Origin IGS:
taggttattacaaagagcccccttggggagaggagttgtgtgttttttataaaaaacaccaaaaaagatttgcattgtaaaaagaatccttttatctttgccacgttgtttagtatgattcgcttaactggtgataagcaaaatggaaacgaagtacggcagatataaaatccaattgacgtatattacatatgtacgcgaagaagcagacaggctctccgcgtaccgtaggtctccgtacctatgcacatccgaaggagaaaaaaaacgtgaaacaatataaccttgtaaaatggtaaaaaagatttattcattaaaaacaaatacgt
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
acgtatttgtttttaatgaataaatcttttttaccattttacaaggttatattgtttcacgttttttttctccttcggatgtgcataggtacggagacctacggtacgcggagagcctgtctgcttcttcgcgtacatatgtaatatacgtcaattggattttatatctgccgtacttcgtttccattttgcttatcaccagttaagcgaatcatactaaacaacgtggcaaagataaaaggattctttttacaatgcaaatcttttttggtgttttttataaaaaacacacaactcctctccccaagggggctctttgtaataaccta

Mask Tandem Repeat Region ================================================
taggttattacaaagagcccccttggggagaggagttgtgtgttttttataaaaaacaccaaaaaagatttgcattgtaaaaagaatccttttatctttgccacgttgtttagtatgattcgcttaactggtgataagcaaaatggaaacgaagtacggcagatataaaatccaattgacgtatattacatatgtacgcgaagaagcagacaggctctccgcgtaccgtaggtctccgtacctatgcacatccgaaggagaaaaaaaacgtgaaacaatataaccttgtaaaatggtaaaaaagatttattcattaaaaacaaatacgt

Find is-nt database================================================
Query_seq: TF2338:TF2339|TF2338:TF2339:conserved hypothetical protein:hypothetical protein:->->:2500067..2500395 329
taggttattacaaagagcccccttggggagaggagttgtgtgttttttataaaaaacaccaaaaaagatttgcattgtaaaaagaatccttttatctttgccacgttgtttagtatgattcgcttaactggtgataagcaaaatggaaacgaagtacggcagatataaaatccaattgacgtatattacatatgtacgcgaagaagcagacaggctctccgcgtaccgtaggtctccgtacctatgcacatccgaaggagaaaaaaaacgtgaaacaatataaccttgtaaaatggtaaaaaagatttattcattaaaaacaaatacgt
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: TF2338:TF2339|TF2338:TF2339:conserved hypothetical protein:hypothetical protein:->->:2500067..2500395 329
taggttattacaaagagcccccttggggagaggagttgtgtgttttttataaaaaacaccaaaaaagatttgcattgtaaaaagaatccttttatctttgccacgttgtttagtatgattcgcttaactggtgataagcaaaatggaaacgaagtacggcagatataaaatccaattgacgtatattacatatgtacgcgaagaagcagacaggctctccgcgtaccgtaggtctccgtacctatgcacatccgaaggagaaaaaaaacgtgaaacaatataaccttgtaaaatggtaaaaaagatttattcattaaaaacaaatacgt
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: TF2338:TF2339|TF2338:TF2339:conserved hypothetical protein:hypothetical protein:->->:2500067..2500395 329
taggttattacaaagagcccccttggggagaggagttgtgtgttttttataaaaaacaccaaaaaagatttgcattgtaaaaagaatccttttatctttgccacgttgtttagtatgattcgcttaactggtgataagcaaaatggaaacgaagtacggcagatataaaatccaattgacgtatattacatatgtacgcgaagaagcagacaggctctccgcgtaccgtaggtctccgtacctatgcacatccgaaggagaaaaaaaacgtgaaacaatataaccttgtaaaatggtaaaaaagatttattcattaaaaacaaatacgt
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

