Origin IGS:
tgatgtggactccatcatgaagatgtgcgcaacgatctccgccttcatttttatcacaaagccctttccttgccgaaaaaggggctttcgttttgccgcctccgtttaatttttaatccgataaatacttttacaagacaacaataattccatatctttgcgggaaatattggtggtatgcaagacgccaccgcgaaaatcagcctgttgacagccttccgatggctttgtgcaagaagaagggacatcgggacaagaaagaatagatagataaataaacaagaagaacg
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
cgttcttcttgtttatttatctatctattctttcttgtcccgatgtcccttcttcttgcacaaagccatcggaaggctgtcaacaggctgattttcgcggtggcgtcttgcataccaccaatatttcccgcaaagatatggaattattgttgtcttgtaaaagtatttatcggattaaaaattaaacggaggcggcaaaacgaaagcccctttttcggcaaggaaagggctttgtgataaaaatgaaggcggagatcgttgcgcacatcttcatgatggagtccacatca

Mask Tandem Repeat Region ================================================
tgatgtggactccatcatgaagatgtgcgcaacgatctccgccttcatttttatcacaaagccctttccttgccgaaaaaggggctttcgttttgccgcctccgtttaatttttaatccgataaatacttttacaagacaacaataattccatatctttgcgggaaatattggtggtatgcaagacgccaccgcgaaaatcagcctgttgacagccttccgatggctttgtgcaagaagaagggacatcgggacaagaaagaatagatagataaataaacaagaagaacg

Find is-nt database================================================
Query_seq: TF2179:TF2180|TF2179:TF2180:integral membrane protein, MarC family:phosphoribosylamine--glycine ligase:->->:2352430..2352719 290
tgatgtggactccatcatgaagatgtgcgcaacgatctccgccttcatttttatcacaaagccctttccttgccgaaaaaggggctttcgttttgccgcctccgtttaatttttaatccgataaatacttttacaagacaacaataattccatatctttgcgggaaatattggtggtatgcaagacgccaccgcgaaaatcagcctgttgacagccttccgatggctttgtgcaagaagaagggacatcgggacaagaaagaatagatagataaataaacaagaagaacg
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: TF2179:TF2180|TF2179:TF2180:integral membrane protein, MarC family:phosphoribosylamine--glycine ligase:->->:2352430..2352719 290
tgatgtggactccatcatgaagatgtgcgcaacgatctccgccttcatttttatcacaaagccctttccttgccgaaaaaggggctttcgttttgccgcctccgtttaatttttaatccgataaatacttttacaagacaacaataattccatatctttgcgggaaatattggtggtatgcaagacgccaccgcgaaaatcagcctgttgacagccttccgatggctttgtgcaagaagaagggacatcgggacaagaaagaatagatagataaataaacaagaagaacg
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: TF2179:TF2180|TF2179:TF2180:integral membrane protein, MarC family:phosphoribosylamine--glycine ligase:->->:2352430..2352719 290
tgatgtggactccatcatgaagatgtgcgcaacgatctccgccttcatttttatcacaaagccctttccttgccgaaaaaggggctttcgttttgccgcctccgtttaatttttaatccgataaatacttttacaagacaacaataattccatatctttgcgggaaatattggtggtatgcaagacgccaccgcgaaaatcagcctgttgacagccttccgatggctttgtgcaagaagaagggacatcgggacaagaaagaatagatagataaataaacaagaagaacg
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

