Origin IGS:
taaacccaaagtggcaatgtgtaaaaaagggggccaaacattttgttttgatccccctcctctttttgaagttgtcacagaatcttccgaaggcggaagcccccataacagctactatcgctacgtttattgactgttacgcccgatta
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
taatcgggcgtaacagtcaataaacgtagcgatagtagctgttatgggggcttccgccttcggaagattctgtgacaacttcaaaaagaggagggggatcaaaacaaaatgtttggcccccttttttacacattgccactttgggttta

Mask Tandem Repeat Region ================================================
taaacccaaagtggcaatgtgtaaaaaagggggccaaacattttgttttgatccccctcctctttttgaagttgtcacagaatcttccgaaggcggaagcccccataacagctactatcgctacgtttattgactgttacgcccgatta

Find is-nt database================================================
Query_seq: TF1532:TF1534|TF1532:TF1534:potassium uptake system protein:conserved hypothetical protein:->->:1639476..1639624 149
taaacccaaagtggcaatgtgtaaaaaagggggccaaacattttgttttgatccccctcctctttttgaagttgtcacagaatcttccgaaggcggaagcccccataacagctactatcgctacgtttattgactgttacgcccgatta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: TF1532:TF1534|TF1532:TF1534:potassium uptake system protein:conserved hypothetical protein:->->:1639476..1639624 149
taaacccaaagtggcaatgtgtaaaaaagggggccaaacattttgttttgatccccctcctctttttgaagttgtcacagaatcttccgaaggcggaagcccccataacagctactatcgctacgtttattgactgttacgcccgatta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: TF1532:TF1534|TF1532:TF1534:potassium uptake system protein:conserved hypothetical protein:->->:1639476..1639624 149
taaacccaaagtggcaatgtgtaaaaaagggggccaaacattttgttttgatccccctcctctttttgaagttgtcacagaatcttccgaaggcggaagcccccataacagctactatcgctacgtttattgactgttacgcccgatta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

taaacccaaagtggcaatgtgtaaaaaagggggccaaacattttgttttgatccccctcctctttttgaagttgtcacagaatcttccgaaggcggaagcccccataacagctactatcgctacgtttattgactgttacgcccgatta
Predict ORF larger than 30AA ================================================
Protein_Len: 40	Strand: +	Start: 11	End: 130
.......... M  A  M  C  K  K  G  G  Q  T  F  C  F  D  P  P  P  L  F  E  V  V  T  E  S  S  E  G  G  S  P  H  N  S  Y  Y  R  Y  V  Y ...................
Protein_Len: 34	Strand: +	Start: 48	End: 149
............................................... M  I  P  L  L  F  L  K  L  S  Q  N  L  P  K  A  E  A  P  I  T  A  T  I  A  T  F  I  D  C  Y  A  R  L 
Protein_Len: 43	Strand: -	Start: 2	End: 130
. F  G  F  H  C  H  T  F  F  P  A  L  C  K  T  K  I  G  R  R  K  K  F  N  D  C  F  R  G  F  A  S  A  G  M  V  A  V  I  A  V  N  M ...................
Protein_Len: 37	Strand: -	Start: 1	End: 111
 L  G  L  T  A  I  H  L  F  P  P  W  V  N  Q  K  S  G  G  G  R  K  S  T  T  V  S  D  E  S  P  P  L  G  W  L  M ......................................

taaacccaaagtggcaatgtgtaaaaaagggggccaaacattttgttttgatccccctcctctttttgaagttgtcacagaatcttccgaaggcggaagcccccataacagctactatcgctacgtttattgactgttacgcccgatta
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

taaacccaaagtggcaatgtgtaaaaaagggggccaaacattttgttttgatccccctcctctttttgaagttgtcacagaatcttccgaaggcggaagcccccataacagctactatcgctacgtttattgactgttacgcccgatta
Predict TransTerm conf > 70================================================
TransTerm Strand: -	Conf: 80	HP_score: -5.6	Tail_Score: -5.055	Start: 29	End: 56	Full_Region: cttcaaaaagaggag ggggatcaaaaca aaa tgtttggccccc ttttttacacattgc
............................ggggatcaaaacaaaatgtttggccccc.............................................................................................

