD | ->-> | 1533111 | 1533263 | 153 | 38.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 443 | TF1449 | RNA polymerase sigma factor, RpoD | TF1450 | periplasmic serine protease | ->-> | 1534122 | 1534241 | 120 | 35% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 444 | TF1450 | periplasmic serine protease | TF1451 | conserved hypothetical protein | ->-> | 1535748 | 1536015 | 268 | 35.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 445 | TF1452 | conserved hypothetical protein; possible transglutaminase-like enzyme | TF1454 | sugar phosphate epimerase/isomerase | ->-> | 1539718 | 1539835 | 118 | 39.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 446 | TF1455 | conserved hypothetical protein | TF1456 | GMP synthase | ->-> | 1541722 | 1541829 | 108 | 38.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 447 | TF1457 | conserved hypothetical protein; possible transporter | TF1458 | conserved hypothetical protein | ->-> | 1544311 | 1544574 | 264 | 29.2% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 448 | TF1458 | conserved hypothetical protein | TF1459 | possible protease | ->-> | 1548442 | 1548573 | 132 | 38.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 449 | TF1460 | 6-phosphogluconate dehydrogenase | TF1461 | DNA-damage-inducible protein F | ->-> | 1550851 | 1550984 | 134 | 35.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 450 | TF1464 | conserved hypothetical protein | TF1465 | modulator of DNA gyrase | ->-> | 1554177 | 1554287 | 111 | 41.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 451 | TF1468 | beta-galactosidase | TF1469 | 2-methylthioadenine synthetase | ->-> | 1561312 | 1561432 | 121 | 50.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 452 | TF1469 | 2-methylthioadenine synthetase | TF1470 | phosphohydrolase, Icc family | ->-> | 1562786 | 1563283 | 498 | 31.3% | 0 | 0 | 0 | +: 1/3/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 453 | TF1473 | hypothetical protein | TF1474 | 6-phosphogluconolactonase | ->-> | 1567027 | 1567481 | 455 | 44.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 21 | 0 | 0 | 0 | Result | |
| 454 | TF1475 | glucose-6-phosphate 1-dehydrogenase | TF1476 | outer membrane protein P49 | ->-> | 1569749 | 1569862 | 114 | 50% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 455 | TF1481 | ABC transporter, ATP-binding protein | TF1482 | alpha-amylase | ->-> | 1575592 | 1576000 | 409 | 39.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 456 | TF1482 | alpha-amylase | TF1483 | glycosyltransferase family protein | ->-> | 1577933 | 1578099 | 167 | 28.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 457 | TF1483 | glycosyltransferase family protein | TF1484 | penicillin binding protein | ->-> | 1578886 | 1579698 | 813 | 47% | 0 | 0 | 0 | +: 1/0/0 | -: 0/2/0 | 32 | 0 | 0 | 0 | Result | |
| 458 | TF1485 | conserved hypothetical protein | TF1486 | hypothetical protein | ->-> | 1587603 | 1587755 | 153 | 22.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 459 | TF1490 | hypothetical protein | TF1491 | mannosyltransferase | ->-> | 1590843 | 1590992 | 150 | 41.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 460 | TF1496 | tyrosyl-tRNA synthetase | TF1497 | GTP-binding protein, Era/ThdF family | ->-> | 1596130 | 1596268 | 139 | 36.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 462 | TF1500 | conserved hypothetical protein | TF1501 | sugar hydrolase | ->-> | 1600415 | 1600567 | 153 | 26.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 463 | TF1504 | conserved hypothetical protein | TF1505 | conserved hypothetical protein | ->-> | 1610726 | 1610912 | 187 | 43.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 464 | TF1507 | outer membrane receptor, TonB-dependent | TF1508 | anti-sigma factor | ->-> | 1616329 | 1616484 | 156 | 41% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 465 | TF1508 | anti-sigma factor | TF1509 | possible acylaminoacyl-peptidase | ->-> | 1617514 | 1617677 | 164 | 34.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 466 | TF1512 | hypothetical protein | TF1513 | hypothetical protein | ->-> | 1624802 | 1625033 | 232 | 28.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 468 | TF1517 | hypothetical protein | TF1518 | peroxiredoxin | ->-> | 1627008 | 1627175 | 168 | 29.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 469 | TF1519 | hypothetical protein | TF1520 | transaldolase | ->-> | 1628083 | 1628289 | 207 | 39.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 471 | TF1525 | conserved hypothetical protein | TF1527 | hypothetical protein | ->-> | 1632593 | 1632738 | 146 | 23.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 472 | TF1527 | hypothetical protein | TF1528 | malate dehydrogenase | ->-> | 1633117 | 1633426 | 310 | 44.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 473 | TF1529 | hypothetical protein | TF1530 | 1-deoxyxylulose-5-phosphate synthase | ->-> | 1634617 | 1634748 | 132 | 30.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 474 | TF1532 | potassium uptake system protein | TF1534 | conserved hypothetical protein | ->-> | 1639476 | 1639624 | 149 | 44.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 475 | TF1535 | possible outer membrane receptor protein | TF1537 | hypothetical protein | ->-> | 1642270 | 1643045 | 776 | 38.3% | 0 | 0 | 0 | +: 1/0/0 | -: 0/4/0 | 5 | 0 | 0 | 0 | Result | |
| 476 | TF1536 | hypothetical protein | TF1538 | conserved hypothetical protein | ->-> | 1643544 | 1643670 | 127 | 41.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 477 | TF1539 | conserved hypothetical protein | TF1540 | possible ATPase | ->-> | 1644402 | 1644676 | 275 | 27.6% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 480 | TF1543 | conserved hypothetical protein | TF1544 | possible transcriptional regulator | ->-> | 1650835 | 1651049 | 215 | 37.7% | 0 | 0 | 0 | +: 0/3/0 | -: 0/2/0 | 1 | 1 | 3 | 203 | Result | aatacccccgaaaaggggtataattgattcctattccttatatttgccactgataaggtatataatgactttggcggagtgagtcgtgcatagtgatataccttgaatatgtacccaaaagagacaaaatgggtacatatccttgagacgtgtacccgaaaacggcattttgggtacatattcggaatgtggtacttcaag |
| 481 | TF1547 | conserved hypothetical protein | TF1548 | thiophene and furan oxidation protein | ->-> | 1652532 | 1652640 | 109 | 35.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 482 | TF1552 | conserved hypothetical protein | TF1553 | copper homeostasis protein | ->-> | 1658887 | 1659012 | 126 | 38.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 484 | TF1565 | polysaccharide export protein, BexD/CtrA/VexA family | TF1566 | H+-transporting ATP synthase, subunit K | ->-> | 1673807 | 1674098 | 292 | 29.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 485 | TF1573 | ATP synthase, subunit E | TF1574 | two-component system response regulator | ->-> | 1681683 | 1681946 | 264 | 33% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 486 | TF1574 | two-component system response regulator | TF1575 | DNA-binding response regulator | ->-> | 1685106 | 1685316 | 211 | 32.7% | 0 | 0 | 0 | +: 1/0/0 | -: 2/2/2 | 1 | 0 | 0 | 0 | Result | |
| 487 | TF1578 | hypothetical protein | TF1579 | hypothetical protein | ->-> | 1686477 | 1687028 | 552 | 48.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 35 | 0 | 0 | 0 | Result | |
| 488 | TF1585 | hypothetical protein | TF1586 | hypothetical protein | ->-> | 1690671 | 1691110 | 440 | 52.3% | 0 | 0 | 0 | +: 0/3/0 | -: 0/0/0 | 19 | 0 | 0 | 0 | Result | |
| 489 | TF1587 | conserved hypothetical protein | TF1588 | hypothetical protein | ->-> | 1702083 | 1702407 | 325 | 41.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 490 | TF1588 | hypothetical protein | TF1589 | surface antigen BspA | ->-> | 1702621 | 1703328 | 708 | 49.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 23 | 0 | 0 | 0 | Result | |
| 492 | TF1590 | hypothetical protein | TF1591 | surface antigen BspA | ->-> | 1706104 | 1706526 | 423 | 48.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 6 | 0 | 0 | 0 | Result | |
| 493 | TF1591 | surface antigen BspA | TF1592 | hypothetical protein | ->-> | 1708327 | 1708464 | 138 | 32.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
| 494 | TF1592 | hypothetical protein | TF1593 | hypothetical protein | ->-> | 1708618 | 1708998 | 381 | 48.8% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/0 | 4 | 0 | 0 | 0 | Result | |
| 495 | TF1593 | hypothetical protein | TF1594 | hypothetical protein | ->-> | 1709638 | 1710042 | 405 | 32.1% | 0 | 0 | 0 | +: 1/1/1 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 496 | TF1601 | conserved hypothetical protein | TF1602 | L-aspartate oxidase | ->-> | 1715600 | 1715718 | 119 | 37.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 497 | TF1604 | possible anti-sigma factor | TF1605 | outer membrane protein, TonB dependent receptor | ->-> | 1718977 | 1719099 | 123 | 33.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 498 | TF1607 | conserved hypothetical protein | TF1608 | sulfate transporter | ->-> | 1725899 | 1726756 | 858 | 35.1% | 0 | 250 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 500 | TF1616 | conserved hypothetical protein; possible transcriptional regulator | TF1617 | conserved hypothetical protein; possible methyltransferase | ->-> | 1732925 | 1733289 | 365 | 31.8% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 501 | TF1620 | TPR domain protein | TF1621 | DNA replication and repair protein RecF | ->-> | 1735284 | 1735432 | 149 | 26.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 502 | TF1629 | hypothetical protein | TF1630 | mobilization protein | ->-> | 1741976 | 1742161 | 186 | 31.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 1 | 5 | 117 | Result | gatttggaaacgagcgaagtgctttctgtcgcatgtttctacatcaacaaagaacgcttgttattctatattgcaaagataatcatttgctttgaataacaagcgtttttgat |
| 503 | TF1631 | hypothetical protein | TF1632 | conserved hypothetical protein | ->-> | 1743594 | 1743999 | 406 | 39.2% | 0 | 0 | 0 | +: 1/0/0 | -: 0/3/0 | 1 | 2 | 66 | 332 | Result | ataagcttctttgaaagttaatcattatagatgattcattgtctcttaattcttgaatactgaccgatgagaacggagtgattacggtcttatctccccgacaatctaacgaggggagctgggcgcagtttgtgggtacaaactgacgtcttgcaatgctaccgaacaaattatatacgcttaaaacgttttatagcctaaaaacgaatgccgtgcattctatgactaactgcgttcgtggcattctcacagagaactaagctgaag |
