Origin IGS:
taacttaccgccaagaaacccaaagtggagaagcaggtggaacagtagatagcacaaccctcactattcgagttttaaccctaaaacaacaaaagaaaatggaagcaacggatttgaacgaagcacgcatctatgtaggcacttatgccaagtacaataacaaacgattgaggtcaatctggacacgcttaaagtgatgcaaagtcgtggcgtatgcaatcaaaacacagaatatcacgaccaaatcgtgaaccttgtcaatgccaacaaacggctaatccgtcagcgaatgagacaaaacagcataaagtataaaccataaaactatcacagca
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
tgctgtgatagttttatggtttatactttatgctgttttgtctcattcgctgacggattagccgtttgttggcattgacaaggttcacgatttggtcgtgatattctgtgttttgattgcatacgccacgactttgcatcactttaagcgtgtccagattgacctcaatcgtttgttattgtacttggcataagtgcctacatagatgcgtgcttcgttcaaatccgttgcttccattttcttttgttgttttagggttaaaactcgaatagtgagggttgtgctatctactgttccacctgcttctccactttgggtttcttggcggtaagtta

Mask Tandem Repeat Region ================================================
taacttaccgccaagaaacccaaagtggagaagcaggtggaacagtagatagcacaaccctcactattcgagttttaaccctaaaacaacaaaagaaaatggaagcaacggatttgaacgaagcacgcatctatgtaggcacttatgccaagtacaataacaaacgattgaggtcaatctggacacgcttaaagtgatgcaaagtcgtggcgtatgcaatcaaaacacagaatatcacgaccaaatcgtgaaccttgtcaatgccaacaaacggctaatccgtcagcgaatgagacaaaacagcataaagtataaaccataaaactatcacagca

Find is-nt database================================================
Query_seq: TF3051:TF3052|TF3051:TF3052:conserved hypothetical protein:conserved hypothetical protein:->->:3278128..3278462 335
taacttaccgccaagaaacccaaagtggagaagcaggtggaacagtagatagcacaaccctcactattcgagttttaaccctaaaacaacaaaagaaaatggaagcaacggatttgaacgaagcacgcatctatgtaggcacttatgccaagtacaataacaaacgattgaggtcaatctggacacgcttaaagtgatgcaaagtcgtggcgtatgcaatcaaaacacagaatatcacgaccaaatcgtgaaccttgtcaatgccaacaaacggctaatccgtcagcgaatgagacaaaacagcataaagtataaaccataaaactatcacagca
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: TF3051:TF3052|TF3051:TF3052:conserved hypothetical protein:conserved hypothetical protein:->->:3278128..3278462 335
taacttaccgccaagaaacccaaagtggagaagcaggtggaacagtagatagcacaaccctcactattcgagttttaaccctaaaacaacaaaagaaaatggaagcaacggatttgaacgaagcacgcatctatgtaggcacttatgccaagtacaataacaaacgattgaggtcaatctggacacgcttaaagtgatgcaaagtcgtggcgtatgcaatcaaaacacagaatatcacgaccaaatcgtgaaccttgtcaatgccaacaaacggctaatccgtcagcgaatgagacaaaacagcataaagtataaaccataaaactatcacagca
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: TF3051:TF3052|TF3051:TF3052:conserved hypothetical protein:conserved hypothetical protein:->->:3278128..3278462 335
taacttaccgccaagaaacccaaagtggagaagcaggtggaacagtagatagcacaaccctcactattcgagttttaaccctaaaacaacaaaagaaaatggaagcaacggatttgaacgaagcacgcatctatgtaggcacttatgccaagtacaataacaaacgattgaggtcaatctggacacgcttaaagtgatgcaaagtcgtggcgtatgcaatcaaaacacagaatatcacgaccaaatcgtgaaccttgtcaatgccaacaaacggctaatccgtcagcgaatgagacaaaacagcataaagtataaaccataaaactatcacagca
Intra-Species Hit: Count: 0

