Origin IGS: taaaatagccagagagaaattggtctctctggcacatcctaaaaaatcattacccacgaggtgggtatggatcgttaccatacgaatcacgttctcttatgtgtccattacgaccatggattaaaagttcggattgttgattccttgagatttcacgggctatcgctatcgcttccgcttgagtatcaaaggtataagttagctttgagttattttctcctcttactccccatcgtccatttttaggaactacatgctgattttttcccattctttacaccccctttctgaaatatgatttgtcagaaaatttatctccaacacatttcttttctattgtatgcaaaaaatacgccattctttca .........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9 tgaaagaatggcgtattttttgcatacaatagaaaagaaatgtgttggagataaattttctgacaaatcatatttcagaaagggggtgtaaagaatgggaaaaaatcagcatgtagttcctaaaaatggacgatggggagtaagaggagaaaataactcaaagctaacttatacctttgatactcaagcggaagcgatagcgatagcccgtgaaatctcaaggaatcaacaatccgaacttttaatccatggtcgtaatggacacataagagaacgtgattcgtatggtaacgatccatacccacctcgtgggtaatgattttttaggatgtgccagagagaccaatttctctctggctatttta Mask Tandem Repeat Region ================================================ taaaatagccagagagaaattggtctctctggcacatcctaaaaaatcattacccacgaggtgggtatggatcgttaccatacgaatcacgttctcttatgtgtccattacgaccatggattaaaagttcggattgttgattccttgagatttcacgggctatcgctatcgcttccgcttgagtatcaaaggtataagttagctttgagttattttctcctcttactccccatcgtccatttttaggaactacatgctgattttttcccattctttacaccccctttctgaaatatgatttgtcagaaaatttatctccaacacatttcttttctattgtatgcaaaaaatacgccattctttca Find is-nt database================================================ Query_seq: TF2961:TF2962|TF2961:TF2962:type I restriction enzyme:integrase/recombinase:->->:3173434..3173798 365 taaaatagccagagagaaattggtctctctggcacatcctaaaaaatcattacccacgaggtgggtatggatcgttaccatacgaatcacgttctcttatgtgtccattacgaccatggattaaaagttcggattgttgattccttgagatttcacgggctatcgctatcgcttccgcttgagtatcaaaggtataagttagctttgagttattttctcctcttactccccatcgtccatttttaggaactacatgctgattttttcccattctttacaccccctttctgaaatatgatttgtcagaaaatttatctccaacacatttcttttctattgtatgcaaaaaatacgccattctttca Intra-Species Hit: Count: 0 Inter-species Hit: Count: 0 Find is-aa database================================================ Query_seq: TF2961:TF2962|TF2961:TF2962:type I restriction enzyme:integrase/recombinase:->->:3173434..3173798 365 taaaatagccagagagaaattggtctctctggcacatcctaaaaaatcattacccacgaggtgggtatggatcgttaccatacgaatcacgttctcttatgtgtccattacgaccatggattaaaagttcggattgttgattccttgagatttcacgggctatcgctatcgcttccgcttgagtatcaaaggtataagttagctttgagttattttctcctcttactccccatcgtccatttttaggaactacatgctgattttttcccattctttacaccccctttctgaaatatgatttgtcagaaaatttatctccaacacatttcttttctattgtatgcaaaaaatacgccattctttca Intra-Species Hit: Count: 0 Inter-species Hit: Count: 0 Find nr database================================================ Query_seq: TF2961:TF2962|TF2961:TF2962:type I restriction enzyme:integrase/recombinase:->->:3173434..3173798 365 taaaatagccagagagaaattggtctctctggcacatcctaaaaaatcattacccacgaggtgggtatggatcgttaccatacgaatcacgttctcttatgtgtccattacgaccatggattaaaagttcggattgttgattccttgagatttcacgggctatcgctatcgcttccgcttgagtatcaaaggtataagttagctttgagttattttctcctcttactccccatcgtccatttttaggaactacatgctgattttttcccattctttacaccccctttctgaaatatgatttgtcagaaaatttatctccaacacatttcttttctattgtatgcaaaaaatacgccattctttca Intra-Species Hit: Count: 0 Inter-species Hit: Count: 28 Min: 53 Max: 274 Len: 222 Subject: UniRef90_Q0LXM9 Cluster: Hypothetical protein; n=1; Caulobacter sp. K31|Rep: Hypothetical protein - Caulobacter sp. K31 HSP 1 e-value: 2.0E-17 bit: 90.5 Len: 219 Query Start:53 Query End:271 Subject Strand: null Subject Start: 1 Subject End: 73 .................................................... M G K N Q H V V P K N G R W G V R G E N N S K L T Y T F D T Q X X X X X X X X X I S R N Q Q S E L L I H G R N G H I R E R D S Y G N D P Y P P R G .............................................................................................. .................................................... M G K N Q H V V P H D G A W A V R G A G N S R V T S I H D T Q A E A Q A A A R G I A I N Q Q S E V V I H R P N G Q I R D K D S Y G H D P F P P R G .............................................................................................. Subject: UniRef90_UPI000039AAED Cluster: hypothetical protein Hflu203000542; n=1; Haemophilus influenzae R2866|Rep: hypothetical protein Hflu203000542 - Haemophilus influenzae R2866 HSP 1 e-value: 3.0E-17 bit: 89.7 Len: 216 Query Start:56 Query End:271 Subject Strand: null Subject Start: 1 Subject End: 72 ....................................................... M G K N Q H V V P K N G R W G V R G E N N S K L T Y T F D T Q X X X X X X X X X I S R N Q Q S E L L I H G R N G H I R E R D S Y G N D P Y P P R .............................................................................................. ....................................................... M G K N Q H V V P H N G K W A V R G A G N E K V T R V V N T Q A E A I K I A Q D I A K N Q Q S D T K I H G R D G Q I R A G N S Y G N D P Y P P K .............................................................................................. Subject: UniRef90_A1U030 Cluster: Hypothetical protein; n=1; Marinobacter aquaeolei VT8|Rep: Hypothetical protein - Marinobacter aquaeolei (strain ATCC 700491 / DSM 11845 / VT8)(Marinobacter hydrocarbonoclasticus (strain DSM 11845)) HSP 1 e-value: 5.0E-17 bit: 89.0 Len: 216 Query Start:53 Query End:268 Subject Strand: null Subject Start: 3 Subject End: 74 .................................................... G