| 504 | TF1633 | mobilizable transposon, excision protein | TF1635 | conserved hypothetical protein; possible helicase | ->-> | 1745409 | 1745592 | 184 | 27.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 1 | 1 | 184 | Result | tgttttgatactttaatgggttgaatgataattatttatgtttgtctgtttttatggttttaccttttccaaagttttcccctccaaactttttcatctttcttcttactacatactattttgtgataagtgattgataatcagtattactttgtagtataagacaatactacacattctacta |
| 505 | TF1634 | hypothetical protein | TF1637 | hypothetical protein | ->-> | 1747139 | 1747245 | 107 | 42.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 1 | 1 | 107 | Result | tgattggagcatattttatctcggattactgtgccaacctattccactacgacgccacaagctgccacttgaatggaaagtgatggaataagaaatgcccgatatta |
| 506 | TF1640 | DNA mismatch endonuclease vsr | TF1641 | hypothetical protein | ->-> | 1748653 | 1748964 | 312 | 30.8% | 0 | 0 | 0 | +: 0/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
| 507 | TF1641 | hypothetical protein | TF1642 | conserved hypothetical protein | ->-> | 1749247 | 1749407 | 161 | 31.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 508 | TF1647 | cytosine-specific methyltransferase | TF1648 | hypothetical protein | ->-> | 1758812 | 1759477 | 666 | 33.8% | 0 | 0 | 0 | +: 0/4/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 509 | TF1648 | hypothetical protein | TF1649 | hypothetical protein | ->-> | 1759667 | 1759777 | 111 | 36% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 513 | TF1654 | hypothetical protein | TF1655 | long-chain-fatty-acid-CoA ligase | ->-> | 1768766 | 1769418 | 653 | 36.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 11 | 0 | 0 | 0 | Result | |
| 514 | TF1655 | long-chain-fatty-acid-CoA ligase | TF1656 | possible 2-methylthioadenine synthetase | ->-> | 1771129 | 1771254 | 126 | 44.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 517 | TF1659 | hypothetical protein | TF1660 | hypothetical protein | ->-> | 1775270 | 1775408 | 139 | 46.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 8 | 0 | 0 | 0 | Result | |
| 518 | TF1660 | hypothetical protein | TF1661 | conserved hypothetical protein | ->-> | 1775661 | 1776204 | 544 | 45.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 519 | TF1662 | possible transcriptional regulator, PadR family | TF1663 | ABC transporter, permease component | ->-> | 1777681 | 1777819 | 139 | 33.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 521 | TF1667 | biotin acetyl-CoA carboxylase ligase/biotin operon repressor bifunctional protein | TF1668 | possible glycosylhydrolase | ->-> | 1780372 | 1780480 | 109 | 41.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 522 | TF1677 | ATP synthase, beta subunit | TF1678 | periplasmic protease | ->-> | 1790982 | 1791236 | 255 | 33.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 523 | TF1682 | hydrolase | TF1684 | zinc protease | ->-> | 1797404 | 1797535 | 132 | 38.6% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 524 | TF1688 | conserved hypothetical protein; possible periplasmic protein | TF1689 | conserved hypothetical protein | ->-> | 1804943 | 1805207 | 265 | 41.5% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 525 | TF1689 | conserved hypothetical protein | TF1690 | chaperone protein dnaK | ->-> | 1806675 | 1806876 | 202 | 34.7% | 0 | 0 | 0 | +: 2/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 526 | TF1690 | chaperone protein dnaK | TF1691 | integrase | ->-> | 1808782 | 1809561 | 780 | 38.8% | 0 | 10 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 527 | TF1692 | conserved hypothetical protein; possible mobilizable transposon, TnpC | TF1693 | conserved hypothetical protein; possible thiopurine S-methyltransferase (TPMT) family protein | ->-> | 1811493 | 1811631 | 139 | 35.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 528 | TF1693 | conserved hypothetical protein; possible thiopurine S-methyltransferase (TPMT) family protein | TF1694 | conserved hypothetical protein | ->-> | 1812433 | 1812632 | 200 | 43% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 529 | TF1694 | conserved hypothetical protein | TF1695 | excisionase | ->-> | 1816395 | 1816661 | 267 | 31.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 530 | TF1696 | conserved hypothetical protein | TF1697 | mobilizable transposon, excision protein | ->-> | 1818236 | 1818465 | 230 | 33.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 531 | TF1697 | mobilizable transposon, excision protein | TF1698 | mobilization protein | ->-> | 1819354 | 1819566 | 213 | 38% | 0 | 0 | 0 | +: 1/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 532 | TF1700 | conserved hypothetical protein | TF1701 | transcriptional regulator | ->-> | 1821522 | 1821632 | 111 | 30.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 1 | 1 | 111 | Result | taaagcttctttcctgcaccaattaaaatgatttaagggaatgagaaaataaaacctcattccctttttctatgctatttcatttcatatctttgcgctatcaaaagaaca |
| 534 | TF1707 | conserved hypothetical protein | TF1708 | transcriptional regulator | ->-> | 1829143 | 1829324 | 182 | 35.2% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 535 | TF1713 | hypothetical protein | TF1714 | hypothetical protein | ->-> | 1833777 | 1834264 | 488 | 42.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 4 | 0 | 0 | 0 | Result | |
| 536 | TF1715 | thermolysin; zinc metalloprotease | TF1716 | hypothetical protein | ->-> | 1837263 | 1837581 | 319 | 40.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/5/0 | 10 | 0 | 0 | 0 | Result | |
| 537 | TF1716 | hypothetical protein | TF1717 | DNA mismatch repair protein | ->-> | 1837771 | 1837944 | 174 | 39.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 538 | TF1722 | conserved hypothetical protein | TF1723 | alpha-rhamnosidase | ->-> | 1848532 | 1848635 | 104 | 27.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 539 | TF1730 | diaminopimelate decarboxylase | TF1733 | conserved hypothetical protein | ->-> | 1855968 | 1856154 | 187 | 48.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 540 | TF1735 | dehydrogenase, possible NADH-dependent dehydrogenase | TF1736 | hypothetical protein | ->-> | 1861521 | 1861822 | 302 | 33.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 541 | TF1738 | outer membrane protein | TF1739 | possible sulfatase | ->-> | 1867007 | 1867122 | 116 | 36.2% | 0 | 0 | 0 | +: 0/3/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 542 | TF1739 | possible sulfatase | TF1740 | hypothetical protein | ->-> | 1868665 | 1868784 | 120 | 46.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 543 | TF1740 | hypothetical protein | TF1741 | conserved hypothetical protein | ->-> | 1869253 | 1869443 | 191 | 38.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 544 | TF1741 | conserved hypothetical protein | TF1742 | TPR repeat-containing protein | ->-> | 1873074 | 1873268 | 195 | 33.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 545 | TF1747 | hypothetical protein | TF1748 | conserved hypothetical protein | ->-> | 1881558 | 1882697 | 1140 | 36.8% | 0 | 0 | 16 | +: 0/0/0 | -: 3/0/0 | 1 | 0 | 0 | 0 | Result | |
| 546 | TF1749 | outer membrane protein, TonB dependent receptor | TF1750 | hypothetical protein | ->-> | 1885860 | 1885993 | 134 | 36.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 547 | TF1750 | hypothetical protein | TF1751 | two-component system response regulator | ->-> | 1886627 | 1887021 | 395 | 38.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 548 | TF1751 | two-component system response regulator | TF1752 | hypothetical protein | ->-> | 1887814 | 1887995 | 182 | 30.2% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 549 | TF1755 | periplasmic protease | TF1756 | chromosome partitioning ATPase, ParA family | ->-> | 1892928 | 1893217 | 290 | 39.7% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 550 | TF1762 | hypothetical protein | TF1763 | K+-dependent Na+/Ca+ exchanger related-protein | ->-> | 1899709 | 1900545 | 837 | 50.1% | 0 | 0 | 0 | +: 0/3/0 | -: 0/0/0 | 22 | 0 | 0 | 0 | Result | |
| 552 | TF1771 | prolipoprotein diacylglyceryl transferase | TF1773 | hypothetical protein | ->-> | 1910668 | 1911078 | 411 | 38% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 553 | TF1773 | hypothetical protein | TF1774 | arylsulfatase precursor | ->-> | 1911466 | 1911565 | 100 | 32% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 554 | TF1774 | arylsulfatase precursor | TF1775 | oxidoreductase, Gfo/Idh/MocA family | ->-> | 1913000 | 1913274 | 275 | 38.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 555 | TF1775 | oxidoreductase, Gfo/Idh/MocA family | TF1776 | urocanate hydratase | ->-> | 1914679 | 1914799 | 121 | 35.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 556 | TF1779 | conserved hypothetical protein | TF1780 | formiminotransferase-cyclodeaminases | ->-> | 1921109 | 1921253 | 145 | 26.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 559 | TF1787 | conserved hypothetical protein | TF1788 | conserved hypothetical protein | ->-> | 1927366 | 1927554 | 189 | 38.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 560 | TF1788 | conserved hypothetical protein | TF1789 | conserved hypothetical protein | ->-> | 1930180 | 1930358 | 179 | 44.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 561 | TF1789 | conserved hypothetical protein | TF1790 | conserved hypothetical protein | ->-> | 1931265 | 1931366 | 102 | 35.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 562 | TF1797 | SNF family transporter | TF1798 | aldose 1-epimerase | ->-> | 1938632 | 1938954 | 323 | 35.3% | 0 | 0 | 0 | +: 0/2/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 563 | TF1798 | aldose 1-epimerase | TF1799 | quinolinate synthetase | ->-> | 1940083 | 1940415 | 333 | 33.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 564 | TF1806 | hypothetical protein | TF1807 | thioesterase family protein | ->-> | 1948935 | 1949038 | 104 | 38.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 565 | TF1810 | conserved hypothetical protein; possible membrane protein | TF1811 | hypothetical protein | ->-> | 1952367 | 1952662 | 296 | 30.1% | 0 | 0 | 0 | +: 0/0/0 | -: 2/1/0 | 1 | 0 | 0 | 0 | Result | |
| 566 | TF1812 | tryptophan synthase, beta chain | TF1813 | peptide methionine sulfoxide reductase | ->-> | 1954195 | 1954309 | 115 | 36.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 567 | TF1813 | peptide methionine sulfoxide reductase | TF1814 | conserved hypothetical protein; possible biotin synthase related domain containing protein | ->-> | 1955354 | 1955464 | 111 | 41.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 568 | TF1815 | conserved hypothetical protein | TF1817 | hypothetical protein | ->-> | 1957503 | 1957763 | 261 | 34.9% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 569 | TF1824 | ABC transporter, ATP-binding protein | TF1825 | mannose-6-phosphate isomerase | ->-> | 1973571 | 1973717 | 147 | 45.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
