Origin IGS:
tatgccggaatcttttttttctgttgcaaatttagcctctgttcgggcgatcggacttgctcaaatcggacaaaaacctgctcaaatcggacattttttatcgctcccgacttgcttaaatcggacagcgatggttctcaaacggcagtataatagttttttatgtagaaacaacgggggatatagcacctcataatggtatttggaagaaaaaattattcttcgataaaatttgttttttaggagaggatttacgactt
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
aagtcgtaaatcctctcctaaaaaacaaattttatcgaagaataattttttcttccaaataccattatgaggtgctatatcccccgttgtttctacataaaaaactattatactgccgtttgagaaccatcgctgtccgatttaagcaagtcgggagcgataaaaaatgtccgatttgagcaggtttttgtccgatttgagcaagtccgatcgcccgaacagaggctaaatttgcaacagaaaaaaaagattccggcata

Mask Tandem Repeat Region ================================================
tatgccggaatcttttttttctgttgcaaatttagcctctgttcgggcgatcggacttgctcaaatcggacaaaaacctgctcaaatcggacattttttatcgctcccgacttgcttaaatcggacagcgatggttctcaaacggcagtataatagttttttatgtagaaacaacgggggatatagcacctcataatggtatttggaagaaaaaattattcttcgataaaatttgttttttaggagaggatttacgactt

Find is-nt database================================================
Query_seq: TF2923:TF2924|TF2923:TF2924:hypothetical protein:DNA-binding response regulator/sensor histidine kinase:->->:3122464..3122723 260
tatgccggaatcttttttttctgttgcaaatttagcctctgttcgggcgatcggacttgctcaaatcggacaaaaacctgctcaaatcggacattttttatcgctcccgacttgcttaaatcggacagcgatggttctcaaacggcagtataatagttttttatgtagaaacaacgggggatatagcacctcataatggtatttggaagaaaaaattattcttcgataaaatttgttttttaggagaggatttacgactt
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: TF2923:TF2924|TF2923:TF2924:hypothetical protein:DNA-binding response regulator/sensor histidine kinase:->->:3122464..3122723 260
tatgccggaatcttttttttctgttgcaaatttagcctctgttcgggcgatcggacttgctcaaatcggacaaaaacctgctcaaatcggacattttttatcgctcccgacttgcttaaatcggacagcgatggttctcaaacggcagtataatagttttttatgtagaaacaacgggggatatagcacctcataatggtatttggaagaaaaaattattcttcgataaaatttgttttttaggagaggatttacgactt
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: TF2923:TF2924|TF2923:TF2924:hypothetical protein:DNA-binding response regulator/sensor histidine kinase:->->:3122464..3122723 260
tatgccggaatcttttttttctgttgcaaatttagcctctgttcgggcgatcggacttgctcaaatcggacaaaaacctgctcaaatcggacattttttatcgctcccgacttgcttaaatcggacagcgatggttctcaaacggcagtataatagttttttatgtagaaacaacgggggatatagcacctcataatggtatttggaagaaaaaattattcttcgataaaatttgttttttaggagaggatttacgactt
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

tatgccggaatcttttttttctgttgcaaatttagcctctgttcgggcgatcggacttgctcaaatcggacaaaaacctgctcaaatcggacattttttatcgctcccgacttgcttaaatcggacagcgatggttctcaaacggcagtataatagttttttatgtagaaacaacgggggatatagcacctcataatggtatttggaagaaaaaattattcttcgataaaatttgttttttaggagaggatttacgactt
Predict ORF larger than 30AA ================================================
Protein_Len: 47	Strand: +	Start: 10	End: 150
......... M  F  F  F  C  C  K  F  S  L  C  S  G  D  R  T  C  S  N  R  T  K  T  C  S  N  R  T  F  F  I  A  P  D  L  L  K  S  D  S  D  G  S  Q  T  A  V ..............................................................................................................
Protein_Len: 60	Strand: +	Start: 2	End: 193
. M  P  E  S  F  F  S  V  A  N  L  A  S  V  R  A  I  G  L  A  Q  I  G  Q  K  P  A  Q  I  G  H  F  L  S  L  P  T  C  L  N  R  T  A  M  V  L  K  R  Q  Y  N  S  F  L  C  R  N  N  G  G ...................................................................
Protein_Len: 47	Strand: +	Start: 120	End: 260
....................................................................................................................... M  G  Q  R  W  F  S  N  G  S  I  I  V  F  Y  V  E  T  T  G  D  I  A  P  H  N  G  I  W  K  K  K  L  F  F  D  K  I  C  F  L  G  E  D  L  R  L 
Protein_Len: 45	Strand: -	Start: 85	End: 219
.................................................................................... I  P  C  K  K  D  S  G  V  Q  K  F  R  V  A  I  T  R  L  R  C  Y  L  L  K  K  H  L  F  L  P  P  Y  L  V  E  Y  H  Y  K  S  S  F  I  M .........................................
Protein_Len: 42	Strand: -	Start: 3	End: 128
.. A  P  I  K  K  K  Q  Q  L  N  L  R  Q  E  P  S  R  V  Q  E  F  R  V  F  V  Q  E  F  R  V  N  K  I  A  G  S  K  S  L  D  S  M ....................................................................................................................................