K N Q H V V P K N G R W G V R G E N N S K L T Y T F D T Q X X X X X X X X X I S R N Q Q S E L L I H G R N G H I R E R D S Y G N D P Y P P R G ................................................................................................. .................................................... G K N Q H V V Q R E N G W A V R G E G N S R D T S H H S T Q A E A A E A A R E I A R R Q E S E V L I H G R D G R I R E R D S Y G N D P F P P K G ................................................................................................. Subject: UniRef90_Q1M9J5 Cluster: Hypothetical protein; n=1; Rhizobium leguminosarum bv. viciae 3841|Rep: Hypothetical protein - Rhizobium leguminosarum bv. viciae (strain 3841) HSP 1 e-value: 3.0E-16 bit: 86.3 Len: 213 Query Start:53 Query End:265 Subject Strand: null Subject Start: 4 Subject End: 74 .................................................... K N Q H V V P K N G R W G V R G E N N S K L T Y T F D T Q X X X X X X X X X I S R N Q Q S E L L I H G R N G H I R E R D S Y G N D P Y P P R G .................................................................................................... .................................................... K N Q H V V P H N G E W A V R G A G N Q R V T S T H G T Q A D A A A A A R K I A I N Q Q S E V V I H R P N G Q I R D K D S Y G R D P F P P R G .................................................................................................... Subject: UniRef90_Q8E115 Cluster: Hypothetical protein SAG0550; n=1; Streptococcus agalactiae serogroup V|Rep: Hypothetical protein SAG0550 - Streptococcus agalactiae serotype V HSP 1 e-value: 2.0E-15 bit: 83.6 Len: 219 Query Start:53 Query End:271 Subject Strand: null Subject Start: 1 Subject End: 74 .................................................... M G K N Q H V V P K - N G R W G V R G E N N S K L T Y T F D T Q X X X X X X X X X I S R N Q Q S E L L I H G R N G H I R E R D S Y G N D P Y P P R G .............................................................................................. .................................................... M A K N Q H V V P N P N G G W D I K G A G N S R A T K H T T T Q A E A V E I A T G I A K N N S S E V I I H G K N G R I R E R N S Y G N D P F P P K G .............................................................................................. Subject: UniRef90_A4BER7 Cluster: Hypothetical protein; n=1; Reinekea sp. MED297|Rep: Hypothetical protein - Reinekea sp. MED297 HSP 1 e-value: 6.0E-15 bit: 82.0 Len: 216 Query Start:53 Query End:268 Subject Strand: null Subject Start: 71 Subject End: 142 .................................................... G K N Q H V V P K N G R W G V R G E N N S K L T Y T F D T Q X X X X X X X X X I S R N Q Q S E L L I H G R N G H I R E R D S Y G N D P Y P P R G ................................................................................................. .................................................... G K N Q H V V K R D D G W A V K G A G N K K D T S H H R T Q E E A R Q A A V E I A R N Q K S E V V I H G R D G K I R D K D S Y G N D P H P P K G ................................................................................................. Subject: UniRef90_A3TZZ9 Cluster: Hypothetical protein; n=1; Oceanicola batsensis HTCC2597|Rep: Hypothetical protein - Oceanicola batsensis HTCC2597 HSP 1 e-value: 8.0E-15 bit: 81.6 Len: 213 Query Start:53 Query End:265 Subject Strand: null Subject Start: 8 Subject End: 78 .................................................... K N Q H V V P K N G R W G V R G E N N S K L T Y T F D T Q X X X X X X X X X I S R N Q Q S E L L I H G R N G H I R E R D S Y G N D P Y P P R G .................................................................................................... .................................................... K N Q H V V P H K D G W A V K G A G N A K A T A I H P T Q Q S A I T Q A R D I A R N Q G S E M L V H G T N G R I R E R N T Y G K D P Y P P E G .................................................................................................... Subject: UniRef90_A1WRV2 Cluster: Hypothetical protein; n=1; Verminephrobacter eiseniae EF01-2|Rep: Hypothetical protein - Verminephrobacter eiseniae (strain EF01-2) HSP 1 e-value: 2.0E-14 bit: 80.1 Len: 216 Query Start:53 Query End:268 Subject Strand: null Subject Start: 3 Subject End: 74 .................................................... G K N Q H V V P K N G R W G V R G E N N S K L T Y T F D T Q X X X X X X X X X I S R N Q Q S E L L I H G R N G H I R E R D S Y G N D P Y P P R G ................................................................................................. .................................................... G K N Q H V V P H Q D G W A V K G A G N Q R A T S V H D T Q Q Q A I D A G R D I A R N Q Q S E L V I H R P D G R I R D K D S H G N D S F P P K G ................................................................................................. Subject: UniRef90_A3DEK0 Cluster: Hypothetical protein; n=1; Clostridium thermocellum ATCC 27405|Rep: Hypothetical protein - Clostridium thermocellum (strain ATCC 27405 / DSM 1237) HSP 1 e-value: 1.0E-13 bit: 77.8 Len: 216 Query Start:56 Query End:271 Subject Strand: null Subject Start: 4 Subject End: 75 ....................................................... M G K N Q H V V P K N G R W G V R G E N N S K L T Y T F D T Q X X X X X X X X X I S R N Q Q S E L L I H G R N G H I R E R D S Y G N D P Y P P R .............................................................................................. ....................................................... M G K N Q W V V R H G D K W A V K G E G N E R A T K V T D T Q K Q A I N V A K G I A Q N Q K S E L I I Q G R D G K I R S K D S Y G N D P C P P K .............................................................................................. Subject: UniRef90_A3SS41 Cluster: Hypothetical protein; n=2; Roseovarius|Rep: Hypothetical protein - Roseovarius nubinhibens ISM HSP 1 e-value: 2.0E-13 bit: 77.0 Len: 213 Query Start:53 Query End:265 Subject Strand: null Subject Start: 4 Subject End: 74 .................................................... K N Q H V V P K N G R W G V R G E N N S K L T Y T F D T Q X X X X X X X X X I S R N Q Q S E L L I H G R N G H I R E R D S Y G N D P Y P P R G .................................................................................................... .................................................... K N Q H V V P H E S G W A V K G A G N S R A S S V H G T Q R E A I T A A R E S A I R Q G S E M L I H G E N G R I R E R N T Y G K D P Y P P K G .................................................................................................... Subject: UniRef90_Q1NB80 Cluster: Hypothetical protein; n=1; Sphingomonas sp. SKA58|Rep: Hypothetical protein - Sphingomonas sp. SKA58 HSP 1 e-value: 2.0E-12 bit: 73.6 Len: 213 Query Start:53 Query End:265 Subject Strand: null Subject Start: 4 Subject End: 74 .................................................... K N Q H V V P K N G R W G V R G E N N S K L T Y T F D T Q X X X X X X X X X I S R N Q Q S E L L I H G R N G H I R E R D S Y G N D P Y P P R G .................................................................................................... .................................................... K G Q H V V P T E R G W S V K K A G S A K S T S V H A T Q A E A I A A A T L I A R N Q K T E L Y I H G R D G R I R E R N S Y G S D P H P P K G .................................................................................................... Subject: UniRef90_Q4ANP8 Cluster: Hypothetical protein; n=1; Chlorobium phaeobacteroides BS1|Rep: Hypothetical protein - Chlorobium phaeobacteroides BS1 HSP 1 e-value: 1.0E-11 bit: 71.2 Len: 213 Query Start:56 Query End:268 Subject Strand: null Subject Start: 20 Subject End: 90 ....................................................... G K N Q H V V P K N G R W G V R G E N N S K L T Y T F D T Q X X X X X X X X X I S R N Q Q S E L L I H G R N G H I R E R D S Y G N D P Y P P R ................................................................................................. ....................................................... G K N Q H V V K H P D G W A V K G A G N S K A T K V T R T Q A Q A I D K A E N I A R N Q Q S D T K I H G E N G R I R A G N S Y G N D S C P P R ................................................................................................. Subject: UniRef90_A1VX17 Cluster: Hypothetical protein; n=1; Polaromonas naphthalenivorans CJ2|Rep: Hypothetical protein - Polaromonas naphthalenivorans (strain CJ2) HSP 1 e-value: 7.0E-10 bit: 65.1 Len: 198 Query Start:53 Query End:250 Subject Strand: null Subject Start: 1 Subject End: 66 .................................................... V P K N G R W G V R G E N N S K L T Y T F D T Q X X X X X X X X X I S R N Q Q S E L L I H G R N G H I R E R D S Y G N D P Y P P R G ................................................................................................................... .................................................... M P H Q D G W A V R G A G A E R A T E T F D R K T D A V Q R G R E I S Q N Q G T E L V I H G R D G Q I Q S K D S H G H D P F P P K G ................................................................................................................... Subject: UniRef90_A3U021 Cluster: Hypothetical protein; n=1; Oceanicola batsensis HTCC2597|Rep: Hypothetical protein - Oceanicola batsensis HTCC2597 HSP 1 e-value: 6.0E-9 bit: 62.0 Len: 219 Query Start:53 Query End:271 Subject Strand: null Subject Start: 1 Subject End: 73 .................................................... M G K N Q H V V P K N G R W G V R G E N N S K L T Y T F D T Q X X X X X X X X X I S R N Q Q S E L L I H G R N G H I R E R D S Y G N D P Y P P R G .............................................................................................. .................................................... M S K R I H V V P H G D G W A A R R E G A T R V G S T H A T Q A E A T A A A R T T A I R E R G E V V I H R P N G Q I R D A N S Y G N D P Y P P K G .............................................................................................. Subject: UniRef90_Q2N508 Cluster: Hypothetical protein; n=1; Desulfococcus multivorans|Rep: Hypothetical protein - Desulfococcus multivorans HSP 1 e-value: 8.0E-9 bit: 61.6 Len: 210 Query Start:53 Query End:262 Subject Strand: null Subject Start: 7 Subject End: 