| 570 | TF1838 | tRNA/rRNA methyltransferase | TF1839 | conserved hypothetical protein | ->-> | 1988806 | 1989486 | 681 | 46.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 26 | 0 | 0 | 0 | Result | |
| 573 | TF1841 | hypothetical protein | TF1842 | hypothetical protein | ->-> | 1992328 | 1992710 | 383 | 45.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 33 | 0 | 0 | 0 | Result | |
| 574 | TF1842 | hypothetical protein | TF1843 | surface antigen BspA | ->-> | 1992861 | 1992973 | 113 | 31% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 575 | TF1843 | surface antigen BspA | TF1844 | hypothetical protein | ->-> | 1996250 | 1996528 | 279 | 36.2% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 576 | TF1846 | hypothetical protein | TF1847 | hypothetical protein | ->-> | 1997076 | 1997528 | 453 | 43.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 12 | 0 | 0 | 0 | Result | |
| 577 | TF1848 | conserved hypothetical protein | TF1850 | Na+/H+-exchanging protein | ->-> | 1998005 | 1998681 | 677 | 49.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 30 | 0 | 0 | 0 | Result | |
| 578 | TF1855 | O-sialoglycoprotein endopeptidase | TF1856 | conserved hypothetical protein | ->-> | 2009918 | 2010108 | 191 | 35.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 579 | TF1861 | conserved hypothetical protein; possible membrane protein | TF1862 | hypothetical protein | ->-> | 2018119 | 2018685 | 567 | 36.7% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 580 | TF1862 | hypothetical protein | TF1863 | Fe-S oxidoreductase | ->-> | 2018845 | 2018959 | 115 | 30.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 583 | TF1875 | conserved hypothetical protein | TF1876 | hypothetical protein | ->-> | 2029654 | 2029883 | 230 | 34.8% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 584 | TF1876 | hypothetical protein | TF1877 | hypothetical protein | ->-> | 2030115 | 2030551 | 437 | 37.1% | 0 | 0 | 0 | +: 1/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
| 585 | TF1884 | conserved hypothetical protein | TF1885 | conserved hypothetical protein | ->-> | 2036657 | 2037446 | 790 | 37.2% | 0 | 0 | 0 | +: 2/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 586 | TF1887 | hypothetical protein | TF1888 | RNA polymerase ECF-type sigma factor | ->-> | 2040861 | 2041079 | 219 | 42.9% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 587 | TF1890 | hypothetical protein | TF1891 | hypothetical protein | ->-> | 2043154 | 2043528 | 375 | 36.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/3/0 | 8 | 0 | 0 | 0 | Result | |
| 588 | TF1894 | hypothetical protein | TF1895 | hypothetical protein | ->-> | 2047374 | 2047490 | 117 | 37.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 589 | TF1896 | conserved hypothetical protein; possible phage-related protein | TF1897 | conserved hypothetical protein; possible aminopeptidase | ->-> | 2049048 | 2049398 | 351 | 28.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 590 | TF1899 | anti-sigma factor | TF1900 | conserved hypothetical protein | ->-> | 2053876 | 2054006 | 131 | 49.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 591 | TF1904 | two-component system response regulator | TF1905 | conserved hypothetical protein | ->-> | 2059796 | 2060071 | 276 | 37.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 2 | 0 | 0 | 0 | Result | |
| 592 | TF1905 | conserved hypothetical protein | TF1906 | conserved hypothetical protein | ->-> | 2060393 | 2061094 | 702 | 43.3% | 0 | 5 | 0 | +: 1/0/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
| 593 | TF1910 | nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase | TF1911 | conserved hypothetical protein | ->-> | 2065179 | 2065282 | 104 | 37.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 594 | TF1911 | conserved hypothetical protein | TF1912 | transcriptional regulator, TetR family | ->-> | 2065994 | 2066109 | 116 | 37.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 595 | TF1914 | conserved hypothetical protein | TF1915 | NAD-dependent protein deacetylase, SIR2 family | ->-> | 2067717 | 2067859 | 143 | 42.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 596 | TF1915 | NAD-dependent protein deacetylase, SIR2 family | TF1916 | conserved hypothetical protein; possible ATPase | ->-> | 2068550 | 2068669 | 120 | 42.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 597 | TF1924 | prenyltransferase, UbiA family | TF1926 | hypothetical protein | ->-> | 2073888 | 2074554 | 667 | 40.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 598 | TF1933 | methionyl-tRNA synthetase | TF1935 | ATP-dependent RNA helicase, DEAD/DEAH-related helicase | ->-> | 2081945 | 2082141 | 197 | 38.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 599 | TF1937 | conserved hypothetical protein | TF1938 | hypothetical protein | ->-> | 2085648 | 2085856 | 209 | 33.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 600 | TF1938 | hypothetical protein | TF1939 | hypothetical protein | ->-> | 2086331 | 2086438 | 108 | 38% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 601 | TF1940 | TPR-repeat-containing protein | TF1941 | 3-phosphoshikimate-1-carboxyvinyltransferase | ->-> | 2088875 | 2089001 | 127 | 34.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 602 | TF1942 | conserved hypothetical protein | TF1943 | phosphoenolpyruvate carboxykinase | ->-> | 2090707 | 2090935 | 229 | 33.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 603 | TF1943 | phosphoenolpyruvate carboxykinase | TF1944 | conserved hypothetical protein | ->-> | 2092526 | 2092655 | 130 | 45.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 604 | TF1948 | conserved hypothetical protein | TF1949 | leucyl-tRNA synthetase | ->-> | 2096856 | 2097088 | 233 | 37.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 605 | TF1953 | methlytransferase, possible UbiE/COQ5 family | TF1954 | long-chain-fatty-acid--CoA ligase | ->-> | 2104933 | 2105095 | 163 | 30.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 606 | TF1959 | conserved hypothetical protein | TF1960 | TonB protein | ->-> | 2110567 | 2110770 | 204 | 29.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 608 | TF1965 | conserved hypothetical protein | TF1966 | conserved hypothetical protein | ->-> | 2114924 | 2115128 | 205 | 41% | 0 | 0 | 1 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 609 | TF1968 | conserved hypothetical protein | TF1969 | transcriptional regulator, AsnC family | ->-> | 2116020 | 2116175 | 156 | 34% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 610 | TF1969 | transcriptional regulator, AsnC family | TF1970 | oxaloacetate decarboxylase, beta subunit | ->-> | 2116695 | 2116943 | 249 | 41.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 611 | TF1974 | glyoxalase I related protein (lactoylglutathione lyase) | TF1975 | uridylate kinase | ->-> | 2121489 | 2121675 | 187 | 39% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 612 | TF1975 | uridylate kinase | TF1976 | RNA polymerase ECF-type sigma factor | ->-> | 2122420 | 2122659 | 240 | 34.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 613 | TF1977 | anti-sigma factor | TF1978 | outer membrane protein, TonB dependent receptor | ->-> | 2124488 | 2124622 | 135 | 33.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 614 | TF1980 | conserved hypothetical protein | TF1981 | mannose-6-phosphate isomerase | ->-> | 2130921 | 2131035 | 115 | 47% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
| 615 | TF1982 | 1,4-alpha-glucan branching enzyme | TF1983 | conserved hypothetical protein | ->-> | 2134191 | 2134823 | 633 | 35.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
| 617 | TF1984 | conserved hypothetical protein | TF1985 | surface antigen BspA | ->-> | 2135640 | 2135798 | 159 | 32.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 618 | TF1985 | surface antigen BspA | TF1986 | hypothetical protein | ->-> | 2136966 | 2137160 | 195 | 36.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 619 | TF1987 | hypothetical protein | TF1989 | outer membrane protein, possible TonB dependent receptor | ->-> | 2137793 | 2137962 | 170 | 30.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 620 | TF1991 | hypothetical protein | TF1992 | hypothetical protein | ->-> | 2143645 | 2144231 | 587 | 41.2% | 0 | 0 | 0 | +: 0/6/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 621 | TF1993 | hypothetical protein | TF1994 | acyl-CoA synthetase | ->-> | 2144583 | 2145119 | 537 | 49.7% | 0 | 0 | 8 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 622 | TF1996 | ATP-dependent exonuclease SbcC | TF1997 | ROK family transcriptional regulator | ->-> | 2151652 | 2151777 | 126 | 26.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 623 | TF1997 | ROK family transcriptional regulator | TF1999 | ArgK protein with ATPase and kinase domains | ->-> | 2152747 | 2152908 | 162 | 40.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 624 | TF2004 | thymidylate synthase | TF2006 | uracil permease | ->-> | 2157304 | 2157418 | 115 | 37.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 627 | TF2013 | polysaccharide deacetylase | TF2014 | dipeptidyl aminopeptidase IV | ->-> | 2169402 | 2169537 | 136 | 39.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 628 | TF2020 | muconate cycloisomerase | TF2021 | hypothetical protein | ->-> | 2177613 | 2177841 | 229 | 36.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 629 | TF2025 | hypothetical protein | TF2026 | hypothetical protein | ->-> | 2182241 | 2182798 | 558 | 38.2% | 0 | 19 | 0 | +: 0/0/0 | -: 0/0/0 | 7 | 0 | 0 | 0 | Result | |
| 630 | TF2027 | conserved hypothetical protein | TF2028 | hypothetical protein | ->-> | 2184237 | 2184481 | 245 | 26.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 631 | TF2030 | hypothetical protein | TF2031 | conserved hypothetical protein | ->-> | 2186185 | 2186744 | 560 | 38.6% | 0 | 0 | 0 | +: 0/3/0 | -: 1/4/1 | 1 | 0 | 0 | 0 | Result | |