Inter-species Hit: Count: 3	Min: 161	Max: 295	Len: 135
Subject: UniRef90_Q56VH5 Cluster: Ctn003; n=1; Bacteroides fragilis|Rep: Ctn003 - Bacteroides fragilis
HSP  1	e-value: 1.0E-10	bit: 67.8	Len: 132	Query Start:161	Query End:292	Subject Strand: null	Subject Start: 381	Subject End: 424
................................................................................................................................................................ Q  T  I  E  V  N  L  D  T  L  K  V  M  Q  S  R  G  V  C  N  Q  N  T  E  Y  H  D  Q  I  V  N  L  V  N  A  N  K  R  L  I  R  Q  R  M ...........................................
................................................................................................................................................................ E  T  I  E  V  S  L  K  T  L  K  V  V  Q  S  R  G  V  C  N  S  N  T  E  Y  H  D  R  I  I  R  L  V  E  D  N  A  G  L  I  R  Q  R  M ...........................................

Subject: UniRef90_Q64TG2 Cluster: Hypothetical protein; n=1; Bacteroides fragilis|Rep: Hypothetical protein - Bacteroides fragilis
HSP  1	e-value: 4.0E-10	bit: 65.9	Len: 132	Query Start:161	Query End:292	Subject Strand: null	Subject Start: 382	Subject End: 425
................................................................................................................................................................ Q  T  I  E  V  N  L  D  T  L  K  V  M  Q  S  R  G  V  C  N  Q  N  T  E  Y  H  D  Q  I  V  N  L  V  N  A  N  K  R  L  I  R  Q  R  M ...........................................
................................................................................................................................................................ E  T  I  E  V  D  L  K  T  L  N  V  V  Q  S  R  G  A  C  N  Q  N  T  E  Y  H  D  R  I  I  G  L  V  E  K  N  T  R  L  I  K  Q  K  L ...........................................

Subject: UniRef90_Q650G8 Cluster: Hypothetical protein; n=1; Bacteroides fragilis|Rep: Hypothetical protein - Bacteroides fragilis
HSP  1	e-value: 3.0E-7	bit: 56.6	Len: 135	Query Start:161	Query End:295	Subject Strand: null	Subject Start: 397	Subject End: 441
................................................................................................................................................................ Q  T  I  E  V  N  L  D  T  L  K  V  M  Q  S  R  G  V  C  N  Q  N  T  E  Y  H  D  Q  I  V  N  L  V  N  A  N  K  R  L  I  R  Q  R  M  R ........................................
................................................................................................................................................................ E  T  V  E  V  D  L  R  T  L  E  V  V  Q  C  H  G  K  H  N  Q  D  T  E  Y  H  E  R  I  I  D  L  V  N  K  N  A  N  L  I  R  E  R  M  K ........................................


