Origin IGS:
tagcaaatagcgactgtgcattcagcggtcagccatcagttttcaggccaggacacagcgttcggtatgccgcgtaggagcgaacctctgtgttcgcccgtgataacaaccttcgcgccctttgcggtttccattgcgtgctttgcggtaaaataaaccgcaagattcacaaaggattccgcaaggttcgcaagttttcatttgcggttattcacgtcattcgtcattgttccattcaaccgtcaaacaactcaacagttaaacacccgaaaaacttttcacttttcgttcttcattattcacttttaacta
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
tagttaaaagtgaataatgaagaacgaaaagtgaaaagtttttcgggtgtttaactgttgagttgtttgacggttgaatggaacaatgacgaatgacgtgaataaccgcaaatgaaaacttgcgaaccttgcggaatcctttgtgaatcttgcggtttattttaccgcaaagcacgcaatggaaaccgcaaagggcgcgaaggttgttatcacgggcgaacacagaggttcgctcctacgcggcataccgaacgctgtgtcctggcctgaaaactgatggctgaccgctgaatgcacagtcgctatttgcta

Mask Tandem Repeat Region ================================================
tagcaaatagcgactgtgcattcagcggtcagccatcagttttcaggccaggacacagcgttcggtatgccgcgtaggagcgaacctctgtgttcgcccgtgataacaaccttcgcgccctttgcggtttccattgcgtgctttgcggtaaaataaaccgcaagattcacaaaggattccgcaaggttcgcaagttttcatttgcggttattcacgtcattcgtcattgttccattcaaccgtcaaacaactcaacagttaaacacccgaaaaacttttcacttttcgttcttcattattcacttttaacta

Find is-nt database================================================
Query_seq: TF1165:TF1166|TF1165:TF1166:conserved hypothetical protein:ABC transporter, permease component:->->:1245982..1246293 312
tagcaaatagcgactgtgcattcagcggtcagccatcagttttcaggccaggacacagcgttcggtatgccgcgtaggagcgaacctctgtgttcgcccgtgataacaaccttcgcgccctttgcggtttccattgcgtgctttgcggtaaaataaaccgcaagattcacaaaggattccgcaaggttcgcaagttttcatttgcggttattcacgtcattcgtcattgttccattcaaccgtcaaacaactcaacagttaaacacccgaaaaacttttcacttttcgttcttcattattcacttttaacta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: TF1165:TF1166|TF1165:TF1166:conserved hypothetical protein:ABC transporter, permease component:->->:1245982..1246293 312
tagcaaatagcgactgtgcattcagcggtcagccatcagttttcaggccaggacacagcgttcggtatgccgcgtaggagcgaacctctgtgttcgcccgtgataacaaccttcgcgccctttgcggtttccattgcgtgctttgcggtaaaataaaccgcaagattcacaaaggattccgcaaggttcgcaagttttcatttgcggttattcacgtcattcgtcattgttccattcaaccgtcaaacaactcaacagttaaacacccgaaaaacttttcacttttcgttcttcattattcacttttaacta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: TF1165:TF1166|TF1165:TF1166:conserved hypothetical protein:ABC transporter, permease component:->->:1245982..1246293 312
tagcaaatagcgactgtgcattcagcggtcagccatcagttttcaggccaggacacagcgttcggtatgccgcgtaggagcgaacctctgtgttcgcccgtgataacaaccttcgcgccctttgcggtttccattgcgtgctttgcggtaaaataaaccgcaagattcacaaaggattccgcaaggttcgcaagttttcatttgcggttattcacgtcattcgtcattgttccattcaaccgtcaaacaactcaacagttaaacacccgaaaaacttttcacttttcgttcttcattattcacttttaacta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