| 632 | TF2032 | outer membrane protein, TonB dependent receptor | TF2033 | conserved hypothetical protein | ->-> | 2191478 | 2191668 | 191 | 30.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 633 | TF2035 | conserved hypothetical protein | TF2036 | possible pyruvate formate-lyase activating enzyme | ->-> | 2195912 | 2196441 | 530 | 36.4% | 0 | 0 | 0 | +: 0/3/0 | -: 0/4/0 | 3 | 0 | 0 | 0 | Result | |
| 634 | TF2038 | hypothetical protein | TF2039 | possible cell-cycle regulation histidine triad (HIT) protein | ->-> | 2199283 | 2199457 | 175 | 42.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 635 | TF2040 | transcription elongation factor | TF2041 | conserved hypothetical protein | ->-> | 2200341 | 2200534 | 194 | 31.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 636 | TF2047 | hypothetical protein | TF2048 | conserved hypothetical protein | ->-> | 2210359 | 2210782 | 424 | 46.7% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 20 | 0 | 0 | 0 | Result | |
| 637 | TF2051 | hypothetical protein | TF2052 | acetyl transferase | ->-> | 2215770 | 2216646 | 877 | 34.5% | 0 | 250 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 638 | TF2055 | UDP-N-acetyl-D-mannosaminuronic acid dehydrogenase | TF2056 | conserved hypothetical protein | ->-> | 2220845 | 2221011 | 167 | 34.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 639 | TF2056 | conserved hypothetical protein | TF2057 | hypothetical protein | ->-> | 2222131 | 2222234 | 104 | 26% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 640 | TF2058 | possible ATP-dependent DNA helicase | TF2059 | asparagine synthase, glutamine-hydrolyzing | ->-> | 2223859 | 2224066 | 208 | 41.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 641 | TF2060 | glycosyltransferase | TF2061 | hypothetical protein | ->-> | 2227035 | 2227540 | 506 | 32% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 643 | TF2078 | dehydrogenase | TF2079 | permease | ->-> | 2245532 | 2245724 | 193 | 54.4% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 646 | TF2086 | transglutaminase-related protein | TF2087 | conserved hypothetical protein | ->-> | 2256828 | 2256995 | 168 | 41.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 647 | TF2092 | ribonuclease III | TF2093 | conserved hypothetical protein | ->-> | 2261884 | 2262111 | 228 | 47.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 648 | TF2093 | conserved hypothetical protein | TF2094 | 6-phosphofructokinase | ->-> | 2262463 | 2262576 | 114 | 35.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 649 | TF2094 | 6-phosphofructokinase | TF2095 | 5'-nucleotidase precursor | ->-> | 2263585 | 2263730 | 146 | 24.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 650 | TF2096 | possible OmpA, outer membrane-related protein | TF2097 | glucose inhibited division protein A | ->-> | 2268516 | 2269276 | 761 | 26.5% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 652 | TF2108 | hypothetical protein | TF2109 | possible metallo-beta-lactamase family protein | ->-> | 2277750 | 2278081 | 332 | 40.4% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 7 | 0 | 0 | 0 | Result | |
| 654 | TF2115 | conserved hypothetical protein; possible carboxylesterase | TF2116 | conserved hypothetical protein; possible hemagglutinin/hemolysin | ->-> | 2285832 | 2285938 | 107 | 31.8% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 655 | TF2117 | hypothetical protein | TF2118 | conserved hypothetical protein | ->-> | 2289975 | 2290100 | 126 | 28.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 657 | TF2121 | phosphoenolpyruvate synthase | TF2123 | conserved hypothetical protein; TPR-repeat protein | ->-> | 2297286 | 2297407 | 122 | 36.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 658 | TF2125 | conserved hypothetical protein | TF2126 | S-adenosylhomocysteine hydrolase | ->-> | 2302526 | 2302640 | 115 | 45.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 659 | TF2126 | S-adenosylhomocysteine hydrolase | TF2127 | hypothetical protein | ->-> | 2304057 | 2304177 | 121 | 38.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 660 | TF2134 | conserved hypothetical protein | TF2133 | aspartate-semialdehyde dehydrogenase | ->-> | 2310248 | 2310414 | 167 | 36.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 661 | TF2135 | conserved hypothetical protein | TF2136 | conserved hypothetical protein | ->-> | 2311696 | 2311950 | 255 | 31.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 662 | TF2138 | conserved hypothetical protein | TF2139 | hypothetical protein | ->-> | 2315507 | 2315800 | 294 | 36.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 663 | TF2139 | hypothetical protein | TF2140 | hypothetical protein | ->-> | 2316239 | 2316511 | 273 | 36.6% | 0 | 0 | 0 | +: 0/2/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 664 | TF2141 | conserved hypothetical protein | TF2142 | hypothetical protein | ->-> | 2318353 | 2318555 | 203 | 28.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 665 | TF2142 | hypothetical protein | TF2143 | S-adenosylmethionine:tRNA ribosyltransferase-isomerase | ->-> | 2319273 | 2319470 | 198 | 36.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 666 | TF2143 | S-adenosylmethionine:tRNA ribosyltransferase-isomerase | TF2145 | conserved hypothetical protein; possible rhodanese-domain protein | ->-> | 2319765 | 2319903 | 139 | 53.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 667 | TF2152 | uronate isomerase | TF2153 | 6-phosphofructokinase | ->-> | 2328122 | 2328251 | 130 | 40.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 670 | TF2161 | conserved hypothetical protein | TF2162 | thermolysin precursor | ->-> | 2338423 | 2338808 | 386 | 44.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 10 | 0 | 0 | 0 | Result | |
| 671 | TF2162 | thermolysin precursor | TF2163 | hypothetical protein | ->-> | 2340774 | 2340941 | 168 | 23.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 672 | TF2165 | hypothetical protein | TF2166 | hypothetical protein | ->-> | 2341983 | 2342254 | 272 | 47.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 12 | 0 | 0 | 0 | Result | |
| 673 | TF2166 | hypothetical protein | TF2167 | hypothetical protein | ->-> | 2342423 | 2342725 | 303 | 46.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 6 | 0 | 0 | 0 | Result | |
| 674 | TF2169 | hypothetical protein | TF2171 | hypothetical protein | ->-> | 2345415 | 2345624 | 210 | 48.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 10 | 0 | 0 | 0 | Result | |
| 675 | TF2171 | hypothetical protein | TF2173 | hypothetical protein | ->-> | 2345853 | 2345955 | 103 | 58.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 4 | 0 | 0 | 0 | Result | |
| 676 | TF2172 | hypothetical protein | TF2174 | possible endopeptidase precursor | ->-> | 2346196 | 2346431 | 236 | 45.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 9 | 0 | 0 | 0 | Result | |
| 677 | TF2175 | hypothetical protein | TF2176 | hypothetical protein | ->-> | 2348876 | 2349050 | 175 | 28% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 7 | 0 | 0 | 0 | Result | |
| 678 | TF2176 | hypothetical protein | TF2177 | hypothetical protein | ->-> | 2349246 | 2349420 | 175 | 40% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 4 | 0 | 0 | 0 | Result | |
| 679 | TF2179 | integral membrane protein, MarC family | TF2180 | phosphoribosylamine--glycine ligase | ->-> | 2352430 | 2352719 | 290 | 42.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 680 | TF2184 | conserved hypothetical protein | TF2185 | outer membrane protein, TonB dependent receptor | ->-> | 2357104 | 2357401 | 298 | 40.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 681 | TF2189 | conserved hypothetical protein | TF2190 | conserved hypothetical protein | ->-> | 2364945 | 2365151 | 207 | 33.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 682 | TF2190 | conserved hypothetical protein | TF2191 | hypothetical protein | ->-> | 2365707 | 2366073 | 367 | 40.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 16 | 0 | 0 | 0 | Result | |
| 683 | TF2196 | hypothetical protein | TF2197 | conserved hypothetical protein | ->-> | 2372241 | 2372541 | 301 | 39.9% | 0 | 0 | 0 | +: 0/4/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 684 | TF2201 | hypothetical protein | TF2202 | hypothetical protein | ->-> | 2378345 | 2378821 | 477 | 39.4% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 14 | 0 | 0 | 0 | Result | |
| 686 | TF2229.1 | rteR regulatory ortholog (with internal stop) | TF2230 | CTn excision protein | ->-> | 2399788 | 2399938 | 151 | 41.7% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 687 | TF2231 | DNA methylase, site-specific DNA-methyltransferase (adenine-specific) | TF2233 | conserved hypothetical protein | ->-> | 2406309 | 2406894 | 586 | 29.2% | 0 | 0 | 15 | +: 1/1/0 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
| 688 | TF2234 | acetyltransferase, GNAT family | TF2235 | tetracycline resistance protein related to CtnDOT tetQ | ->-> | 2408139 | 2408385 | 247 | 30% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 689 | TF2237 | two-component system response regulator involved in CTn | TF2238 | conserved hypothetical protein | ->-> | 2413954 | 2414237 | 284 | 46.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 1 | 4 | 283 | Result | cccgcaattcgctgaaaatggctatctttgcatgacatattagaaggtaacggcgactggcagagccttttgccgcctatatataacataagaccgcaaggcgtttcgagcgaaaatctggtaaattgacactacggagacgattgcgtgatgcttatgctatgcctacgcatagcgtgcattcacgtactctccgtaaaaggctttaccagagccgtcgcttgaaagtagtgtgatttgcacgctacttttttgcccttgcccaacgaaaggaaacgat |
| 690 | TF2250 | transfer region-related protein, TraD | TF2251 | conjugative transposon protein, TraE | ->-> | 2424234 | 2424411 | 178 | 48.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 1 | 79 | 178 | Result | cgcaacggacacacccaagtccgtagaaacaaacgggcaacccactaaaccaaagtaaagtaatcgagtatcaaccgcccgacaaaggaccatccaccct |
| 691 | TF2270 | conserved hypothetical protein | TF2271 | conserved hypothetical protein | ->-> | 2435822 | 2435941 | 120 | 47.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 692 | TF2281 | hypothetical protein | TF2283 | hypothetical protein | ->-> | 2440056 | 2440405 | 350 | 33.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 3 | 49 | 196 | Result | gttacttttgcatacgaagagttctttgaaggttacgcaacgcgcagaaggatgatgcagtagataactaactaaatcgtaacctattactatcatgagcaattaacctacgctcagttccaataaattacactcttttcgtaacttc |