taacttaccgccaagaaacccaaagtggagaagcaggtggaacagtagatagcacaaccctcactattcgagttttaaccctaaaacaacaaaagaaaatggaagcaacggatttgaacgaagcacgcatctatgtaggcacttatgccaagtacaataannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncaaaacagcataaagtataaaccataaaactatcacagca
Predict ORF larger than 30AA ================================================
Protein_Len: 43	Strand: +	Start: 66	End: 194
................................................................. M  R  V  L  T  L  K  Q  Q  K  K  M  E  A  T  D  L  N  E  A  R  I  Y  V  G  T  Y  A  K  Y  N  N  K  R  L  R  S  I  W  T  R  L  K .............................................................................................................................................
Protein_Len: 33	Strand: +	Start: 214	End: 312
..................................................................................................................................................................................................................... M  Q  S  K  H  R  I  S  R  P  N  R  E  P  C  Q  C  Q  Q  T  A  N  P  S  A  N  E  T  K  Q  H  K  V .......................
Protein_Len: 51	Strand: +	Start: 167	End: 319
...................................................................................................................................................................... M  E  V  N  L  D  T  L  K  V  M  Q  S  R  G  V  C  N  Q  N  T  E  Y  H  D  Q  I  V  N  L  V  N  A  N  K  R  L  I  R  Q  R  M  R  Q  N  S  I  K  Y  K  P ................
Protein_Len: 39	Strand: -	Start: 146	End: 262
................................................................................................................................................. A  L  Y  L  L  L  R  N  L  D  I  Q  V  R  K  F  H  H  L  T  T  A  Y  A  I  L  V  C  F  I  V  V  L  D  H  V  K  D  M .........................................................................
Protein_Len: 51	Strand: -	Start: 67	End: 219
.................................................................. E  L  K  L  G  L  V  V  F  S  F  P  L  L  P  N  S  R  L  V  C  R  H  L  C  K  H  W  T  C  Y  C  V  I  S  T  L  R  S  V  S  L  T  I  C  L  R  P  T  H  M ....................................................................................................................
Protein_Len: 41	Strand: -	Start: 8	End: 130
....... R  W  S  V  W  L  P  S  A  P  P  V  T  S  L  V  V  R  V  I  R  T  K  V  R  F  C  C  F  F  I  S  A  V  S  K  F  S  A  R  M .............................................................................................................................................................................................................

taacttaccgccaagaaacccaaagtggagaagcaggtggaacagtagatagcacaaccctcactattcgagttttaaccctaaaacaacaaaagaaaatggaagcaacggatttgaacgaagcacgcatctatgtaggcacttatgccaagtacaataannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncaaaacagcataaagtataaaccataaaactatcacagca
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

taacttaccgccaagaaacccaaagtggagaagcaggtggaacagtagatagcacaaccctcactattcgagttttaaccctaaaacaacaaaagaaaatggaagcaacggatttgaacgaagcacgcatctatgtaggcacttatgccaagtacaataannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncaaaacagcataaagtataaaccataaaactatcacagca
Predict TransTerm conf > 70================================================

Find igs database================================================
Query_seq: TF3051:TF3052|TF3051:TF3052:conserved hypothetical protein:conserved hypothetical protein:->->:3278128..3278462 335
taacttaccgccaagaaacccaaagtggagaagcaggtggaacagtagatagcacaaccctcactattcgagttttaaccctaaaacaacaaaagaaaatggaagcaacggatttgaacgaagcacgcatctatgtaggcacttatgccaagtacaataannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncaaaacagcataaagtataaaccataaaactatcacagca
Intra-Species Hit: Count: 1	Min: 1	Max: 335	Len: 335
Subject: tfor_TF3051_TF3052|conserved hypothetical protein:conserved hypothetical protein|POSITIVE:POSITIVE|[3278128,3278462]|335
HSP  1	e-value: 1.0E-85	bit: 317.0	Len: 160	Query Start:1	Query End:160	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 160
taacttaccgccaagaaacccaaagtggagaagcaggtggaacagtagatagcacaaccctcactattcgagttttaaccctaaaacaacaaaagaaaatggaagcaacggatttgaacgaagcacgcatctatgtaggcacttatgccaagtacaataa...............................................................................................................................................................................
taacttaccgccaagaaacccaaagtggagaagcaggtggaacagtagatagcacaaccctcactattcgagttttaaccctaaaacaacaaaagaaaatggaagcaacggatttgaacgaagcacgcatctatgtaggcacttatgccaagtacaataa...............................................................................................................................................................................
HSP  2	e-value: 6.0E-14	bit: 79.8	Len: 40	Query Start:296	Query End:335	Subject Strand: POSITIVE	Subject Start: 296	Subject End: 335
.......................................................................................................................................................................................................................................................................................................caaaacagcataaagtataaaccataaaactatcacagca
.......................................................................................................................................................................................................................................................................................................caaaacagcataaagtataaaccataaaactatcacagca