tagcaaatagcgactgtgcattcagcggtcagccatcagttttcaggccaggacacagcgttcggtatgccgcgtaggagcgaacctctgtgttcgcccgtgataacaaccttcgcgccctttgcggtttccattgcgtgctttgcggtaaaataaaccgcaagattcacaaaggattccgcaaggttcgcaagttttcatttgcggttattcacgtcattcgtcattgttccattcaaccgtcaaacaactcaacagttaaacacccgaaaaacttttcacttttcgttcttcattattcacttttaacta
Predict ORF larger than 30AA ================================================
Protein_Len: 49	Strand: +	Start: 7	End: 153
...... M  A  T  V  H  S  A  V  S  H  Q  F  S  G  Q  D  T  A  F  G  M  P  R  R  S  E  P  L  C  S  P  V  I  T  T  F  A  P  F  A  V  S  I  A  C  F  A  V  K ...............................................................................................................................................................
Protein_Len: 35	Strand: +	Start: 202	End: 306
......................................................................................................................................................................................................... M  R  L  F  T  S  F  V  I  V  P  F  N  R  Q  T  T  Q  Q  L  N  T  R  K  T  F  H  F  S  F  F  I  I  H  F ......
Protein_Len: 60	Strand: +	Start: 90	End: 311
......................................................................................... M  F  A  R  D  N  N  L  R  A  L  C  G  F  H  C  V  L  C  G  K  I  N  R  K  I  H  K  G  F  R  K  V  R  K  F  S  F  A  V  I  H  V  I  R  H  C  S  I  Q  P  S  N  N  S  T  V  K  H  P .
Protein_Len: 52	Strand: -	Start: 46	End: 201
............................................. A  L  V  C  R  E  T  H  R  T  P  A  F  R  Q  T  R  G  H  Y  C  G  E  R  G  K  R  N  G  N  R  A  K  R  Y  F  L  G  C  S  E  C  L  I  G  C  P  E  C  T  K  M ...............................................................................................................
Protein_Len: 44	Strand: -	Start: 39	End: 170
...................................... N  E  P  W  S  V  A  N  P  I  G  R  L  L  S  G  R  H  E  G  T  I  V  V  K  A  G  K  A  T  E  M  A  H  K  A  T  F  Y  V  A  L  N  M ..............................................................................................................................................
Protein_Len: 45	Strand: -	Start: 32	End: 166
............................... G  D  T  K  L  G  P  C  L  T  R  Y  A  A  Y  S  R  V  E  T  N  A  R  S  L  L  R  R  A  R  Q  P  K  W  Q  T  S  Q  P  L  I  F  R  L  M ..................................................................................................................................................

tagcaaatagcgactgtgcattcagcggtcagccatcagttttcaggccaggacacagcgttcggtatgccgcgtaggagcgaacctctgtgttcgcccgtgataacaaccttcgcgccctttgcggtttccattgcgtgctttgcggtaaaataaaccgcaagattcacaaaggattccgcaaggttcgcaagttttcatttgcggttattcacgtcattcgtcattgttccattcaaccgtcaaacaactcaacagttaaacacccgaaaaacttttcacttttcgttcttcattattcacttttaacta
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

tagcaaatagcgactgtgcattcagcggtcagccatcagttttcaggccaggacacagcgttcggtatgccgcgtaggagcgaacctctgtgttcgcccgtgataacaaccttcgcgccctttgcggtttccattgcgtgctttgcggtaaaataaaccgcaagattcacaaaggattccgcaaggttcgcaagttttcatttgcggttattcacgtcattcgtcattgttccattcaaccgtcaaacaactcaacagttaaacacccgaaaaacttttcacttttcgttcttcattattcacttttaacta
Predict TransTerm conf > 70================================================