| 693 | TF2283 | hypothetical protein | TF2284 | hypothetical protein | ->-> | 2440586 | 2440696 | 111 | 33.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 694 | TF2287 | hypothetical protein | TF2288 | hypothetical protein | ->-> | 2441520 | 2442472 | 953 | 35.7% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 695 | TF2288 | hypothetical protein | TF2289 | secretion protein, possible HlyD family | ->-> | 2442659 | 2442864 | 206 | 40.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 696 | TF2295 | hypothetical protein | TF2296 | hypothetical protein | ->-> | 2448778 | 2449031 | 254 | 35.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 697 | TF2298 | hypothetical protein | TF2299 | hypothetical protein | ->-> | 2449989 | 2450133 | 145 | 28.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 698 | TF2299 | hypothetical protein | TF2300 | conserved hypothetical protein | ->-> | 2450308 | 2450760 | 453 | 35.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 699 | TF2302 | conserved hypothetical protein; possible outer membrane protein | TF2303 | conserved hypothetical protein | ->-> | 2458124 | 2458391 | 268 | 33.2% | 0 | 0 | 0 | +: 0/4/0 | -: 0/5/0 | 1 | 0 | 0 | 0 | Result | |
| 700 | TF2308 | conserved hypothetical protein | TF2309 | cysteinyl-tRNA synthetase | ->-> | 2468920 | 2469031 | 112 | 42.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 701 | TF2319 | acyl carrier protein | TF2320 | hypothetical protein | ->-> | 2476649 | 2476793 | 145 | 40.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 702 | TF2321 | hypothetical protein | TF2322 | conserved hypothetical protein; possible lipoprotein | ->-> | 2482718 | 2482882 | 165 | 36.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 703 | TF2325 | conserved hypothetical protein | TF2326 | conserved hypothetical protein | ->-> | 2484720 | 2484825 | 106 | 32.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 704 | TF2338 | conserved hypothetical protein | TF2339 | hypothetical protein | ->-> | 2500067 | 2500395 | 329 | 35.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 705 | TF2340 | hypothetical protein | TF2341 | hypothetical protein | ->-> | 2500976 | 2505874 | 4899 | 48.7% | 0 | 0 | 0 | +: 0/3/0 | -: 2/9/7 | 1 | 0 | 0 | 0 | Result | |
| 706 | TF2342 | glutathione peroxidase | TF2343 | ribosome recycling factor | ->-> | 2506700 | 2507001 | 302 | 38.7% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 707 | TF2346 | hypothetical protein | TF2347 | outer membrane protein, TonB dependent receptor | ->-> | 2510034 | 2510294 | 261 | 31.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 708 | TF2349 | conserved hypothetical protein | TF2350 | hypothetical protein | ->-> | 2514982 | 2515202 | 221 | 40.7% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 709 | TF2350 | hypothetical protein | TF2351 | acetate kinase | ->-> | 2515425 | 2515619 | 195 | 46.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 713 | TF2362 | conserved hypothetical protein | TF2363 | conserved hypothetical protein | ->-> | 2529229 | 2529410 | 182 | 39.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 714 | TF2363 | conserved hypothetical protein | TF2364 | conserved hypothetical protein; possible DNA binding protein, excisionase family | ->-> | 2530341 | 2530501 | 161 | 38.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 715 | TF2366 | conserved hypothetical protein | TF2367 | delta-1-pyrroline-5-carboxylate dehydrogenase | ->-> | 2531953 | 2532141 | 189 | 46.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 716 | TF2374 | UDP-3-O-(R-3-hydoxymyristoyl)-glucosamine-N-acylt ransferase | TF2375 | conserved hypothetical protein | ->-> | 2540953 | 2541092 | 140 | 42.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 719 | TF2383 | hypothetical protein | TF2384 | thiol:disulfide interchange protein | ->-> | 2548626 | 2548740 | 115 | 33% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 720 | TF2385 | conserved hypothetical protein; possible MazG family protein | TF2386 | beta-galactosidase | ->-> | 2551605 | 2551815 | 211 | 37.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/4/0 | 1 | 0 | 0 | 0 | Result | |
| 722 | TF2392 | alpha-galactosidase | TF2394 | integrase/recombinase XerD | ->-> | 2565567 | 2565747 | 181 | 43.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 723 | TF2395 | conserved hypothetical protein | TF2396 | dimethyladenosine transferase | ->-> | 2567725 | 2567864 | 140 | 38.6% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 724 | TF2398 | magnesium chelatase, D/I family | TF2399 | precorrin-2 methyltransferase | ->-> | 2571267 | 2571389 | 123 | 35.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 725 | TF2413 | hypothetical protein | TF2414 | hypothetical protein | ->-> | 2590741 | 2590864 | 124 | 37.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 726 | TF2417 | outer membrane protein, TonB dependent receptor | TF2418 | GTP-binding protein | ->-> | 2597021 | 2597343 | 323 | 29.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 727 | TF2419 | conserved hypothetical protein; possible DNA uptake-related protein | TF2420 | hypothetical protein | ->-> | 2599236 | 2599374 | 139 | 42.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 728 | TF2421 | cytocidal toxin protein | TF2422 | hypothetical protein | ->-> | 2601298 | 2601437 | 140 | 38.6% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 729 | TF2423 | papain family cysteine protease | TF2424 | hypothetical protein | ->-> | 2602558 | 2603171 | 614 | 39.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 2 | 0 | 0 | 0 | Result | |
| 730 | TF2426 | conserved hypothetical protein; possible TonB receptor | TF2427 | arylsulfatase regulator (Fe-S oxidoreductase) | ->-> | 2605992 | 2606868 | 877 | 38.7% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 2 | 0 | 0 | 0 | Result | |
| 731 | TF2437 | elongation factor P | TF2438 | hypothetical protein | ->-> | 2615805 | 2615920 | 116 | 35.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 732 | TF2438 | hypothetical protein | TF2439 | conserved hypothetical protein | ->-> | 2616218 | 2616519 | 302 | 45.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 18 | 0 | 0 | 0 | Result | |
| 733 | TF2440 | conserved hypothetical protein; possible DNA mismatch repair protein | TF2441 | 10 kDa chaperonin | ->-> | 2618198 | 2618378 | 181 | 35.9% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 734 | TF2446 | riboflavin-specific deaminase | TF2447 | lipoprotein | ->-> | 2623581 | 2623688 | 108 | 31.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 735 | TF2458 | ribosome-binding factor A | TF2459 | conserved hypothetical protein | ->-> | 2635706 | 2635926 | 221 | 38% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 736 | TF2459 | conserved hypothetical protein | TF2460 | outer membrane protein, possibly involved in nutrient binding | ->-> | 2636719 | 2636896 | 178 | 39.3% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 738 | TF2470 | possible heme biosynthesis-related protein | TF2471 | conserved hypothetical protein | ->-> | 2648780 | 2649358 | 579 | 32.6% | 0 | 0 | 0 | +: 0/4/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 739 | TF2477 | phosphatase | TF2478 | hypothetical protein | ->-> | 2655026 | 2655514 | 489 | 44.2% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 9 | 0 | 0 | 0 | Result | |
| 740 | TF2478 | hypothetical protein | TF2479 | conserved hypothetical protein | ->-> | 2655674 | 2656131 | 458 | 28.4% | 0 | 0 | 0 | +: 0/2/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
| 741 | TF2479 | conserved hypothetical protein | TF2480 | hypothetical protein | ->-> | 2657104 | 2657234 | 131 | 21.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 742 | TF2482 | hypothetical protein | TF2483 | hypothetical protein | ->-> | 2659246 | 2659824 | 579 | 38.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 743 | TF2484 | hypothetical protein | TF2485 | conserved hypothetical protein | ->-> | 2660367 | 2660742 | 376 | 39.1% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
| 746 | TF2489 | hypothetical protein | TF2491 | hypothetical protein | ->-> | 2664759 | 2665092 | 334 | 40.1% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
| 747 | TF2500 | ABC transporter, ATP-binding protein | TF2501 | DNA mismatch repair protein | ->-> | 2675363 | 2676419 | 1057 | 46.9% | 0 | 0 | 0 | +: 0/3/0 | -: 0/6/0 | 33 | 0 | 0 | 0 | Result | |
| 748 | TF2510 | trigger factor, peptidyl prolyl cis-trans isomerase | TF2511 | RNA binding protein | ->-> | 2689740 | 2690049 | 310 | 28.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 749 | TF2515 | outer membrane protein, TonB dependent receptor | TF2517 | hypothetical protein | ->-> | 2694926 | 2695228 | 303 | 43.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 750 | TF2517 | hypothetical protein | TF2518 | ATP-dependent DNA helicase | ->-> | 2695541 | 2695680 | 140 | 36.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 751 | TF2528 | anti-sigma factor | TF2527 | RNA polymerase ECF-type sigma factor | ->-> | 2710115 | 2710236 | 122 | 32.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 752 | TF2530 | conserved hypothetical protein | TF2531 | possible dipeptidyl-peptidase III | ->-> | 2712987 | 2713184 | 198 | 40.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 753 | TF2533 | adenylosuccinate synthetase | TF2534 | conserved hypothetical protein | ->-> | 2717075 | 2717183 | 109 | 41.3% | 0 | 0 | 0 | +: 1/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 754 | TF2535 | histidyl-tRNA synthetase | TF2536 | subtilisin-like serine protease | ->-> | 2719239 | 2719425 | 187 | 42.2% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 2 | 0 | 0 | 0 | Result | |
| 757 | TF2543 | RNA polymerase sigma-70 factor, ECF subfamily | TF2544 | cytidine deaminase | ->-> | 2728327 | 2728461 | 135 | 33.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 758 | TF2544 | cytidine deaminase | TF2545 | hypothetical protein | ->-> | 2728954 | 2729192 | 239 | 31.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 759 | TF2546 | S-adenosylmethionine synthetase | TF2547 | hypothetical protein | ->-> | 2730664 | 2730803 | 140 | 35.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 760 | TF2547 | hypothetical protein | TF2548 | 30S ribosomal protein S12 | ->-> | 2731008 | 2731377 | 370 | 40.8% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 6 | 0 | 0 | 0 | Result | |