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UAACUUACCGCCAAGAAACCCAAAGUGGAGAAGCAGGUGGAACAGUAGAUAGCACAACCCUCACUAUUCGAGUUUUAACCCUAAAACAACAAAAGAAAAUGGAAGCAACGGAUUUGAACGAAGCACGCAUCUAUGUAGGCACUUAUGCCAAGUACAAUAACAAACGAUUGAGGUCAAUCUGGACACGCUUAAAGUGAUGCAAAGUCGUGGCGUAUGCAAUCAAAACACAGAAUAUCACGACCAAAUCGUGAACCUUGUCAAUGCCAACAAACGGCUAAUCCGUCAGCGAAUGAGACAAAACAGCAUAAAGUAUAAACCAUAAAACUAUCACAGCA
.......(((((.......((.....)).......)))))....((.(((((...................((((((....))))))...........((((..((.(((..((((.((.((((.........((((((((....))))...)))).........(((((....))))).......))))...))....))))..))).)).(((((.................((((((.....))))))...(((((...(((.......))).....((....)).....)))))....))))).........))))....))))))).... (-68.74)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UGCUGUGAUAGUUUUAUGGUUUAUACUUUAUGCUGUUUUGUCUCAUUCGCUGACGGAUUAGCCGUUUGUUGGCAUUGACAAGGUUCACGAUUUGGUCGUGAUAUUCUGUGUUUUGAUUGCAUACGCCACGACUUUGCAUCACUUUAAGCGUGUCCAGAUUGACCUCAAUCGUUUGUUAUUGUACUUGGCAUAAGUGCCUACAUAGAUGCGUGCUUCGUUCAAAUCCGUUGCUUCCAUUUUCUUUUGUUGUUUUAGGGUUAAAACUCGAAUAGUGAGGGUUGUGCUAUCUACUGUUCCACCUGCUUCUCCACUUUGGGUUUCUUGGCGGUAAGUUA
...((..(((((...(((((....(((((.((((((((..........((.((((((((...(((.(((...((..(((((((.(((((((...)))))))...))).)))).))...))).)))..((((...((((((......((((......(((((....)))))...))))..((((...((((....))))))))..))))))....))))...)))))))))).................((((((....))))))..)))))))))))))...)))))..)))))..)).(((((...((......))......)))))....... (-76.80)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
354	70	23	226	159	tfor:TF0763|5end_chromate_transport_protein_809675..809905_POSITIVE
348	288	241	78	25	tfor:TF2275|5end_conserved_hypothetical_protein_2436934..2437164_POSITIVE
337	220	172	166	114	tfor:TF1042|5end_possible_surface_antigen_with_leucine-rich_repeat_1102957..1103187_POSITIVE
325	147	109	70	19	tfor:TF1199|5end_dephospho-CoA_kinase_1282136..1282366_POSITIVE
322	300	262	103	54	tfor:TF0325|5end_LysM_domain_protein_351917..352147_POSITIVE
320	289	245	64	9	tfor:TF2310|5end_dehydrogenase,_possible_3-oxoacyl-[acyl-carrier-protein]_reductase_2470481..2470711_POSITIVE
317	217	183	57	14	tfor:TF0984|5end_possible_mucin-desulfating_sulfatase_(MdsC_protein)_1040259..1040489_POSITIVE
313	213	181	191	161	tfor:TF3024|5end_periplasmic_protease_3247204..3247434_POSITIVE
311	290	246	53	11	tfor:TF2661|5end_hypothetical_protein_2833509..2833739_POSITIVE
311	290	248	56	7	tfor:TF0329|5end_membrane-bound_lytic_murein_transglycosylase_D_355189..355419_POSITIVE
308	230	181	195	142	tfor:TF2902|5end_holliday_junction_DNA_helicase_3097813..3098043_POSITIVE
306	306	262	45	8	tfor:TF0832|5end_conserved_hypothetical_protein_888466..888696_POSITIVE
306	289	245	128	88	tfor:TF0321|5end_glycosyltransferase_347438..347668_POSITIVE