taggttattacaaagagcccccttggggagaggagttgtgtgttttttataaaaaacaccaaaaaagatttgcattgtaaaaagaatccttttatctttgccacgttgtttagtatgattcgcttaactggtgataagcaaaatggaaacgaagtacggcagatataaaatccaattgacgtatattacatatgtacgcgaagaagcagacaggctctccgcgtaccgtaggtctccgtacctatgcacatccgaaggagaaaaaaaacgtgaaacaatataaccttgtaaaatggtaaaaaagatttattcattaaaaacaaatacgt
Predict ORF larger than 30AA ================================================
Protein_Len: 53	Strand: +	Start: 7	End: 165
...... M  T  K  S  P  L  G  E  R  S  C  V  F  F  I  K  N  T  K  K  D  L  H  C  K  K  N  P  F  I  F  A  T  L  F  S  M  I  R  L  T  G  D  K  Q  N  G  N  E  V  R  Q  I ....................................................................................................................................................................
Protein_Len: 51	Strand: +	Start: 128	End: 280
............................................................................................................................... M  V  I  S  K  M  E  T  K  Y  G  R  Y  K  I  Q  L  T  Y  I  T  Y  V  R  E  E  A  D  R  L  S  A  Y  R  R  S  P  Y  L  C  T  S  E  G  E  K  K  R  E  T  I .................................................
Protein_Len: 38	Strand: +	Start: 183	End: 296
...................................................................................................................................................................................... M  L  H  M  Y  A  K  K  Q  T  G  S  P  R  T  V  G  L  R  T  Y  A  H  P  K  E  K  K  N  V  K  Q  Y  N  L  V  K  W .................................
Protein_Len: 45	Strand: -	Start: 189	End: 323
............................................................................................................................................................................................ M  H  V  R  L  L  L  C  A  R  R  T  G  Y  T  E  T  G  I  C  M  R  L  L  F  F  V  H  F  L  I  V  K  Y  F  P  L  F  S  K  N  M  L  F  M ......
Protein_Len: 60	Strand: -	Start: 127	End: 306
.............................................................................................................................. S  T  I  L  L  I  S  V  F  Y  P  L  Y  L  I  W  N  V  Y  I  V  Y  T  R  S  S  A  S  L  S  E  A  Y  R  L  D  G  Y  R  H  V  D  S  P  S  F  F  R  S  V  I  Y  G  Q  L  I  T  F  F  M .......................
Protein_Len: 58	Strand: -	Start: 3	End: 176
.. T  I  V  F  L  G  R  P  S  L  L  Q  T  N  K  I  F  F  V  L  F  S  K  C  Q  L  F  F  G  K  I  K  A  V  N  N  L  I  I  R  K  V  P  S  L  C  F  P  F  S  T  R  C  I  Y  F  G  M .........................................................................................................................................................

taggttattacaaagagcccccttggggagaggagttgtgtgttttttataaaaaacaccaaaaaagatttgcattgtaaaaagaatccttttatctttgccacgttgtttagtatgattcgcttaactggtgataagcaaaatggaaacgaagtacggcagatataaaatccaattgacgtatattacatatgtacgcgaagaagcagacaggctctccgcgtaccgtaggtctccgtacctatgcacatccgaaggagaaaaaaaacgtgaaacaatataaccttgtaaaatggtaaaaaagatttattcattaaaaacaaatacgt
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

taggttattacaaagagcccccttggggagaggagttgtgtgttttttataaaaaacaccaaaaaagatttgcattgtaaaaagaatccttttatctttgccacgttgtttagtatgattcgcttaactggtgataagcaaaatggaaacgaagtacggcagatataaaatccaattgacgtatattacatatgtacgcgaagaagcagacaggctctccgcgtaccgtaggtctccgtacctatgcacatccgaaggagaaaaaaaacgtgaaacaatataaccttgtaaaatggtaaaaaagatttattcattaaaaacaaatacgt
Predict TransTerm conf > 70================================================
TransTerm Strand: -	Conf: 61	HP_score: -7.2	Tail_Score: -2.98223	Start: 193	End: 227	Full_Region: ggtacggagacctac ggtacgcggagagc ctgtct gcttcttcgcgtaca tatgtaatatacgtc
................................................................................................................................................................................................ggtacgcggagagcctgtctgcttcttcgcgtaca......................................................................................................