tgatgtggactccatcatgaagatgtgcgcaacgatctccgccttcatttttatcacaaagccctttccttgccgaaaaaggggctttcgttttgccgcctccgtttaatttttaatccgataaatacttttacaagacaacaataattccatatctttgcgggaaatattggtggtatgcaagacgccaccgcgaaaatcagcctgttgacagccttccgatggctttgtgcaagaagaagggacatcgggacaagaaagaatagatagataaataaacaagaagaacg
Predict ORF larger than 30AA ================================================
Protein_Len: 34	Strand: +	Start: 5	End: 106
.... M  D  S  I  M  K  M  C  A  T  I  S  A  F  I  F  I  T  K  P  F  P  C  R  K  R  G  F  R  F  A  A  S  V ........................................................................................................................................................................................
Protein_Len: 40	Strand: +	Start: 25	End: 144
........................ M  R  N  D  L  R  L  H  F  Y  H  K  A  L  S  L  P  K  K  G  L  S  F  C  R  L  R  L  I  F  N  P  I  N  T  F  T  R  Q  Q ..................................................................................................................................................
Protein_Len: 40	Strand: +	Start: 144	End: 263
............................................................................................................................................... M  I  P  Y  L  C  G  K  Y  W  W  Y  A  R  R  H  R  E  N  Q  P  V  D  S  L  P  M  A  L  C  K  K  K  G  H  R  D  K  K  E ...........................
Protein_Len: 38	Strand: +	Start: 154	End: 267
......................................................................................................................................................... M  F  A  G  N  I  G  G  M  Q  D  A  T  A  K  I  S  L  L  T  A  F  R  W  L  C  A  R  R  R  D  I  G  T  R  K  N  R .......................
Protein_Len: 58	Strand: -	Start: 109	End: 282
............................................................................................................ N  K  I  R  Y  I  S  K  C  S  L  L  L  E  M  D  K  R  S  I  N  T  T  H  L  V  G  G  R  F  D  A  Q  Q  C  G  E  S  P  K  T  C  S  S  P  V  D  P  C  S  L  I  S  L  Y  I  F  M ........
Protein_Len: 60	Strand: -	Start: 57	End: 272
........................................................ Q  R  R  R  K  I  K  L  G  I  F  V  K  V  L  C  C  Y  N  W  I  K  A  P  F  I  P  P  I  C  S  A  V  A  F  I  L  R  N  V  A  K  R  H  S  Q  A  L  L  L  S  M  P  V  L  F  F  L  Y  M ..................

tgatgtggactccatcatgaagatgtgcgcaacgatctccgccttcatttttatcacaaagccctttccttgccgaaaaaggggctttcgttttgccgcctccgtttaatttttaatccgataaatacttttacaagacaacaataattccatatctttgcgggaaatattggtggtatgcaagacgccaccgcgaaaatcagcctgttgacagccttccgatggctttgtgcaagaagaagggacatcgggacaagaaagaatagatagataaataaacaagaagaacg
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

tgatgtggactccatcatgaagatgtgcgcaacgatctccgccttcatttttatcacaaagccctttccttgccgaaaaaggggctttcgttttgccgcctccgtttaatttttaatccgataaatacttttacaagacaacaataattccatatctttgcgggaaatattggtggtatgcaagacgccaccgcgaaaatcagcctgttgacagccttccgatggctttgtgcaagaagaagggacatcgggacaagaaagaatagatagataaataaacaagaagaacg
Predict TransTerm conf > 70================================================
TransTerm Strand: +	Conf: 55	HP_score: -2.3	Tail_Score: -4.09864	Start: 74	End: 90	Full_Region: AAGCCCTTTCCTTGC CGAAA AAGGGGC TTTCG TTTTGCCGCCTCCGT
.........................................................................CGAAAAAGGGGCTTTCG........................................................................................................................................................................................................