77 .................................................... N Q H V V P K - N G R W G V R G E N N S K L T Y T F D T Q X X X X X X X X X I S R N Q Q S E L L I H G R N G H I R E R D S Y G N D P Y P P R G ....................................................................................................... .................................................... S H H V V P N A D G G W D V K K D G A T R S S G H F D K K Q E A V D A G R K I S Q N Q G T E F Y I H G K D G K I Q N K D S H G N D P Y P P K G ....................................................................................................... Subject: UniRef90_Q0KQV1 Cluster: Hypothetical protein; n=1; Shewanella baltica OS195|Rep: Hypothetical protein - Shewanella baltica OS195 HSP 1 e-value: 1.0E-8 bit: 60.8 Len: 213 Query Start:53 Query End:265 Subject Strand: null Subject Start: 4 Subject End: 75 .................................................... K N Q H V V P K N - G R W G V R G E N N S K L T Y T F D T Q X X X X X X X X X I S R N Q Q S E L L I H G R N G H I R E R D S Y G N D P Y P P R G .................................................................................................... .................................................... K S T H V V P N S D G G W D I K Q S G G Q R S S G H F E T K Q D A V D R A R E I S R N Q E T E L V I H N K D G Q I G G K D S H G K D P F P P K G .................................................................................................... Subject: UniRef90_Q72BD2 Cluster: Hypothetical protein; n=1; Desulfovibrio vulgaris subsp. vulgaris str. Hildenborough|Rep: Hypothetical protein - Desulfovibrio vulgaris (strain Hildenborough / ATCC 29579 / NCIMB8303) HSP 1 e-value: 2.0E-8 bit: 60.5 Len: 219 Query Start:53 Query End:271 Subject Strand: null Subject Start: 1 Subject End: 75 .................................................... M G K N Q H - V V P K - N G R W G V R G E N N S K L T Y T F D T Q X X X X X X X X X I S R N Q Q S E L L I H G R N G H I R E R D S Y G N D P Y P P R G .............................................................................................. .................................................... M S R D T H R V M P H P D G G W Q I K R D G D Q R A S H R G D T Q S G L I D T A R E I S R N Q G T E L Q I H R P N G Q I R Q S D S H G N D P H P P K G .............................................................................................. Subject: UniRef90_Q07NS5 Cluster: Hypothetical protein; n=1; Rhodopseudomonas palustris BisA53|Rep: Hypothetical protein - Rhodopseudomonas palustris (strain BisA53) HSP 1 e-value: 2.0E-8 bit: 60.5 Len: 219 Query Start:53 Query End:271 Subject Strand: null Subject Start: 1 Subject End: 73 .................................................... M G K N Q H V V P K N G R W G V R G E N N S K L T Y T F D T Q X X X X X X X X X I S R N Q Q S E L L I H G R N G H I R E R D S Y G N D P Y P P R G .............................................................................................. .................................................... M S K R I H V V P H D S G W A T R R E G A S R V G T T H G T Q A Q A T E S A R N T A I R E R G E V V V H R P D G R I R D A N S Y G N D P F P P K G .............................................................................................. Subject: UniRef90_Q8NPK6 Cluster: Hypothetical protein Cgl1806; n=1; Corynebacterium glutamicum|Rep: Hypothetical protein Cgl1806 - Corynebacterium glutamicum (Brevibacterium flavum) HSP 1 e-value: 2.0E-8 bit: 60.1 Len: 213 Query Start:53 Query End:265 Subject Strand: null Subject Start: 4 Subject End: 74 .................................................... K N Q H V V P K N G R W G V R G E N N S K L T Y T F D T Q X X X X X X X X X I S R N Q Q S E L L I H G R N G H I R E R D S Y G N D P Y P P R G .................................................................................................... .................................................... R N I T T V R T E D G W G N R R D N A S R L S K S F D T Q S E A I A A A K V T A Q R E K L E H R I Q G R D G K I R E A N S Y G N D P H P P K G .................................................................................................... Subject: UniRef90_A1H312 Cluster: Hypothetical protein; n=1; Parvibaculum lavamentivorans DS-1|Rep: Hypothetical protein - Parvibaculum lavamentivorans DS-1 HSP 1 e-value: 2.0E-8 bit: 60.1 Len: 219 Query Start:53 Query End:271 Subject Strand: null Subject Start: 1 Subject End: 73 .................................................... M G K N Q H V V P K N G R W G V R G E N N S K L T Y T F D T Q X X X X X X X X X I S R N Q Q S E L L I H G R N G H I R E R D S Y G N D P Y P P R G .............................................................................................. .................................................... M S K R I H V V P H D S G W A T R R E G T S R A G S T H E T Q A Q A T E A A R S T A I R E R G E V I I H R P D G R I R D A N S Y G T D P F P P K G .............................................................................................. Subject: UniRef90_Q89Y84 Cluster: Bsr0071 protein; n=1; Bradyrhizobium japonicum|Rep: Bsr0071 protein - Bradyrhizobium japonicum HSP 1 e-value: 9.0E-8 bit: 58.2 Len: 