Find igs database================================================
Query_seq: TF2338:TF2339|TF2338:TF2339:conserved hypothetical protein:hypothetical protein:->->:2500067..2500395 329
taggttattacaaagagcccccttggggagaggagttgtgtgttttttataaaaaacaccaaaaaagatttgcattgtaaaaagaatccttttatctttgccacgttgtttagtatgattcgcttaactggtgataagcaaaatggaaacgaagtacggcagatataaaatccaattgacgtatattacatatgtacgcgaagaagcagacaggctctccgcgtaccgtaggtctccgtacctatgcacatccgaaggagaaaaaaaacgtgaaacaatataaccttgtaaaatggtaaaaaagatttattcattaaaaacaaatacgt
Intra-Species Hit: Count: 1	Min: 1	Max: 260	Len: 260
Subject: tfor_TF2338_TF2339|conserved hypothetical protein:hypothetical protein|POSITIVE:POSITIVE|[2500067,2500395]|329
HSP  1	e-value: 1.0E-106	bit: 385.0	Len: 194	Query Start:67	Query End:260	Subject Strand: POSITIVE	Subject Start: 67	Subject End: 260
..................................................................gatttgcattgtaaaaagaatccttttatctttgccacgttgtttagtatgattcgcttaactggtgataagcaaaatggaaacgaagtacggcagatataaaatccaattgacgtatattacatatgtacgcgaagaagcagacaggctctccgcgtaccgtaggtctccgtacctatgcacatccgaaggag.....................................................................
..................................................................gatttgcattgtaaaaagaatccttttatctttgccacgttgtttagtatgattcgcttaactggtgataagcaaaatggaaacgaagtacggcagatataaaatccaattgacgtatattacatatgtacgcgaagaagcagacaggctctccgcgtaccgtaggtctccgtacctatgcacatccgaaggag.....................................................................
HSP  2	e-value: 6.0E-20	bit: 99.6	Len: 50	Query Start:1	Query End:50	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 50
taggttattacaaagagcccccttggggagaggagttgtgtgttttttat.......................................................................................................................................................................................................................................................................................
taggttattacaaagagcccccttggggagaggagttgtgtgttttttat.......................................................................................................................................................................................................................................................................................