Find igs database================================================
Query_seq: TF2179:TF2180|TF2179:TF2180:integral membrane protein, MarC family:phosphoribosylamine--glycine ligase:->->:2352430..2352719 290
tgatgtggactccatcatgaagatgtgcgcaacgatctccgccttcatttttatcacaaagccctttccttgccgaaaaaggggctttcgttttgccgcctccgtttaatttttaatccgataaatacttttacaagacaacaataattccatatctttgcgggaaatattggtggtatgcaagacgccaccgcgaaaatcagcctgttgacagccttccgatggctttgtgcaagaagaagggacatcgggacaagaaagaatagatagataaataaacaagaagaacg
Intra-Species Hit: Count: 1	Min: 1	Max: 290	Len: 290
Subject: tfor_TF2179_TF2180|integral membrane protein, MarC family:phosphoribosylamine--glycine ligase|POSITIVE:POSITIVE|[2352430,2352719]|290
HSP  1	e-value: 1.0E-163	bit: 575.0	Len: 290	Query Start:1	Query End:290	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 290
tgatgtggactccatcatgaagatgtgcgcaacgatctccgccttcatttttatcacaaagccctttccttgccgaaaaaggggctttcgttttgccgcctccgtttaatttttaatccgataaatacttttacaagacaacaataattccatatctttgcgggaaatattggtggtatgcaagacgccaccgcgaaaatcagcctgttgacagccttccgatggctttgtgcaagaagaagggacatcgggacaagaaagaatagatagataaataaacaagaagaacg
tgatgtggactccatcatgaagatgtgcgcaacgatctccgccttcatttttatcacaaagccctttccttgccgaaaaaggggctttcgttttgccgcctccgtttaatttttaatccgataaatacttttacaagacaacaataattccatatctttgcgggaaatattggtggtatgcaagacgccaccgcgaaaatcagcctgttgacagccttccgatggctttgtgcaagaagaagggacatcgggacaagaaagaatagatagataaataaacaagaagaacg