tatgccggaatcttttttttctgttgcaaatttagcctctgttcgggcgatcggacttgctcaaatcggacaaaaacctgctcaaatcggacattttttatcgctcccgacttgcttaaatcggacagcgatggttctcaaacggcagtataatagttttttatgtagaaacaacgggggatatagcacctcataatggtatttggaagaaaaaattattcttcgataaaatttgttttttaggagaggatttacgactt
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

tatgccggaatcttttttttctgttgcaaatttagcctctgttcgggcgatcggacttgctcaaatcggacaaaaacctgctcaaatcggacattttttatcgctcccgacttgcttaaatcggacagcgatggttctcaaacggcagtataatagttttttatgtagaaacaacgggggatatagcacctcataatggtatttggaagaaaaaattattcttcgataaaatttgttttttaggagaggatttacgactt
Predict TransTerm conf > 70================================================

Find igs database================================================
Query_seq: TF2923:TF2924|TF2923:TF2924:hypothetical protein:DNA-binding response regulator/sensor histidine kinase:->->:3122464..3122723 260
tatgccggaatcttttttttctgttgcaaatttagcctctgttcgggcgatcggacttgctcaaatcggacaaaaacctgctcaaatcggacattttttatcgctcccgacttgcttaaatcggacagcgatggttctcaaacggcagtataatagttttttatgtagaaacaacgggggatatagcacctcataatggtatttggaagaaaaaattattcttcgataaaatttgttttttaggagaggatttacgactt
Intra-Species Hit: Count: 1	Min: 21	Max: 260	Len: 240
Subject: tfor_TF2923_TF2924|hypothetical protein:DNA-binding response regulator/sensor histidine kinase|POSITIVE:POSITIVE|[3122464,3122723]|260
HSP  1	e-value: 1.0E-133	bit: 476.0	Len: 240	Query Start:21	Query End:260	Subject Strand: POSITIVE	Subject Start: 21	Subject End: 260
....................ctgttgcaaatttagcctctgttcgggcgatcggacttgctcaaatcggacaaaaacctgctcaaatcggacattttttatcgctcccgacttgcttaaatcggacagcgatggttctcaaacggcagtataatagttttttatgtagaaacaacgggggatatagcacctcataatggtatttggaagaaaaaattattcttcgataaaatttgttttttaggagaggatttacgactt
....................ctgttgcaaatttagcctctgttcgggcgatcggacttgctcaaatcggacaaaaacctgctcaaatcggacattttttatcgctcccgacttgcttaaatcggacagcgatggttctcaaacggcagtataatagttttttatgtagaaacaacgggggatatagcacctcataatggtatttggaagaaaaaattattcttcgataaaatttgttttttaggagaggatttacgactt