| 761 | TF2576 | translation initiation factor IF-1 | TF2577 | 30S ribosomal protein S13 | ->-> | 2746268 | 2746447 | 180 | 37.8% | 0 | 1 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 762 | TF2578 | 30S ribosomal protein S11 | TF2579 | 30S ribosomal protein S4 | ->-> | 2747225 | 2747341 | 117 | 42.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 763 | TF2581 | 50S ribosomal protein L17 | TF2582 | ABC transporter, ATP-binding protein | ->-> | 2749431 | 2749572 | 142 | 41.5% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 764 | TF2583 | possible ABC transporter, permease component | TF2584 | hypothetical protein | ->-> | 2751087 | 2751319 | 233 | 41.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 768 | TF2592 | conserved hypothetical protein | TF2593 | amino acid transport protein | ->-> | 2762868 | 2763021 | 154 | 42.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 769 | TF2597 | outer membrane receptor protein; possible TonB dependent receptor | TF2598 | conserved hypothetical protein | ->-> | 2770912 | 2771171 | 260 | 34.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 770 | TF2599 | alpha-amylase family protein | TF2600 | ribose-phosphate pyrophosphokinase | ->-> | 2773724 | 2773827 | 104 | 30.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 771 | TF2602 | tRNA-(5-methylaminomethyl-2-thiouridylate) methyltransferase | TF2603 | transcriptional regulator, AraC family | ->-> | 2776561 | 2776717 | 157 | 36.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 772 | TF2603 | transcriptional regulator, AraC family | TF2604 | possible membrane transport protein | ->-> | 2777333 | 2777546 | 214 | 33.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 773 | TF2604 | possible membrane transport protein | TF2605 | outer membrane protein, TonB dependent receptor | ->-> | 2779893 | 2779994 | 102 | 34.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 774 | TF2606 | conserved hypothetical protein | TF2607 | conserved hypothetical protein | ->-> | 2783612 | 2783976 | 365 | 38.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 776 | TF2609 | dipeptidase, pathogenicity island-encoded protein D | TF2610 | nitroreductase | ->-> | 2786325 | 2786515 | 191 | 37.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 777 | TF2613 | conserved hypothetical protein | TF2614 | conserved hypothetical protein | ->-> | 2789859 | 2790060 | 202 | 33.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 778 | TF2615 | conserved hypothetical protein | TF2616 | outer membrane protein, TonB dependent receptor | ->-> | 2791270 | 2791609 | 340 | 42.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 779 | TF2617 | conserved hypothetical protein | TF2618 | integral membrane protein, possible zinc transporter | ->-> | 2795233 | 2795354 | 122 | 35.2% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 780 | TF2636 | glutaminase | TF2637 | conserved hypothetical protein | ->-> | 2807160 | 2807283 | 124 | 35.5% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 781 | TF2637 | conserved hypothetical protein | TF2638 | cation transport protein | ->-> | 2808016 | 2808124 | 109 | 39.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 782 | TF2640 | hypothetical protein | TF2641 | riboflavin kinase/FAD synthase | ->-> | 2809594 | 2809820 | 227 | 48.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 8 | 0 | 0 | 0 | Result | |
| 783 | TF2646 | conserved hypothetical protein | TF2647 | transcriptional regulator, possible arylsulfatase regulator | ->-> | 2816758 | 2816935 | 178 | 46.1% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 784 | TF2647 | transcriptional regulator, possible arylsulfatase regulator | TF2648 | conserved hypothetical protein | ->-> | 2818196 | 2818404 | 209 | 29.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 785 | TF2653 | hypothetical protein | TF2654 | arginyl-tRNA synthetase | ->-> | 2822521 | 2822831 | 311 | 42.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 786 | TF2655 | DNA topoisomerase I | TF2656 | valyl-tRNA synthetase | ->-> | 2827023 | 2827215 | 193 | 37.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 790 | TF2662 | hypothetical protein | TF2663 | hypothetical protein | ->-> | 2837192 | 2837291 | 100 | 37% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 791 | TF2663 | hypothetical protein | TF2664 | hypothetical protein | ->-> | 2841384 | 2841538 | 155 | 43.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 792 | TF2664 | hypothetical protein | TF2666 | hypothetical protein | ->-> | 2841791 | 2841957 | 167 | 54.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 9 | 0 | 0 | 0 | Result | |
| 793 | TF2665 | hypothetical protein | TF2667 | hypothetical protein | ->-> | 2842296 | 2842534 | 239 | 48.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 11 | 0 | 0 | 0 | Result | |
| 794 | TF2668 | hypothetical protein | TF2670 | hypothetical protein | ->-> | 2842794 | 2842918 | 125 | 56.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 9 | 0 | 0 | 0 | Result | |
| 795 | TF2674 | conserved hypothetical protein; possible phosphoesterase | TF2675 | conserved hypothetical protein | ->-> | 2848838 | 2849003 | 166 | 25.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 796 | TF2675 | conserved hypothetical protein | TF2676 | conserved hypothetical protein | ->-> | 2849682 | 2849784 | 103 | 34% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 797 | TF2680 | conserved hypothetical protein | TF2681 | conserved hypothetical protein | ->-> | 2855777 | 2855935 | 159 | 27.7% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 798 | TF2696 | oxidoreductase, short chain dehydrogenase/reductase family | TF2697 | small heat shock protein | ->-> | 2871672 | 2871817 | 146 | 42.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 799 | TF2697 | small heat shock protein | TF2698 | hypothetical protein | ->-> | 2872250 | 2872614 | 365 | 40% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 800 | TF2699 | hypothetical protein | TF2700 | possible nifS-like aminotransferase | ->-> | 2872834 | 2872994 | 161 | 34.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 801 | TF2700 | possible nifS-like aminotransferase | TF2701 | conserved hypothetical protein | ->-> | 2874195 | 2874313 | 119 | 30.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 802 | TF2714 | hypothetical protein | TF2715 | glycosyltransferase | ->-> | 2888711 | 2889258 | 548 | 34.9% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 804 | TF2720 | conserved hypothetical protein | TF2721 | conserved hypothetical protein | ->-> | 2895002 | 2895729 | 728 | 37.4% | 0 | 0 | 2 | +: 1/1/1 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
| 807 | TF2727 | outer membrane protein, possibly involved in nutrient binding | TF2728 | outer membrane protein, TonB dependent receptor | ->-> | 2904595 | 2904747 | 153 | 30.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 808 | TF2730 | thiol:disulfide interchange protein | TF2731 | Fe2+/Zn2+ uptake regulation protein | ->-> | 2911007 | 2911335 | 329 | 44.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 809 | TF2731 | Fe2+/Zn2+ uptake regulation protein | TF2732 | thioredoxin M | ->-> | 2911747 | 2911906 | 160 | 38.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 810 | TF2733 | DNA polymerase III, alpha subunit | TF2734 | conserved hypothetical protein | ->-> | 2916034 | 2916180 | 147 | 29.9% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 811 | TF2738 | 30S ribosomal protein S16 | TF2739 | thioredoxin | ->-> | 2920145 | 2920265 | 121 | 41.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 812 | TF2742 | single-strand DNA-specific exonuclease | TF2743 | conserved hypothetical protein | ->-> | 2925664 | 2925896 | 233 | 31.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 813 | TF2744 | methionyl-tRNA formyltransferase | TF2745 | hypothetical protein | ->-> | 2927439 | 2927701 | 263 | 46% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 3 | 0 | 0 | 0 | Result | |
| 814 | TF2745 | hypothetical protein | TF2746 | hypothetical protein | ->-> | 2928008 | 2928135 | 128 | 47.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 9 | 0 | 0 | 0 | Result | |
| 815 | TF2746 | hypothetical protein | TF2747 | heat shock protein, HSP90 family | ->-> | 2928307 | 2928418 | 112 | 51.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 816 | TF2747 | heat shock protein, HSP90 family | TF2748 | ATP-dependent Clp protease | ->-> | 2930477 | 2930598 | 122 | 38.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 817 | TF2752 | endonuclease III | TF2753 | zinc protease | ->-> | 2937572 | 2937682 | 111 | 32.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 818 | TF2757 | hypothetical protein | TF2758 | hypothetical protein | ->-> | 2942396 | 2942531 | 136 | 39% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 819 | TF2758 | hypothetical protein | TF2759 | xylose repressor, ROK family | ->-> | 2943531 | 2943707 | 177 | 38.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 820 | TF2759 | xylose repressor, ROK family | TF2760 | MarR family transcriptional regulator | ->-> | 2944914 | 2945158 | 245 | 46.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 821 | TF2763 | pyridine nucleotide-disulphide oxidoreductase family protein | TF2764 | hypothetical protein | ->-> | 2948655 | 2948896 | 242 | 24.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 822 | TF2765 | subtilisin-like serine protease | TF2766 | shikimate kinase | ->-> | 2951521 | 2951758 | 238 | 41.2% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 2 | 0 | 0 | 0 | Result | |