219 Query Start:53 Query End:271 Subject Strand: null Subject Start: 1 Subject End: 73 .................................................... M G K N Q H V V P K N G R W G V R G E N N S K L T Y T F D T Q X X X X X X X X X I S R N Q Q S E L L I H G R N G H I R E R D S Y G N D P Y P P R G .............................................................................................. .................................................... M S K R I H V V P H E S G W A T R R E G A L R V G S T H H T Q A E A T E A A R S T A L R E H G E V V I H R P D G R I R D A N S Y G N D P F P P K G .............................................................................................. Subject: UniRef90_A0Q5T5 Cluster: Hypothetical protein; n=1; Francisella tularensis subsp. novicida U112|Rep: Hypothetical protein - Francisella tularensis subsp. novicida (strain U112) HSP 1 e-value: 2.0E-7 bit: 57.0 Len: 219 Query Start:56 Query End:274 Subject Strand: null Subject Start: 6 Subject End: 78 ....................................................... R M G K N Q H V V P K N G R W G V R G E N N S K L T Y T F D T Q X X X X X X X X X I S R N Q Q S E L L I H G R N G H I R E R D S Y G N D P Y P P R ........................................................................................... ....................................................... K R G K N Q F V V K H P D G W A V K G A N N K R A T I V T K T Q K D S I E R A N K I A K N Q K S D T K I Q G R D A K F R G G N S Y G N D S C P P K ........................................................................................... Subject: UniRef90_A3X0C6 Cluster: Hypothetical protein; n=1; Nitrobacter sp. Nb-311A|Rep: Hypothetical protein - Nitrobacter sp. Nb-311A HSP 1 e-value: 3.0E-7 bit: 56.2 Len: 204 Query Start:53 Query End:256 Subject Strand: null Subject Start: 11 Subject End: 79 .................................................... H V V P K - N G R W G V R G E N N S K L T Y T F D T Q X X X X X X X X X I S R N Q Q S E L L I H G R N G H I R E R D S Y G N D P Y P P R G ............................................................................................................. .................................................... H V V P S P G G G W N V K R G G A A R A S G H F D T K R E A I S Q G R E V S R S Q G T E L R I H N R D G R I G Q S D S H G R D P N P P R G ............................................................................................................. Subject: UniRef90_Q46QV4 Cluster: Hypothetical protein; n=1; Ralstonia eutropha JMP134|Rep: Hypothetical protein - Ralstonia eutropha (strain JMP134) (Alcaligenes eutrophus) HSP 1 e-value: 1.0E-6 bit: 54.7 Len: 192 Query Start:77 Query End:268 Subject Strand: null Subject Start: 3 Subject End: 65 ............................................................................ G K N Q H V V P K N G R W G V R G E N N S K L T Y T F D T Q X X X X X X X X X I S R N Q Q S E L L I H G R N G H I R E R D S Y G ................................................................................................. ............................................................................ G K N V H V V P A H D G W A V E S E A G G P - R Q L F D S Q E Q A I A A G T E K A R H D Q A E L L I H G R D G Q I R E R N S L G ................................................................................................. Subject: UniRef90_A3JKY0 Cluster: Hypothetical protein; n=1; Marinobacter sp. ELB17|Rep: Hypothetical protein - Marinobacter sp. ELB17 HSP 1 e-value: 1.0E-6 bit: 54.7 Len: 210 Query Start:56 Query End:265 Subject Strand: null Subject Start: 4 Subject End: 74 ....................................................... K N Q H V V P K - N G R W G V R G E N N S K L T Y T F D T Q X X X X X X X X X I S R N Q Q S E L L I H G R N G H I R E R D S Y G N D P Y P P R .................................................................................................... ....................................................... K T H Q V V P N P D G G W D L K K G G G E R A I K H F D T K Q N A V D Y G R E V S R N Q E S E F V V H K K D G S I Q N P D S H G N D P M P P K .................................................................................................... Subject: UniRef90_Q475E2 Cluster: Hypothetical protein; n=1; Ralstonia eutropha JMP134|Rep: Hypothetical protein - Ralstonia eutropha (strain JMP134) (Alcaligenes eutrophus) HSP 1 e-value: 1.0E-6 bit: 54.3 Len: 204 Query Start:53 Query End:256 Subject Strand: null Subject Start: 7 Subject End: 74 .................................................... H V V P K N G R W G V R G E N N S K L T Y T F D T Q X X X X X X X X X I S R N Q Q S E L L I H G R N G H I R E R D S Y G N D P Y P P R G ............................................................................................................. .................................................... H V V P A Q E G W A V E E A S H P S G R K L F A T Q E D A I A V A T E M A R Q R K S E L F I H G R D G Q I R S R S S F G N D P R N V R G ............................................................................................................. Subject: UniRef90_Q0G7M6 Cluster: Hypothetical protein; n=1; Fulvimarina pelagi HTCC2506|Rep: Hypothetical protein - Fulvimarina pelagi HTCC2506 HSP 1 e-value: 2.0E-6 bit: 53.9 Len: 210 Query Start:56 Query End:265 Subject Strand: null Subject Start: 5 Subject End: 75 ....................................................... K N Q H V V P K N - G R W G V R G E N N S K L T Y T F D T Q X X X X X X X X X I S R N Q Q S E L L I H G R N G H I R E R D S Y G N D P Y P P R .................................................................................................... ....................................................... K N Y H V V P S S K G G W D V K R G G S Q R A S G H F D T K T P A M S R A R E L A Q K A G V E R V E H K R D G K I R D S D S Y G N D P C P P R .................................................................................................... Subject: UniRef90_Q3JF59 Cluster: Hypothetical protein; n=1; Nitrosococcus oceani ATCC 19707|Rep: Hypothetical protein - Nitrosococcus oceani (strain ATCC 19707 / NCIMB 11848) HSP 1 e-value: 6.0E-6 bit: 52.0 Len: 210 Query Start:56 Query End:265 Subject Strand: null Subject Start: 4 Subject End: 73 ....................................................... K N Q H V V P K N G R W G V R G E N N S K L T Y T F D T Q X X X X X X X X X I S R N Q Q S E L L I H G R N G H I R E R D S Y G N D P Y P P R .................................................................................................... ....................................................... R D Y H V V P R N K Q W A I Q K E G K D R A S S L H R T Q K D A S N E G R R L A K K N Q T A L V I H R C D G R I R D S H S Y E N N P H P P K .................................................................................................... taaaatagccagagagaaattggtctctctggcacatcctaaaaaatcattannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnttacaccccctttctgaaatatgatttgtcagaaaatttatctccaacacatttcttttctattgtatgcaaaaaatacgccattctttca Predict ORF larger than 30AA ================================================ Protein_Len: 39 Strand: + Start: 5 End: 121 .... M A R E K L V S L A H P K K S L P T R W V W I V T I R I T F S Y V S I T T M D .................................................................................................................................................................................................................................................... Protein_Len: 34 Strand: + Start: 36 End: 137 ................................... M L K N H Y P R G G Y G S L P Y E S R S L M C P L R P W I K S S D C .................................................................................................................................................................................................................................... Protein_Len: 60 Strand: + Start: 46 End: 243 ............................................. M I T H E V G M D R Y H T N H V L L C V H Y D H G L K V R I V D S L R F H G L S L S L P L E Y Q R Y K L A L S Y F L L L .......................................................................................................................... Protein_Len: 32 Strand: + Start: 270 End: 365 ............................................................................................................................................................................................................................................................................. M L Y T P F L K Y D L S E N L S P T H F F S I V C K K Y A I L S Protein_Len: 60 Strand: - Start: 53 End: 271 .................................................... E R I H G N R G H I L L E S Q Q N R S I E R A I A I A E A Q T D F T Y T L K S N N E G R V G W R G N K P V V H Q N K G M .............................................................................................. Protein_Len: 30 Strand: - Start: 1 End: 90 L I A L S F N T E R A C G L F D N G V L H T H I T V M R I M ................................................................................................................................................................................................................................................................................... taaaatagccagagagaaattggtctctctggcacatcctaaaaaatcattannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnttacaccccctttctgaaatatgatttgtcagaaaatttatctccaacacatttcttttctattgtatgcaaaaaatacgccattctttca Predict Promoter with matrix: RpoD-15 score > 80================================================ Predict Promoter with matrix: RpoD-16 score > 80================================================ Predict Promoter with matrix: RpoD-17 score > 80================================================ Predict Promoter with matrix: RpoD-18 score > 80================================================ Predict Promoter with matrix: RpoD-19 score > 80================================================ Predict Promoter with matrix: RpoN score > 80================================================ PromScan Matrix: RpoN Strand: - Score: 81 Start: 342 End: 358 .....................................................................................................................................................................................................................................................................................................................................................ATGGCGTATTTTTTGCA....... taaaatagccagagagaaattggtctctctggcacatcctaaaaaatcattannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnttacaccccctttctgaaatatgatttgtcagaaaatttatctccaacacatttcttttctattgtatgcaaaaaatacgccattctttca