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UAGGUUAUUACAAAGAGCCCCCUUGGGGAGAGGAGUUGUGUGUUUUUUAUAAAAAACACCAAAAAAGAUUUGCAUUGUAAAAAGAAUCCUUUUAUCUUUGCCACGUUGUUUAGUAUGAUUCGCUUAACUGGUGAUAAGCAAAAUGGAAACGAAGUACGGCAGAUAUAAAAUCCAAUUGACGUAUAUUACAUAUGUACGCGAAGAAGCAGACAGGCUCUCCGCGUACCGUAGGUCUCCGUACCUAUGCACAUCCGAAGGAG
..((((.........)))).((((((((((((...(((.((((((((....)))))))))))......(((((................((((((.((((((...(((((((.......(((((.....))))))))))))..((....))......)))))).)))))).....(((.(((((((.....))))))))))....)))))....))))))..((..(((((((......))))))).))..)).)))).. (-65.11)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
CUCCUUCGGAUGUGCAUAGGUACGGAGACCUACGGUACGCGGAGAGCCUGUCUGCUUCUUCGCGUACAUAUGUAAUAUACGUCAAUUGGAUUUUAUAUCUGCCGUACUUCGUUUCCAUUUUGCUUAUCACCAGUUAAGCGAAUCAUACUAAACAACGUGGCAAAGAUAAAAGGAUUCUUUUUACAAUGCAAAUCUUUUUUGGUGUUUUUUAUAAAAAACACACAACUCCUCUCCCCAAGGGGGCUCUUUGUAAUAACCUA
.(((....((((((((((.(((.(....).))).(((((((((((((......)).))))))))))).))))).....)))))....))).....(((((((((..............((((((((........))))))))...............))))..)))))..(((.......((((((.((.........(((((((((((....)))))))).))).......(((....)))))...))))))...))). (-67.45)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
442	238	196	126	83	tfor:TF1742|5end_TPR_repeat-containing_protein_1873129..1873359_POSITIVE
409	254	213	131	72	tfor:TF2187|5end_conserved_hypothetical_protein_2361693..2361923_POSITIVE
394	238	197	193	139	tfor:TF0955|5end_conserved_hypothetical_protein_999215..999445_POSITIVE
389	238	197	81	38	tfor:TF1935|5end_ATP-dependent_RNA_helicase,_DEAD/DEAH-related_helicase_2082002..2082232_POSITIVE
386	238	193	85	36	tfor:TF1003|5end_conserved_hypothetical_protein;_possible_secreted_glycosylhydrolase_1058177..1058407_POSITIVE
373	259	218	81	45	tfor:TF1137|5end_asparaginyl-tRNA_synthetase_(asparagine--tRNA_ligase)_1212443..1212673_POSITIVE
371	239	197	62	15	tfor:TF3055|5end_hypothetical_protein_3278775..3279005_POSITIVE
368	257	211	211	143	tfor:TF1350|5end_possible_transcriptional_regulator_1429639..1429869_POSITIVE
367	255	211	208	140	tfor:TF3149|5end_conserved_hypothetical_protein_3384424..3384654_POSITIVE
366	240	192	169	105	tfor:TF0819|5end_phosphoglycerate_mutase_878447..878677_POSITIVE
364	238	193	221	165	tfor:TF2345|5end_dGTP_triphosphohydrolase_2508372..2508602_POSITIVE
362	250	205	185	143	tfor:TF2789|5end_enoyl-[acyl-carrier-protein]_reductase_2972431..2972661_POSITIVE
360	228	194	179	140	tfor:TF1466|5end_DNA_gyrase_modulator_1555469..1555699_POSITIVE
358	257	220	152	116	tfor:TF1586|5end_hypothetical_protein_1690971..1691201_POSITIVE
358	254	217	187	138	tfor:TF0160|5end_conserved_hypothetical_protein;_possible_Fic_family_protein_170327..170557_POSITIVE
356	237	193	227	180	tfor:TF2364|5end_conserved_hypothetical_protein;_possible_DNA_binding_protein,_excisionase_family_2530362..2530592_POSITIVE
354	256	212	217	175	tfor:TF2044|5end_excinuclease_ABC,_subunit_A_2203228..2203458_POSITIVE
354	229	189	125	89	tfor:TF0463|5end_precorrin-6Y_C5,15-methyltransferase_479015..479245_POSITIVE
353	255	212	196	142	tfor:TF2655|5end_DNA_topoisomerase_I_2824543..2824773_POSITIVE
351	240	196	170	122	tfor:TF2229.1|5end_rteR_regulatory_ortholog_(with_internal_stop)_2399454..2399684_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
386	238	193	60	11	tfor:TF1002|3end_replicative_DNA_helicase_1058232..1058382_POSITIVE
371	239	197	96	49	tfor:TF3053|3end_conserved_hypothetical_protein_3278889..3279039_POSITIVE
356	237	193	65	18	tfor:TF2363|3end_conserved_hypothetical_protein_2530280..2530430_POSITIVE
354	229	189	125	89	tfor:TF0462|3end_possible_cobalamin_biosynthesis_precorrin-3_methylase_479095..479245_POSITIVE
353	255	212	132	78	tfor:TF2654|3end_arginyl-tRNA_synthetase_2824559..2824709_POSITIVE
343	236	194	102	60	tfor:TF0991|3end_probable_NAD(FAD)-dependent_dehydrogenase_1048334..1048484_POSITIVE
340	260	211	116	60	tfor:TF0825|3end_hypothetical_protein_883850..884000_POSITIVE
335	238	197	151	114	tfor:TF2046|3end_polyribonucleotide_nucleotidyltransferase_2210152..2210302_POSITIVE
334	239	197	77	28	tfor:TF2515|3end_outer_membrane_protein,_TonB_dependent_receptor_2694865..2695015_POSITIVE
324	249	203	129	67	tfor:TF1048|3end_permease_1110217..1110367_POSITIVE
324	238	192	151	95	tfor:TF0818|3end_bifunctional_protein:__aspartokinase_I;_homoserine_dehydrogenase_878517..878667_POSITIVE
322	259	221	137	92	tfor:TF1487|3end_orotate_phosphoribosyltransferase_1588522..1588672_POSITIVE
321	259	211	61	12	tfor:TF1928|3end_conserved_hypothetical_protein_2076124..2076274_POSITIVE
321	249	202	55	12	tfor:TF0664|3end_small_protein_B_(SMPB)_709570..709720_POSITIVE
319	244	201	132	82	tfor:TF2182|3end_conserved_hypothetical_protein;_possible_integral_membrane_protein_2355400..2355550_POSITIVE
317	250	205	72	13	tfor:TF2830|3end_ABC_transporter,_ATP-binding_protein_3021419..3021569_POSITIVE
317	258	213	145	110	tfor:TF1186|3end_hypothetical_protein_1269815..1269965_POSITIVE
313	238	197	60	2	tfor:TF2808|3end_bacterial_sugar_transferase_2999909..3000059_POSITIVE
312	240	191	150	98	tfor:TF0487|3end_xylulose_kinase_510174..510324_POSITIVE
311	258	214	86	25	tfor:TF0959|3end_periplasmic_protease_1008540..1008690_POSITIVE