| 823 | TF2768 | ferredoxin oxidoreductase, beta subunit | TF2769 | cell-division protein; ftsX family permease | ->-> | 2955230 | 2955487 | 258 | 42.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 824 | TF2775 | conserved hypothetical protein; possible mucoidy inhibitor-related protein | TF2776 | hypothetical protein | ->-> | 2961419 | 2961609 | 191 | 34% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 825 | TF2778 | outer membrane protein, TonB dependent receptor | TF2779 | fucose permease | ->-> | 2964312 | 2964705 | 394 | 40.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 826 | TF2782 | conserved hypothetical protein | TF2783 | aminotransferase, PatB family | ->-> | 2967417 | 2968178 | 762 | 44% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 827 | TF2786 | hypothetical protein | TF2787 | 30S ribosomal protein S1 | ->-> | 2970363 | 2970515 | 153 | 27.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 828 | TF2789 | enoyl-[acyl-carrier-protein] reductase | TF2790 | prismane protein, hybrid-cluster protein | ->-> | 2973426 | 2973536 | 111 | 48.6% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 829 | TF2790 | prismane protein, hybrid-cluster protein | TF2791 | GTP-binding protein TypA | ->-> | 2975211 | 2975437 | 227 | 43.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 831 | TF2792 | 30S ribosomal protein S15 | TF2793 | possible L-lysine 2,3-aminomutase | ->-> | 2977660 | 2977800 | 141 | 39% | 0 | 0 | 0 | +: 1/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 832 | TF2793 | possible L-lysine 2,3-aminomutase | TF2794 | possible transcriptional regulator | ->-> | 2979949 | 2980077 | 129 | 44.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 833 | TF2795 | hypothetical protein | TF2796 | cytochrome D ubiquinol oxidase, subunit II | ->-> | 2980970 | 2981408 | 439 | 41.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
| 834 | TF2798 | conserved hypothetical protein | TF2799 | RNA polymerase ECF-type sigma factor | ->-> | 2984394 | 2984524 | 131 | 30.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 835 | TF2799 | RNA polymerase ECF-type sigma factor | TF2800 | anti-sigma factor | ->-> | 2985113 | 2985284 | 172 | 36% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 836 | TF2802 | possible outer membrane protein | TF2803 | dehydrogenase, possible NADH-dependent dehydrogenase | ->-> | 2991875 | 2992048 | 174 | 27% | 0 | 0 | 0 | +: 1/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 837 | TF2803 | dehydrogenase, possible NADH-dependent dehydrogenase | TF2804 | conserved hypothetical protein | ->-> | 2993528 | 2993633 | 106 | 41.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 838 | TF2804 | conserved hypothetical protein | TF2806 | conserved hypothetical protein | ->-> | 2994510 | 2994614 | 105 | 36.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 839 | TF2809 | conserved hypothetical protein; possible translation factor (SUA5) | TF2810 | conserved hypothetical protein | ->-> | 3000572 | 3000722 | 151 | 44.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 840 | TF2815 | meso-diaminopimelate D-dehydrogenase | TF2816 | hypothetical protein | ->-> | 3006481 | 3007064 | 584 | 49.3% | 0 | 0 | 0 | +: 0/3/0 | -: 0/0/0 | 20 | 0 | 0 | 0 | Result | |
| 841 | TF2816 | hypothetical protein | TF2817 | hypothetical protein | ->-> | 3007245 | 3007497 | 253 | 37.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 17 | 0 | 0 | 0 | Result | |
| 842 | TF2817 | hypothetical protein | TF2818 | acetylornithine aminotransferase | ->-> | 3007687 | 3007878 | 192 | 49.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 11 | 0 | 0 | 0 | Result | |
| 843 | TF2823 | TPR-containing protein | TF2824 | nucleoside-transporting protein nupG | ->-> | 3014398 | 3014840 | 443 | 49.2% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 22 | 0 | 0 | 0 | Result | |
| 846 | TF2832 | possible proton/sodium:glutamate symporter protein | TF2833 | lipid A disaccharide synthase | ->-> | 3024000 | 3024112 | 113 | 38.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 847 | TF2835 | stationary-phase survival protein SurE | TF2834 | cardiolipin synthase | ->-> | 3026021 | 3026125 | 105 | 41.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 848 | TF2839 | ATP-dependent exodeoxyribonuclease | TF2840 | hypothetical protein | ->-> | 3031096 | 3031199 | 104 | 41.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 849 | TF2840 | hypothetical protein | TF2841 | conserved hypothetical protein | ->-> | 3031350 | 3031580 | 231 | 39% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 3 | 0 | 0 | 0 | Result | |
| 850 | TF2850 | endoribonuclease L-PSP | TF2852 | conserved hypothetical protein | ->-> | 3038932 | 3039105 | 174 | 39.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 851 | TF2855 | ATPase, AAA family | TF2856 | conserved hypothetical protein; possible TPR-repeat-containing protein | ->-> | 3042072 | 3042257 | 186 | 30.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 852 | TF2856 | conserved hypothetical protein; possible TPR-repeat-containing protein | TF2857 | conserved hypothetical protein | ->-> | 3043083 | 3043221 | 139 | 34.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 853 | TF2860 | hypothetical protein | TF2861 | conserved hypothetical protein; possible Rhs family protein | ->-> | 3051741 | 3051877 | 137 | 37.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 854 | TF2871 | hypothetical protein | TF2872 | hypothetical protein | ->-> | 3062775 | 3062907 | 133 | 30.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 855 | TF2872 | hypothetical protein | TF2873 | conserved hypothetical protein | ->-> | 3063715 | 3064384 | 670 | 30% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 856 | TF2879 | tRNA (guanine-N-1)-methyltransferase | TF2880 | phenylalanyl-tRNA synthetase, beta subunit | ->-> | 3069069 | 3069191 | 123 | 48% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 857 | TF2881 | conserved hypothetical protein | TF2882 | conserved hypothetical protein | ->-> | 3072441 | 3073558 | 1118 | 35.5% | 0 | 0 | 7 | +: 0/3/0 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
| 858 | TF2886 | RNA methylase SpoU family | TF2887 | phosphomannomutase/phosphoglucomutase | ->-> | 3076331 | 3076466 | 136 | 44.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 859 | TF2887 | phosphomannomutase/phosphoglucomutase | TF2888 | 50S ribosomal protein L21 | ->-> | 3077853 | 3078134 | 282 | 36.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 860 | TF2889 | 50S ribosomal protein L27 | TF2891 | lipoprotein | ->-> | 3078749 | 3078901 | 153 | 43.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 861 | TF2892 | seryl-tRNA synthetase | TF2893 | conserved hypothetical protein; possible phosphoesterase | ->-> | 3080787 | 3080905 | 119 | 42% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 862 | TF2893 | conserved hypothetical protein; possible phosphoesterase | TF2894 | conserved hypothetical protein; possible Fic family protein | ->-> | 3082100 | 3082465 | 366 | 31.7% | 0 | 0 | 0 | +: 0/3/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 863 | TF2894 | conserved hypothetical protein; possible Fic family protein | TF2895 | hypothetical protein | ->-> | 3083648 | 3084075 | 428 | 34.6% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 864 | TF2895 | hypothetical protein | TF2896 | conserved hypothetical protein; possible ATPase, AAA superfamily | ->-> | 3084253 | 3084532 | 280 | 45% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 865 | TF2896 | conserved hypothetical protein; possible ATPase, AAA superfamily | TF2897 | iron(III) ABC transporter, permease component | ->-> | 3085748 | 3086037 | 290 | 29.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 866 | TF2900 | conserved hypothetical protein | TF2901 | conserved hypothetical protein | ->-> | 3090090 | 3090504 | 415 | 44.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 867 | TF2902 | holliday junction DNA helicase | TF2903 | translation initiation factor SUI1 | ->-> | 3098541 | 3098713 | 173 | 37.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 868 | TF2913 | conserved hypothetical protein | TF2914 | hypothetical protein | ->-> | 3109178 | 3109484 | 307 | 44% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 869 | TF2914 | hypothetical protein | TF2915 | hypothetical protein | ->-> | 3109704 | 3110561 | 858 | 49.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 33 | 0 | 0 | 0 | Result | |
| 870 | TF2916 | conserved hypothetical protein | TF2917 | conserved hypothetical protein | ->-> | 3112239 | 3112394 | 156 | 35.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 871 | TF2918 | hypothetical protein | TF2919 | 5'-nucleotidase family protein | ->-> | 3114443 | 3114580 | 138 | 43.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 872 | TF2920 | conserved hypothetical protein | TF2921 | hypothetical protein | ->-> | 3117231 | 3118637 | 1407 | 49% | 0 | 0 | 0 | +: 0/8/0 | -: 0/1/0 | 52 | 0 | 0 | 0 | Result | |
| 873 | TF2921 | hypothetical protein | TF2922 | surface antigen BspA | ->-> | 3118851 | 3119261 | 411 | 44.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 31 | 0 | 0 | 0 | Result | |
| 874 | TF2922 | surface antigen BspA | TF2923 | hypothetical protein | ->-> | 3121599 | 3122307 | 709 | 47.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 40 | 0 | 0 | 0 | Result | |
| 875 | TF2923 | hypothetical protein | TF2924 | DNA-binding response regulator/sensor histidine kinase | ->-> | 3122464 | 3122723 | 260 | 38.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 876 | TF2924 | DNA-binding response regulator/sensor histidine kinase | TF2925 | beta-N-acetylglucosaminidase | ->-> | 3125679 | 3125839 | 161 | 44.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 878 | TF2928 | predicted DNA repair protein | TF2929 | conserved hypothetical protein | ->-> | 3131500 | 3131623 | 124 | 36.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 879 | TF2929 | conserved hypothetical protein | TF2930 | glutamyl-tRNA synthetase | ->-> | 3132623 | 3132825 | 203 | 24.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 880 | TF2934 | acetyltransferase/carbonic anhydrase | TF2933 | 30S ribosomal protein S21 | ->-> | 3137306 | 3137483 | 178 | 28.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 882 | TF2943 | 50S ribosomal protein L7/L12 | TF2944 | DNA-directed RNA polymerase, beta subunit | ->-> | 3143628 | 3143746 | 119 | 37.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 883 | TF2946 | conserved hypothetical protein; possible ATPase | TF2947 | isochorismate synthase | ->-> | 3153423 | 3153772 | 350 | 40% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 885 | TF2954 | outer membrane protein, TonB dependent receptor | TF2955 | integrase | ->-> | 3162182 | 3162622 | 441 | 29.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 886 | TF2956 | conserved hypothetical protein | TF2958 | type I restriction-modification system R subunit | ->-> | 3166526 | 3166712 | 187 | 33.2% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 887 | TF2961 | type I restriction enzyme | TF2962 | integrase/recombinase | ->-> | 3173434 | 3173798 | 365 | 38.1% | 0 | 0 | 28 | +: 0/1/0 | -: 1/3/0 | 1 | 0 | 0 | 0 | Result | |