Find igs database================================================
Query_seq: TF1165:TF1166|TF1165:TF1166:conserved hypothetical protein:ABC transporter, permease component:->->:1245982..1246293 312
tagcaaatagcgactgtgcattcagcggtcagccatcagttttcaggccaggacacagcgttcggtatgccgcgtaggagcgaacctctgtgttcgcccgtgataacaaccttcgcgccctttgcggtttccattgcgtgctttgcggtaaaataaaccgcaagattcacaaaggattccgcaaggttcgcaagttttcatttgcggttattcacgtcattcgtcattgttccattcaaccgtcaaacaactcaacagttaaacacccgaaaaacttttcacttttcgttcttcattattcacttttaacta
Intra-Species Hit: Count: 1	Min: 1	Max: 312	Len: 312
Subject: tfor_TF1165_TF1166|conserved hypothetical protein:ABC transporter, permease component|POSITIVE:POSITIVE|[1245982,1246293]|312
HSP  1	e-value: 1.0E-176	bit: 618.0	Len: 312	Query Start:1	Query End:312	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 312
tagcaaatagcgactgtgcattcagcggtcagccatcagttttcaggccaggacacagcgttcggtatgccgcgtaggagcgaacctctgtgttcgcccgtgataacaaccttcgcgccctttgcggtttccattgcgtgctttgcggtaaaataaaccgcaagattcacaaaggattccgcaaggttcgcaagttttcatttgcggttattcacgtcattcgtcattgttccattcaaccgtcaaacaactcaacagttaaacacccgaaaaacttttcacttttcgttcttcattattcacttttaacta
tagcaaatagcgactgtgcattcagcggtcagccatcagttttcaggccaggacacagcgttcggtatgccgcgtaggagcgaacctctgtgttcgcccgtgataacaaccttcgcgccctttgcggtttccattgcgtgctttgcggtaaaataaaccgcaagattcacaaaggattccgcaaggttcgcaagttttcatttgcggttattcacgtcattcgtcattgttccattcaaccgtcaaacaactcaacagttaaacacccgaaaaacttttcacttttcgttcttcattattcacttttaacta