Predict TransTerm conf > 70================================================ TransTerm Strand: - Conf: 85 HP_score: -7.1 Tail_Score: -5.07567 Start: 47 End: 71 Full_Region: ttcgtatggtaacga tccatacccac ctc gtgggtaatga ttttttaggatgtgc ..............................................tccatacccacctcgtgggtaatga...................................................................................................................................................................................................................................................................................................... TransTerm Strand: - Conf: 73 HP_score: -8.1 Tail_Score: -3.63817 Start: 48 End: 69 Full_Region: cgtatggtaacgatc catacccac ctc gtgggtaatg attttttaggatgtg ...............................................catacccacctcgtgggtaatg........................................................................................................................................................................................................................................................................................................ TransTerm Strand: - Conf: 78 HP_score: -10.9 Tail_Score: -2.62513 Start: 51 End: 67 Full_Region: tatggtaacgatcca tacccac ctc gtgggta atgattttttaggat ..................................................tacccacctcgtgggta.......................................................................................................................................................................................................................................................................................................... TransTerm Strand: + Conf: 46 HP_score: -3.5 Tail_Score: -3.20905 Start: 186 End: 208 Full_Region: GCTTCCGCTTGAGTA TCAAAGGTA TAAGT TAGCTTTGA GTTATTTTCTCCTCT .........................................................................................................................................................................................TCAAAGGTATAAGTTAGCTTTGA............................................................................................................................................................. Find igs database================================================ Query_seq: TF2961:TF2962|TF2961:TF2962:type I restriction enzyme:integrase/recombinase:->->:3173434..3173798 365 taaaatagccagagagaaattggtctctctggcacatcctaaaaaatcattannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnttacaccccctttctgaaatatgatttgtcagaaaatttatctccaacacatttcttttctattgtatgcaaaaaatacgccattctttca Intra-Species Hit: Count: 1 Min: 1 Max: 365 Len: 365 Subject: tfor_TF2961_TF2962|type I restriction enzyme:integrase/recombinase|POSITIVE:POSITIVE|[3173434, 3173798]|365 HSP 1 e-value: 2.0E-44 bit: 180.0 Len: 91 Query Start:275 Query End:365 Subject Strand: POSITIVE Subject Start: 275 Subject End: 365 ..................................................................................................................................................................................................................................................................................ttacaccccctttctgaaatatgatttgtcagaaaatttatctccaacacatttcttttctattgtatgcaaaaaatacgccattctttca ..................................................................................................................................................................................................................................................................................ttacaccccctttctgaaatatgatttgtcagaaaatttatctccaacacatttcttttctattgtatgcaaaaaatacgccattctttca HSP 2 e-value: 4.0E-21 bit: 103.0 Len: 52 Query Start:1 Query End:52 Subject Strand: POSITIVE Subject Start: 1 Subject End: 52 taaaatagccagagagaaattggtctctctggcacatcctaaaaaatcatta......................................................................................................................................................................................................................................................................................................................... taaaatagccagagagaaattggtctctctggcacatcctaaaaaatcatta......................................................................................................................................................................................................................................................................................................................... Inter-species Hit: Count: 0 Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================ UAAAAUAGCCAGAGAGAAAUUGGUCUCUCUGGCACAUCCUAAAAAAUCAUUACCCACGAGGUGGGUAUGGAUCGUUACCAUACGAAUCACGUUCUCUUAUGUGUCCAUUACGACCAUGGAUUAAAAGUUCGGAUUGUUGAUUCCUUGAGAUUUCACGGGCUAUCGCUAUCGCUUCCGCUUGAGUAUCAAAGGUAUAAGUUAGCUUUGAGUUAUUUUCUCCUCUUACUCCCCAUCGUCCAUUUUUAGGAACUACAUGCUGAUUUUUUCCCAUUCUUUACACCCCCUUUCUGAAAUAUGAUUUGUCAGAAAAUUUAUCUCCAACACAUUUCUUUUCUAUUGUAUGCAAAAAAUACGCCAUUCUUUCA .......((((((((((......))))))))))...(((((((((.....