| 888 | TF2964 | type I restriction enzyme | TF2965 | conserved hypothetical protein | ->-> | 3176334 | 3176695 | 362 | 35.9% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 889 | TF2966 | hypothetical protein | TF2967 | hypothetical protein | ->-> | 3177733 | 3177904 | 172 | 23.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 7 | 0 | 0 | 0 | Result | |
| 892 | TF2977 | candidate b-glycosyltransferase, Glycosyltransferase Family 2 protein | TF2978 | conserved hypothetical protein | ->-> | 3186109 | 3186215 | 107 | 33.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 893 | TF2980 | possible alpha-amylase | TF2981 | conserved hypothetical protein | ->-> | 3195875 | 3196108 | 234 | 39.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 895 | TF2988 | conserved hypothetical protein | TF2989 | conserved hypothetical protein | ->-> | 3205013 | 3205208 | 196 | 30.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 896 | TF2993 | SAM-dependent methyltransferase | TF2994 | hypothetical protein | ->-> | 3210478 | 3210744 | 267 | 39.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 4 | 0 | 0 | 0 | Result | |
| 897 | TF2996 | hypothetical protein | TF2997 | hypothetical protein | ->-> | 3211182 | 3211547 | 366 | 40.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 23 | 0 | 0 | 0 | Result | |
| 898 | TF2997 | hypothetical protein | TF2998 | surface antigen BspA | ->-> | 3211725 | 3211950 | 226 | 39.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 8 | 0 | 0 | 0 | Result | |
| 899 | TF2998 | surface antigen BspA | TF2999 | conserved hypothetical protein | ->-> | 3215212 | 3215705 | 494 | 48.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 16 | 0 | 0 | 0 | Result | |
| 900 | TF2999 | conserved hypothetical protein | TF3000 | hypothetical protein | ->-> | 3215952 | 3216551 | 600 | 44.3% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
| 904 | TF3003 | hypothetical protein | TF3004 | phosphoribosylformylglycinamidine (FGAM) synthase | ->-> | 3220690 | 3220958 | 269 | 42% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 14 | 0 | 0 | 0 | Result | |
| 905 | TF3004 | phosphoribosylformylglycinamidine (FGAM) synthase | TF3005 | histidine kinase sensor protein | ->-> | 3224637 | 3224944 | 308 | 31.2% | 0 | 0 | 0 | +: 1/3/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 906 | TF3006 | response regulator, transcriptional regulator RprY | TF3007 | conserved hypothetical protein | ->-> | 3227223 | 3227395 | 173 | 37.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 908 | TF3008 | zinc protease | TF3009 | RNA polymerase ECF-type sigma factor | ->-> | 3228898 | 3229232 | 335 | 37% | 0 | 0 | 0 | +: 1/1/1 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 909 | TF3009 | RNA polymerase ECF-type sigma factor | TF3010 | possible anti-sigma factor | ->-> | 3229770 | 3229955 | 186 | 41.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 910 | TF3010 | possible anti-sigma factor | TF3011 | outer membrane protein, TonB dependent receptor | ->-> | 3230949 | 3231069 | 121 | 35.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 911 | TF3013 | conserved hypothetical protein | TF3014 | oxidoreductase, short-chain dehydrogenase/reductase family | ->-> | 3237600 | 3237762 | 163 | 46% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 912 | TF3015 | hypothetical protein | TF3016 | conserved hypothetical protein | ->-> | 3238744 | 3238885 | 142 | 21.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 913 | TF3017 | hypothetical protein | TF3018 | polyphosphate kinase | ->-> | 3239964 | 3240261 | 298 | 35.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 914 | TF3024 | periplasmic protease | TF3025 | hypothetical protein | ->-> | 3248775 | 3248911 | 137 | 38% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 915 | TF3025 | hypothetical protein | TF3026 | conserved hypothetical protein | ->-> | 3249152 | 3249276 | 125 | 25.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 916 | TF3027 | zinc metalloprotease | TF3028 | 1-deoxy-d-xylulose-5-phosphate reductoisomerase | ->-> | 3251680 | 3251781 | 102 | 37.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 917 | TF3030 | 16S rRNA processing protein | TF3031 | conserved hypothetical protein | ->-> | 3254357 | 3254540 | 184 | 42.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 918 | TF3031 | conserved hypothetical protein | TF3032 | thiamin biosynthesis protein | ->-> | 3255147 | 3255359 | 213 | 26.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 919 | TF3033 | S1 RNA binding domain protein, S1 ribosomal protein | TF3034 | conserved hypothetical protein | ->-> | 3259044 | 3259252 | 209 | 36.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 920 | TF3034 | conserved hypothetical protein | TF3035 | aldose 1-epimerase | ->-> | 3260495 | 3260677 | 183 | 32.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 921 | TF3037 | galactokinase | TF3038 | conserved hypothetical protein | ->-> | 3264327 | 3264470 | 144 | 31.2% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 922 | TF3043 | conserved hypothetical protein | TF3044 | two-component system sensor kinase | ->-> | 3272470 | 3272830 | 361 | 38.8% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 923 | TF3045 | two-component system response regulator | TF3046 | hypothetical protein | ->-> | 3274694 | 3275087 | 394 | 36% | 0 | 0 | 0 | +: 0/3/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 926 | TF3051 | conserved hypothetical protein | TF3052 | conserved hypothetical protein | ->-> | 3278128 | 3278462 | 335 | 41.2% | 0 | 0 | 3 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 927 | TF3055 | hypothetical protein | TF3056 | conserved hypothetical protein | ->-> | 3279095 | 3279583 | 489 | 32.9% | 0 | 2 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 928 | TF3058 | conserved hypothetical protein | TF3059 | conserved hypothetical protein | ->-> | 3282102 | 3282218 | 117 | 24.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 929 | TF3062 | conserved hypothetical protein | TF3063 | ferredoxin-type protein | ->-> | 3288173 | 3288318 | 146 | 24.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 930 | TF3064 | oxidoreductase, aldo/keto reductase family | TF3065 | enolase | ->-> | 3291045 | 3291194 | 150 | 41.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 931 | TF3068 | flavodoxin A | TF3069 | hypothetical protein | ->-> | 3293444 | 3293642 | 199 | 33.2% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 932 | TF3077 | tonB-dependent receptor HmuY | TF3078 | ribonucleoside diphosphate reductase, alpha subunit | ->-> | 3305827 | 3306748 | 922 | 37.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 933 | TF3079 | ribonucleoside-diphosphate reductase 1, beta subunit | TF3080 | conserved hypothetical protein | ->-> | 3310374 | 3310619 | 246 | 30.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 936 | TF3082 | conserved hypothetical protein | TF3083 | hypothetical protein | ->-> | 3317399 | 3317516 | 118 | 22% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
| 937 | TF3084 | conserved hypothetical protein | TF3085 | hypothetical protein | ->-> | 3318703 | 3318820 | 118 | 22% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
| 939 | TF3092 | 30S ribosomal protein S9 | TF3093 | 30S ribosomal protein S2 | ->-> | 3325240 | 3325383 | 144 | 36.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 940 | TF3094 | translation elongation factor Ts | TF3095 | ABC transporter, ATP-binding protein | ->-> | 3327084 | 3327220 | 137 | 33.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 941 | TF3099 | conserved hypothetical protein | TF3100 | conserved hypothetical protein | ->-> | 3331168 | 3331324 | 157 | 39.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 942 | TF3101 | hypothetical protein | TF3102 | hypothetical protein | ->-> | 3332720 | 3332825 | 106 | 33% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 943 | TF3104 | outer membrane protein, TonB dependent receptor | TF3105 | hypothetical protein | ->-> | 3337511 | 3338207 | 697 | 38.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 8 | 0 | 0 | 0 | Result | |
| 944 | TF3114 | hypothetical protein | TF3115 | possible sugar kinase | ->-> | 3350399 | 3350567 | 169 | 34.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 945 | TF3115 | possible sugar kinase | TF3116 | conserved hypothetical protein | ->-> | 3352086 | 3352275 | 190 | 26.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 946 | TF3119 | conserved hypothetical protein | TF3120 | HD superfamily hydrolase | ->-> | 3353193 | 3353308 | 116 | 35.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 947 | TF3120 | HD superfamily hydrolase | TF3121 | nicotinate phosphoribosyltransferase | ->-> | 3354836 | 3354954 | 119 | 35.3% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 951 | TF3140 | Na+-translocating NADH-quinone reductase, subunit B | TF3141 | NADH: ubiquinone oxidoreductase, subunit A | ->-> | 3374634 | 3374806 | 173 | 45.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 952 | TF3141 | NADH: ubiquinone oxidoreductase, subunit A | TF3142 | conserved hypothetical protein | ->-> | 3376328 | 3376496 | 169 | 43.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 953 | TF3143 | conserved hypothetical protein; possible membrane protein | TF3144 | phosphomannomutase/phosphoglucomutase | ->-> | 3379288 | 3379495 | 208 | 37.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 954 | TF3144 | phosphomannomutase/phosphoglucomutase | TF3145 | conserved hypothetical protein; possible GTP cyclohydrolase I family | ->-> | 3381245 | 3381393 | 149 | 49.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 955 | TF3145 | conserved hypothetical protein; possible GTP cyclohydrolase I family | TF3146 | GTP-binding protein Obg | ->-> | 3381883 | 3381991 | 109 | 40.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 956 | TF3148 | hypoxanthine-guanine phosphoribosyltransferase | TF3149 | conserved hypothetical protein | ->-> | 3384332 | 3384563 | 232 | 41.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 958 | TF3163 | conserved hypothetical protein | TF3164 | hypothetical protein | ->-> | 3403778 | 3404036 | 259 | 29% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| Total: | 0 | 17 | 0/28 | 795 | 23 | ||||||||||||||