305	288	250	163	131	tfor:TF2789|5end_enoyl-[acyl-carrier-protein]_reductase_2972431..2972661_POSITIVE
303	208	164	203	156	tfor:TF3156|5end_conserved_hypothetical_protein_3391364..3391594_POSITIVE
299	318	272	112	65	tfor:TF1734|5end_conserved_hypothetical_protein_1856556..1856786_POSITIVE
299	265	224	231	196	tfor:TF0697|5end_glycerol-3-phosphate_cytidyltransferase_740667..740897_POSITIVE
297	228	181	55	11	tfor:TF2879|5end_tRNA_(guanine-N-1)-methyltransferase_3068254..3068484_POSITIVE
296	213	172	87	38	tfor:TF2833|5end_lipid_A_disaccharide_synthase_3023973..3024203_POSITIVE
296	299	253	47	7	tfor:TF2705|5end_conserved_hypothetical_protein;_possible_SufE_Fe/S-cluster-related_protein_2876850..2877080_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
337	220	172	149	97	tfor:TF1041|3end_dihydroorotate_dehydrogenase,_catalytic_subunit_1103020..1103170_POSITIVE
335	47	4	63	21	tfor:TF1298|3end_possible_membrane_protein_1381197..1381347_POSITIVE
329	288	248	50	10	tfor:TF2274|3end_conserved_hypothetical_protein_2436986..2437136_POSITIVE
322	300	262	103	54	tfor:TF0324|3end_conserved_hypothetical_protein_351997..352147_POSITIVE
311	290	248	53	4	tfor:TF0328|3end_conserved_hypothetical_protein_355266..355416_POSITIVE
309	217	172	151	106	tfor:TF1954|3end_long-chain-fatty-acid--CoA_ligase_2106940..2107090_POSITIVE
308	234	193	147	105	tfor:TF1327|3end_L-fucose_permease_1407195..1407345_POSITIVE
306	289	245	128	88	tfor:TF0320|3end_dihydroorotase_347518..347668_POSITIVE
293	266	233	64	27	tfor:TF2159|3end_conserved_hypothetical_protein_2336076..2336226_POSITIVE
292	82	52	88	54	tfor:TF3133|3end_conserved_hypothetical_protein_3369913..3370063_POSITIVE
291	50	8	97	43	tfor:TF2129|3end_possible_3-oxoacyl-(acyl-carrier-protein)_synthase_2306569..2306719_POSITIVE
290	108	61	103	52	tfor:TF2916|3end_conserved_hypothetical_protein_3112178..3112328_POSITIVE
290	289	250	129	91	tfor:TF1832|3end_3-isopropylmalate_dehydratase,_small_subunit_1981502..1981652_POSITIVE
287	49	6	59	23	tfor:TF1717|3end_DNA_mismatch_repair_protein_1840494..1840644_POSITIVE
286	309	261	59	6	tfor:TF2374|3end_UDP-3-O-(R-3-hydoxymyristoyl)-glucosamine-N-acylt_ransferase_2540892..2541042_POSITIVE
284	228	182	99	41	tfor:TF2930|3end_glutamyl-tRNA_synthetase_3134352..3134502_POSITIVE
284	313	272	134	75	tfor:TF0784|3end_possible_biopolymer_transport_protein_837881..838031_POSITIVE
283	218	172	149	109	tfor:TF3127|3end_acetyltransferase,_possible_GNAT_family_3362234..3362384_POSITIVE
281	230	194	55	9	tfor:TF0423|3end_G:T/U_mismatch-specific_DNA_glycosylase_439281..439431_POSITIVE
279	149	101	87	30	tfor:TF2907|3end_CDP-diacylglycerol-serine-O-phosphatidyltransfera_se_3103681..3103831_POSITIVE