Find igs database================================================
Query_seq: TF1532:TF1534|TF1532:TF1534:potassium uptake system protein:conserved hypothetical protein:->->:1639476..1639624 149
taaacccaaagtggcaatgtgtaaaaaagggggccaaacattttgttttgatccccctcctctttttgaagttgtcacagaatcttccgaaggcggaagcccccataacagctactatcgctacgtttattgactgttacgcccgatta
Intra-Species Hit: Count: 1	Min: 1	Max: 149	Len: 149
Subject: tfor_TF1532_TF1534|potassium uptake system protein:conserved hypothetical protein|POSITIVE:POSITIVE|[1639476,1639624]|149
HSP  1	e-value: 2.0E-79	bit: 295.0	Len: 149	Query Start:1	Query End:149	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 149
taaacccaaagtggcaatgtgtaaaaaagggggccaaacattttgttttgatccccctcctctttttgaagttgtcacagaatcttccgaaggcggaagcccccataacagctactatcgctacgtttattgactgttacgcccgatta
taaacccaaagtggcaatgtgtaaaaaagggggccaaacattttgttttgatccccctcctctttttgaagttgtcacagaatcttccgaaggcggaagcccccataacagctactatcgctacgtttattgactgttacgcccgatta

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UAAACCCAAAGUGGCAAUGUGUAAAAAAGGGGGCCAAACAUUUUGUUUUGAUCCCCCUCCUCUUUUUGAAGUUGUCACAGAAUCUUCCGAAGGCGGAAGCCCCCAUAACAGCUACUAUCGCUACGUUUAUUGACUGUUACGCCCGAUUA
..........((((((((...((((((((((((..((((.....))))....))))))....))))))..))))))))..((((.......(((....)))....(((((((......((...))......).)))))).....)))). (-38.00)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UAAUCGGGCGUAACAGUCAAUAAACGUAGCGAUAGUAGCUGUUAUGGGGGCUUCCGCCUUCGGAAGAUUCUGUGACAACUUCAAAAAGAGGAGGGGGAUCAAAACAAAAUGUUUGGCCCCCUUUUUUACACAUUGCCACUUUGGGUUUA
.((((.(((......))).......((.(((((.(.((.((((((((((.((((((....)))))).)))))))))).)).)....(((((((((((.(((((........))))))))))))))))....))))).))....)))).. (-46.10)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
388	62	27	159	122	tfor:TF2357|5end_collagenase_2522561..2522791_POSITIVE
383	119	78	199	163	tfor:TF1875|5end_conserved_hypothetical_protein_2028752..2028982_POSITIVE
369	120	72	219	165	tfor:TF3112|5end_Na+/H+_anitporter_3346775..3347005_POSITIVE
365	128	81	216	158	tfor:TF1909|5end_cobalamin_(5`-phosphate)_synthase_2063207..2063437_POSITIVE
364	99	51	83	39	tfor:TF0190|5end_cell_division_protein_FtsH_204029..204259_POSITIVE
356	67	26	166	116	tfor:TF0187|5end_ferredoxin_202151..202381_POSITIVE
333	80	32	186	150	tfor:TF2789|5end_enoyl-[acyl-carrier-protein]_reductase_2972431..2972661_POSITIVE
333	125	85	165	128	tfor:TF2655|5end_DNA_topoisomerase_I_2824543..2824773_POSITIVE
330	106	67	111	61	tfor:TF2807|5end_possible_chloride_channel_protein_2996637..2996867_POSITIVE
323	68	23	178	134	tfor:TF1708|5end_transcriptional_regulator_1829185..1829415_POSITIVE
323	95	51	66	5	tfor:TF0016|5end_hypothetical_protein_10292..10522_POSITIVE