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UAGCAAAUAGCGACUGUGCAUUCAGCGGUCAGCCAUCAGUUUUCAGGCCAGGACACAGCGUUCGGUAUGCCGCGUAGGAGCGAACCUCUGUGUUCGCCCGUGAUAACAACCUUCGCGCCCUUUGCGGUUUCCAUUGCGUGCUUUGCGGUAAAAUAAACCGCAAGAUUCACAAAGGAUUCCGCAAGGUUCGCAAGUUUUCAUUUGCGGUUAUUCACGUCAUUCGUCAUUGUUCCAUUCAACCGUCAAACAACUCAACAGUUAAACACCCGAAAAACUUUUCACUUUUCGUUCUUCAUUAUUCACUUUUAACUA
.........((((((((.......)))))).))....((((....(((..((((((((.(((((.....((.....))..)))))..))))))))))).((((((((...(((.(((..((((((((..(((.(((.(...((((((((.......))))))))...).))).)))..))))))))..))))))......(((((((((........((........))........))))).))))..........))))......((((((.........))))))...........))))....)))). (-83.79)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UAGUUAAAAGUGAAUAAUGAAGAACGAAAAGUGAAAAGUUUUUCGGGUGUUUAACUGUUGAGUUGUUUGACGGUUGAAUGGAACAAUGACGAAUGACGUGAAUAACCGCAAAUGAAAACUUGCGAACCUUGCGGAAUCCUUUGUGAAUCUUGCGGUUUAUUUUACCGCAAAGCACGCAAUGGAAACCGCAAAGGGCGCGAAGGUUGUUAUCACGGGCGAACACAGAGGUUCGCUCCUACGCGGCAUACCGAACGCUGUGUCCUGGCCUGAAAACUGAUGGCUGACCGCUGAAUGCACAGUCGCUAUUUGCUA
........((..((((.(((.........(((.(..((((((.(((((((((((((((..((...))..))))))))))(((...(((((((....((((......(((((.(....).)))))..((((((((..(((.(((((....(((((((.......)))))))....))))).)))..)))).)))).))))....)))))))...((((((((......))))))))...((((((.........)))))))))..)))))))))))..).)))....((.....))....))).))))..)). (-100.40)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
712	98	51	231	184	tfor:TF0471|5end_conserved_hypothetical_protein_487516..487746_POSITIVE
520	99	66	226	194	tfor:TF2994|5end_hypothetical_protein_3210605..3210835_POSITIVE
515	120	74	120	62	tfor:TF0366|5end_hypothetical_protein_383564..383794_POSITIVE
515	120	74	120	62	tfor:TF0362|5end_hypothetical_protein_379952..380182_POSITIVE
515	120	74	120	62	tfor:TF0346|5end_hypothetical_protein_367048..367278_POSITIVE
514	120	74	126	68	tfor:TF2172|5end_hypothetical_protein_2345822..2346052_POSITIVE
514	120	74	120	62	tfor:TF2173|5end_hypothetical_protein_2345816..2346046_POSITIVE
514	120	74	120	62	tfor:TF2171|5end_hypothetical_protein_2345485..2345715_POSITIVE
514	120	74	120	62	tfor:TF2166|5end_hypothetical_protein_2342115..2342345_POSITIVE
486	100	59	63	17	tfor:TF1664|5end_conserved_hypothetical_protein_1778761..1778991_POSITIVE
479	99	51	139	78	tfor:TF1580|5end_conserved_hypothetical_protein;_possible_fibronectin_domain_containing_protein_1687187..1687417_POSITIVE
467	100	57	176	135	tfor:TF0265|5end_conserved_hypothetical_protein,_Rhs_family_293279..293509_POSITIVE
460	106	74	231	199	tfor:TF1169|5end_lipoprotein_ABC_transporter,_permease_component_1249136..1249366_POSITIVE
457	120	74	111	62	tfor:TF0340|5end_hypothetical_protein_363893..364123_POSITIVE
449	129	81	99	43	tfor:TF0538|5end_hypothetical_protein_566891..567121_POSITIVE
449	129	81	92	36	tfor:TF0539|5end_hypothetical_protein_566884..567114_POSITIVE
428	87	41	55	8	tfor:TF0665|5end_conserved_hypothetical_protein_709497..709727_POSITIVE
424	100	56	196	151	tfor:TF1850|5end_Na+/H+-exchanging_protein_1998542..1998772_POSITIVE
424	218	179	214	176	tfor:TF0535|5end_surface_antigen_BspA_559804..560034_POSITIVE
407	100	51	72	10	tfor:TF1955|5end_amino_acid_exporter,_possible_threonine_efflux_protein_2106952..2107182_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
645	96	51	151	106	tfor:TF0470|3end_hypothetical_protein_487518..487668_POSITIVE
635	98	56	100	57	tfor:TF1716|3end_hypothetical_protein_1837710..1837860_POSITIVE
551	120	77	55	1	tfor:TF1588|3end_hypothetical_protein_1702560..1702710_POSITIVE
514	120	74	134	75	tfor:TF1168|3end_hypothetical_protein_1249092..1249242_POSITIVE
482	117	71	144	97	tfor:TF2651|3end_hypothetical_protein_2822014..2822164_POSITIVE
479	99	51	146	85	tfor:TF1579|3end_hypothetical_protein_1687274..1687424_POSITIVE
474	99	56	110	61	tfor:TF2346|3end_hypothetical_protein_2509973..2510123_POSITIVE
428	87	41	48	1	tfor:TF0664|3end_small_protein_B_(SMPB)_709570..709720_POSITIVE
424	218	179	98	60	tfor:TF0534|3end_hypothetical_protein_559768..559918_POSITIVE
412	87	45	149	90	tfor:TF2746|3end_hypothetical_protein_2928246..2928396_POSITIVE
406	300	252	109	63	tfor:TF1816|3end_hypothetical_protein_1957974..1958124_POSITIVE
406	300	252	126	80	tfor:TF1817|3end_hypothetical_protein_1957991..1958141_POSITIVE
405	89	47	75	30	tfor:TF2160|3end_magnesium_chelatase,_subunit_I_2337049..2337199_POSITIVE
400	53	15	39	1	tfor:TF2832|3end_possible_proton/sodium:glutamate_symporter_protein_3023939..3024089_POSITIVE
400	149	110	139	93	tfor:TF2347|3end_outer_membrane_protein,_TonB_dependent_receptor_2511092..2511242_POSITIVE
398	294	252	53	11	tfor:TF1204|3end_possible_metal-dependent_membrane_protease_1287461..1287611_POSITIVE
388	68	21	58	13	tfor:TF1715|3end_thermolysin;_zinc_metalloprotease_1837202..1837352_POSITIVE
388	66	25	99	63	tfor:TF0685|3end_hypothetical_protein_731132..731282_POSITIVE
387	103	64	46	3	tfor:TF0959|3end_periplasmic_protease_1008540..1008690_POSITIVE
386	83	43	83	31	tfor:TF0247|3end_conserved_hypothetical_protein_278348..278498_POSITIVE