(((((((...))))))).(((((((......))))..(((((......)))))))).....(((.((((...........(((........)))..((((.....(((((....((....))....)))))....((((((.((.....)).)))))).......))))..........)))).)))..)))))))))....(((((.((.....)).................(((((((...........))))))).............................)))))...................... (-79.10) Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================ UGAAAGAAUGGCGUAUUUUUUGCAUACAAUAGAAAAGAAAUGUGUUGGAGAUAAAUUUUCUGACAAAUCAUAUUUCAGAAAGGGGGUGUAAAGAAUGGGAAAAAAUCAGCAUGUAGUUCCUAAAAAUGGACGAUGGGGAGUAAGAGGAGAAAAUAACUCAAAGCUAACUUAUACCUUUGAUACUCAAGCGGAAGCGAUAGCGAUAGCCCGUGAAAUCUCAAGGAAUCAACAAUCCGAACUUUUAAUCCAUGGUCGUAAUGGACACAUAAGAGAACGUGAUUCGUAUGGUAACGAUCCAUACCCACCUCGUGGGUAAUGAUUUUUUAGGAUGUGCCAGAGAGACCAAUUUCUCUCUGGCUAUUUUA ...........(.(((((((((((..(.........(((((((((..((((.....))))..))).....)))))).......)..))))))))))).).((((((((.......((((((.......(((.(((((...((((((((((.......((((((.((.....)).))))))...(((.((....))....((....))...)))..))))..(((........)))...)))))).))))).)))...(((....))).)).))))..(..((((......))))..).(((((((...))))))).))))))))(((((((.((((((((((......))))))))))))))))) (-95.39) Find mRNA Target Using Conserved IGS================================================ 5'END mRNA Target Prediction=================================== Score srna_start srna_end target_start tegart_end seq_id 349 179 133 92 18 tfor:TF0761|5end_conserved_hypothetical_protein_806412..806642_POSITIVE 341 176 134 197 158 tfor:TF3003|5end_hypothetical_protein_3220382..3220612_POSITIVE 335 177 131 208 147 tfor:TF1250|5end_possible_cation_efflux_pump_1332324..1332554_POSITIVE 324 96 53 179 122 tfor:TF2265|5end_transfer_region-related_protein,_TraP;_DNA_primase_involved_in_conjugation_2433474..2433704_POSITIVE 319 187 141 50 6 tfor:TF2423|5end_papain_family_cysteine_protease_2601608..2601838_POSITIVE 319 219 176 159 120 tfor:TF1583|5end_conserved_hypothetical_protein;_possible_endonuclease_1689445..1689675_POSITIVE 318 198 156 67 24 tfor:TF2013|5end_polysaccharide_deacetylase_2168650..2168880_POSITIVE 316 185 157 229 198 tfor:TF0002|5end_hypothetical_protein_316..546_POSITIVE 314 179 132 142 80 tfor:TF2348|5end_outer_membrane_protein,_possibly_involved_in_nutrient_binding_2511088..2511318_POSITIVE 313 160 111 190 140 tfor:TF1398|5end_conserved_hypothetical_protein_1471474..1471704_POSITIVE 313 187 141 182 122 tfor:TF0283|5end_possible_nicotinamide_mononucleotide_transporter_311335..311565_POSITIVE 310 210 164 59 11 tfor:TF1259|5end_hypothetical_protein_1338549..1338779_POSITIVE 308 177 131 187 134 tfor:TF1236|5end_L-rhamnose_isomerase_1320743..1320973_POSITIVE 302 178 131 210 174 tfor:TF1292|5end_sensor_histidine_protein_kinase_1372567..1372797_POSITIVE 302 119 72 101 45 tfor:TF0426|5end_conserved_hypothetical_protein_444728..444958_POSITIVE 300 178 144 217 179 tfor:TF2332|5end_signal_peptidase_I_2491694..2491924_POSITIVE 300 197 155 79 28 tfor:TF0023|5end_possible_response_element_in_two_component_regulation_19446..19676_POSITIVE 299 177 135 69 16 tfor:TF3004|5end_phosphoribosylformylglycinamidine_(FGAM)_synthase_3220819..3221049_POSITIVE 298 96 53 224 179 tfor:TF0881|5end_conserved_hypothetical_protein_934459..934689_POSITIVE 297 180 134 226 172 tfor:TF1929|5end_conserved_hypothetical_protein_2076049..2076279_POSITIVE 3'END mRNA Target Prediction=================================== Score srna_start srna_end target_start tegart_end seq_id 329 33 8 83 58 tfor:TF2961|3end_type_I_restriction_enzyme_3173373..3173523_POSITIVE 319 219 176 101 62 tfor:TF1581|3end_hypothetical_protein_1689467..1689617_POSITIVE 318 198 156 57 14 tfor:TF2012|3end_conserved_hypothetical_protein_2168720..2168870_POSITIVE 314 179 132 66 4 tfor:TF2347|3end_outer_membrane_protein,_TonB_dependent_receptor_2511092..2511242_POSITIVE 313 187 141 143 83 tfor:TF0282|3end_probable_tonB-linked_outer_membrane_receptor_311376..311526_POSITIVE 304 180 131 104 60 tfor:TF0308|3end_hypothetical_protein_334082..334232_POSITIVE 302 70 21 109 58 tfor:TF3143|3end_conserved_hypothetical_protein;_possible_membrane_protein_3379227..3379377_POSITIVE 300 197 155 75 24 tfor:TF0022|3end_two-component_system_sensor_histidine_kinase_19522..19672_POSITIVE 298 96 53 56 11 tfor:TF0880|3end_conserved_hypothetical_protein_934371..934521_POSITIVE 297 166 129 36 6 tfor:TF1456|3end_GMP_synthase_1543287..1543437_POSITIVE 295 170 126 49 9 tfor:TF2444|3end_regulatory_protein_RecX_2621549..2621699_POSITIVE 295 97 56 53 14 tfor:TF1853|3end_homoserine_O-succinyltransferase_2007494..2007644_POSITIVE 293 178 146 107 75 tfor:TF0008|3end_hypothetical_protein_4336..4486_POSITIVE 289 207 163 148 108 tfor:TF3105|3end_hypothetical_protein_3338342..3338492_POSITIVE 289 178 131 148 105 tfor:TF1815|3end_conserved_hypothetical_protein_1957442..1957592_POSITIVE 288 259 211 133 75 tfor:TF2660|3end_hypothetical_protein_2833540..2833690_POSITIVE 288 181 141 127 80 tfor:TF1292|3end_sensor_histidine_protein_kinase_1374554..1374704_POSITIVE 287 260 219 62 24 tfor:TF2744|3end_methionyl-tRNA_formyltransferase_2927378..2927528_POSITIVE 287 80 31 110 45 tfor:TF2741|3end_ATP-dependent_DNA_helicase_RecQ_2923878..2924028_POSITIVE 286 177 131 106 60 tfor:TF2891|3end_lipoprotein_3079381..3079531_POSITIVE