322	59	13	226	174	tfor:TF1999|5end_ArgK_protein_with_ATPase_and_kinase_domains_2152769..2152999_POSITIVE
320	59	12	227	182	tfor:TF1260|5end_chaperone_protein_DnaJ_1345325..1345555_POSITIVE
319	95	55	53	8	tfor:TF1912|5end_transcriptional_regulator,_TetR_family_2065970..2066200_POSITIVE
318	100	54	146	101	tfor:TF2135|5end_conserved_hypothetical_protein_2311316..2311546_POSITIVE
316	63	26	78	35	tfor:TF1046|5end_hypothetical_protein_1108178..1108408_POSITIVE
313	100	54	147	101	tfor:TF2145|5end_conserved_hypothetical_protein;_possible_rhodanese-domain_protein_2319764..2319994_POSITIVE
311	99	51	48	6	tfor:TF1167|5end_hypothetical_protein_1248559..1248789_POSITIVE
310	119	71	56	1	tfor:TF0426|5end_conserved_hypothetical_protein_444728..444958_POSITIVE
306	70	27	207	157	tfor:TF0662|5end_hypothetical_protein_708316..708546_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
364	99	51	64	20	tfor:TF0189|3end_phosphatidate_cytidylytransferase_(CDP-diglyceride_synthetase)_204090..204240_POSITIVE
333	125	85	101	64	tfor:TF2654|3end_arginyl-tRNA_synthetase_2824559..2824709_POSITIVE
330	106	67	59	9	tfor:TF2805|3end_zinc_protease_2996665..2996815_POSITIVE
326	125	81	121	77	tfor:TF2953|3end_possible_TonB-dependent_outer_membrane_receptor_3161501..3161651_POSITIVE
323	70	25	62	9	tfor:TF2765|3end_subtilisin-like_serine_protease_2951460..2951610_POSITIVE
322	59	13	63	11	tfor:TF1997|3end_ROK_family_transcriptional_regulator_2152686..2152836_POSITIVE
318	100	54	112	67	tfor:TF2133|3end_aspartate-semialdehyde_dehydrogenase_2311362..2311512_POSITIVE
316	63	26	65	22	tfor:TF1045|3end_conserved_hypothetical_protein_1108245..1108395_POSITIVE
313	128	86	42	6	tfor:TF0072|3end_hypothetical_protein_81070..81220_POSITIVE
306	70	27	68	18	tfor:TF0661|3end_hypothetical_protein_708257..708407_POSITIVE
303	121	90	58	30	tfor:TF0079|3end_conserved_hypothetical_protein_86273..86423_POSITIVE
302	121	81	114	72	tfor:TF2547|3end_hypothetical_protein_2730947..2731097_POSITIVE
296	137	92	101	41	tfor:TF2315|3end_thioesterase_2474498..2474648_POSITIVE
294	126	87	59	11	tfor:TF2762|3end_conserved_hypothetical_protein_2946134..2946284_POSITIVE
294	121	88	75	46	tfor:TF2657|3end_conserved_hypothetical_protein_2830873..2831023_POSITIVE
291	71	31	70	22	tfor:TF2651|3end_hypothetical_protein_2822014..2822164_POSITIVE
290	99	51	58	10	tfor:TF2687|3end_iron-regulated_ABC-type_transporter_membrane_component_2864962..2865112_POSITIVE
288	128	88	95	53	tfor:TF2394|3end_integrase/recombinase_XerD_2566590..2566740_POSITIVE
288	129	88	132	91	tfor:TF0429|3end_ABC_transporter,_ATP-binding_protein_452227..452377_POSITIVE
288	101	68	150	119	tfor:TF0283|3end_possible_nicotinamide_mononucleotide_transporter_312074..312224_POSITIVE