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
CUGUUGCAAAUUUAGCCUCUGUUCGGGCGAUCGGACUUGCUCAAAUCGGACAAAAACCUGCUCAAAUCGGACAUUUUUUAUCGCUCCCGACUUGCUUAAAUCGGACAGCGAUGGUUCUCAAACGGCAGUAUAAUAGUUUUUUAUGUAGAAACAACGGGGGAUAUAGCACCUCAUAAUGGUAUUUGGAAGAAAAAAUUAUUCUUCGAUAAAAUUUGUUUUUUAGGAGAGGAUUUACGACUU
..((((...........((((((.((((((......)))))).)).))))......(((.(((.....(((((..(((((((.((((((..(((((......((((.......))))......))))).......((((((.....))))))..)))))).......(((.......))).....((((((.......)))))))))))))..))))).....)))))).....)))).. (-53.30)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
AAGUCGUAAAUCCUCUCCUAAAAAACAAAUUUUAUCGAAGAAUAAUUUUUUCUUCCAAAUACCAUUAUGAGGUGCUAUAUCCCCCGUUGUUUCUACAUAAAAAACUAUUAUACUGCCGUUUGAGAACCAUCGCUGUCCGAUUUAAGCAAGUCGGGAGCGAUAAAAAAUGUCCGAUUUGAGCAGGUUUUUGUCCGAUUUGAGCAAGUCCGAUCGCCCGAACAGAGGCUAAAUUUGCAACAG
..((.((((((((((.......((((((........((((((.......))))))....((((.......))))............)))))).........................(((((......((((((.((((((((....)))))))))))))).......(((.((((((..((((((.......))))))..)))))).)))....))))).))))....)))))).)).. (-53.10)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
395	50	1	48	5	tfor:TF2747|5end_heat_shock_protein,_HSP90_family_2928279..2928509_POSITIVE
374	48	2	224	167	tfor:TF2307|5end_two-component_system_sensor_histidine_kinase/response_2462618..2462848_POSITIVE
372	60	13	51	1	tfor:TF2391|5end_conserved_hypothetical_protein_2562128..2562358_POSITIVE
369	130	81	225	167	tfor:TF1733|5end_conserved_hypothetical_protein_1856015..1856245_POSITIVE
369	77	41	132	95	tfor:TF0531|5end_hypothetical_protein_557063..557293_POSITIVE
364	130	81	42	3	tfor:TF1936|5end_conserved_hypothetical_protein_2083984..2084214_POSITIVE
359	60	13	77	27	tfor:TF0690|5end_preprotein_translocase_subunit_735243..735473_POSITIVE
356	60	11	221	171	tfor:TF1924|5end_prenyltransferase,_UbiA_family_2072857..2073087_POSITIVE
355	49	1	84	25	tfor:TF0789|5end_preprotein_translocase,_secDF_family_841293..841523_POSITIVE
353	129	81	185	135	tfor:TF3039|5end_ABC_transporter,_ATP-binding_protein_3265731..3265961_POSITIVE
342	50	1	144	79	tfor:TF2189|5end_conserved_hypothetical_protein_2363455..2363685_POSITIVE
337	48	6	227	174	tfor:TF1801|5end_conserved_hypothetical_protein;_possible_TPR-repeat-containing_protein_1944213..1944443_POSITIVE
335	129	81	158	98	tfor:TF1740|5end_hypothetical_protein_1868645..1868875_POSITIVE
335	70	22	195	145	tfor:TF1048|5end_permease_1109241..1109471_POSITIVE
333	58	19	55	2	tfor:TF2123|5end_conserved_hypothetical_protein;_TPR-repeat_protein_2297268..2297498_POSITIVE
332	50	1	203	145	tfor:TF2332|5end_signal_peptidase_I_2491694..2491924_POSITIVE
329	69	21	226	175	tfor:TF2454|5end_D-alanyl-D-alanine_dipeptidase_2631259..2631489_POSITIVE
328	50	2	209	168	tfor:TF2329|5end_conserved_hypothetical_protein_2488324..2488554_POSITIVE
325	110	67	150	101	tfor:TF1317|5end_hypothetical_protein_1391378..1391608_POSITIVE
324	60	15	227	163	tfor:TF0971|5end_conserved_hypothetical_protein_1021355..1021585_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
369	130	81	109	51	tfor:TF1732|3end_conserved_hypothetical_protein_1855979..1856129_POSITIVE
364	130	81	57	18	tfor:TF1934|3end_hypothetical_protein_2084079..2084229_POSITIVE
355	59	14	77	32	tfor:TF2646|3end_conserved_hypothetical_protein_2816697..2816847_POSITIVE
355	49	1	81	22	tfor:TF0788|3end_protein-export_membrane_protein_841370..841520_POSITIVE
342	50	1	144	79	tfor:TF2188|3end_conserved_hypothetical_protein_2363535..2363685_POSITIVE
330	51	16	147	113	tfor:TF2887|3end_phosphomannomutase/phosphoglucomutase_3077792..3077942_POSITIVE
328	108	67	145	107	tfor:TF3038|3end_conserved_hypothetical_protein_3265799..3265949_POSITIVE
314	60	15	118	60	tfor:TF2745|3end_hypothetical_protein_2927947..2928097_POSITIVE
314	60	15	136	78	tfor:TF1659|3end_hypothetical_protein_1775209..1775359_POSITIVE
311	59	15	151	94	tfor:TF0538|3end_hypothetical_protein_567135..567285_POSITIVE
311	128	81	72	20	tfor:TF0148|3end_conserved_hypothetical_protein_160157..160307_POSITIVE
310	59	15	151	94	tfor:TF1845|3end_hypothetical_protein_1997005..1997155_POSITIVE
309	60	15	136	78	tfor:TF1187|3end_hypothetical_protein_1269872..1270022_POSITIVE
309	60	15	79	21	tfor:TF1186|3end_hypothetical_protein_1269815..1269965_POSITIVE
308	54	14	56	3	tfor:TF2087|3end_conserved_hypothetical_protein_2257694..2257844_POSITIVE
306	50	15	146	113	tfor:TF2674|3end_conserved_hypothetical_protein;_possible_phosphoesterase_2848777..2848927_POSITIVE
305	48	4	118	70	tfor:TF0279|3end_conserved_hypothetical_protein_308679..308829_POSITIVE
304	110	61	51	1	tfor:TF2874|3end_conserved_hypothetical_protein_3065224..3065374_POSITIVE
304	50	2	143	105	tfor:TF2833|3end_lipid_A_disaccharide_synthase_3025183..3025333_POSITIVE
302	76	31	46	2	tfor:TF3147|3end_adenylate_kinase_3383704..3383854_POSITIVE