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UGAUGUGGACUCCAUCAUGAAGAUGUGCGCAACGAUCUCCGCCUUCAUUUUUAUCACAAAGCCCUUUCCUUGCCGAAAAAGGGGCUUUCGUUUUGCCGCCUCCGUUUAAUUUUUAAUCCGAUAAAUACUUUUACAAGACAACAAUAAUUCCAUAUCUUUGCGGGAAAUAUUGGUGGUAUGCAAGACGCCACCGCGAAAAUCAGCCUGUUGACAGCCUUCCGAUGGCUUUGUGCAAGAAGAAGGGACAUCGGGACAAGAAAGAAUAGAUAGAUAAAUAAACAAGAAGAACG
....((((........(((((((((.(((..........)))...))))))))).((((((((((((...........)))))))))).))....)))).((..((((.(((((..((((((.....(((((.(....((.(((((.((((...........)))).))))).))...((((.((.((((.((.((.....((.(((....))).)))))).)))).)).)))).).)))))....)))))).....))))).))))..))................... (-60.50)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
CGUUCUUCUUGUUUAUUUAUCUAUCUAUUCUUUCUUGUCCCGAUGUCCCUUCUUCUUGCACAAAGCCAUCGGAAGGCUGUCAACAGGCUGAUUUUCGCGGUGGCGUCUUGCAUACCACCAAUAUUUCCCGCAAAGAUAUGGAAUUAUUGUUGUCUUGUAAAAGUAUUUAUCGGAUUAAAAAUUAAACGGAGGCGGCAAAACGAAAGCCCCUUUUUCGGCAAGGAAAGGGCUUUGUGAUAAAAAUGAAGGCGGAGAUCGUUGCGCACAUCUUCAUGAUGGAGUCCACAUCA
...................((((((....((((((((((.(((.(.(((((.(((((((.....(((((((((((((.(((....))).).))))).)))))))...(((((...((.(((((.((((...........)))).))))).))...)))))...........................(((((.(((.........))))))))....))))))))))))).))).)))))....))))).((((((.((.....))))))))..)))))).......... (-72.20)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
505	220	174	47	10	tfor:TF2950|5end_chloromuconate_cycloisomerase_3157399..3157629_POSITIVE
393	219	172	66	14	tfor:TF1935|5end_ATP-dependent_RNA_helicase,_DEAD/DEAH-related_helicase_2082002..2082232_POSITIVE
384	228	187	133	82	tfor:TF2047|5end_hypothetical_protein_2210057..2210287_POSITIVE
381	120	71	172	121	tfor:TF0085|5end_ABC_transporter,_ATP-binding_protein_91517..91747_POSITIVE
376	107	61	54	10	tfor:TF2876|5end_cytosine_deaminase_3065144..3065374_POSITIVE
374	216	172	69	27	tfor:TF2013|5end_polysaccharide_deacetylase_2168650..2168880_POSITIVE
370	248	201	61	17	tfor:TF1484|5end_penicillin_binding_protein_1579559..1579789_POSITIVE
368	245	202	159	111	tfor:TF3108|5end_glutamine-hydrolyzing_carbamoyl-phosphate_synthase,_large_subunit_3338732..3338962_POSITIVE
363	237	192	63	17	tfor:TF0789|5end_preprotein_translocase,_secDF_family_841293..841523_POSITIVE
356	219	172	76	31	tfor:TF0218|5end_translation_initiation_factor_3_(IF-3)_243182..243412_POSITIVE
355	250	203	51	1	tfor:TF2267|5end_lysozyme-related_protein_2434869..2435099_POSITIVE
355	107	61	226	167	tfor:TF1929|5end_conserved_hypothetical_protein_2076049..2076279_POSITIVE
354	210	161	221	163	tfor:TF2381|5end_muramidase/hemagglutinin_2545757..2545987_POSITIVE
351	230	186	109	56	tfor:TF2246|5end_hypothetical_protein_2421288..2421518_POSITIVE
351	220	180	59	18	tfor:TF1548|5end_thiophene_and_furan_oxidation_protein_1652501..1652731_POSITIVE
351	196	159	81	49	tfor:TF1291|5end_response_regulator_(fimR__protein)_1371959..1372189_POSITIVE
348	105	61	63	4	tfor:TF2576|5end_translation_initiation_factor_IF-1_2745912..2746142_POSITIVE
348	106	64	231	192	tfor:TF0497|5end_conserved_hypothetical_protein_524058..524288_POSITIVE
346	255	213	170	130	tfor:TF0135|5end_hypothetical_protein_146322..146552_POSITIVE
341	233	191	224	177	tfor:TF2812|5end_hypothetical_protein_3002726..3002956_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
505	220	174	47	10	tfor:TF2949|3end_dihydroxynaphthoate_synthase_(naphthoate_synthase)_3157479..3157629_POSITIVE
384	228	187	148	97	tfor:TF2046|3end_polyribonucleotide_nucleotidyltransferase_2210152..2210302_POSITIVE
376	107	61	54	10	tfor:TF2874|3end_conserved_hypothetical_protein_3065224..3065374_POSITIVE
374	216	172	59	17	tfor:TF2012|3end_conserved_hypothetical_protein_2168720..2168870_POSITIVE
371	46	3	103	44	tfor:TF0001|3end_hypothetical_protein_158..308_POSITIVE
368	245	202	83	35	tfor:TF3107|3end_hypothetical_protein_3338736..3338886_POSITIVE
363	237	192	60	14	tfor:TF0788|3end_protein-export_membrane_protein_841370..841520_POSITIVE
355	250	203	51	1	tfor:TF2266|3end_transfer_region-related_protein,_TraQ_2434949..2435099_POSITIVE
353	250	202	108	63	tfor:TF0880|3end_conserved_hypothetical_protein_934371..934521_POSITIVE
350	217	173	117	49	tfor:TF2745|3end_hypothetical_protein_2927947..2928097_POSITIVE
342	229	182	63	6	tfor:TF2646|3end_conserved_hypothetical_protein_2816697..2816847_POSITIVE
338	210	167	49	1	tfor:TF1255|3end_conserved_hypothetical_protein_1338151..1338301_POSITIVE
337	42	7	123	80	tfor:TF1291|3end_response_regulator_(fimR__protein)_1372647..1372797_POSITIVE
333	217	183	68	40	tfor:TF3067|3end_conserved_hypothetical_protein_3292877..3293027_POSITIVE
331	230	184	126	68	tfor:TF1066|3end_hypothetical_protein_1136858..1137008_POSITIVE
325	220	173	92	24	tfor:TF3153|3end_conserved_hypothetical_protein_3389324..3389474_POSITIVE
325	105	61	67	23	tfor:TF1683|3end_conserved_hypothetical_protein_1796511..1796661_POSITIVE
324	63	21	67	21	tfor:TF2134|3end_conserved_hypothetical_protein_2310187..2310337_POSITIVE
324	226	182	140	81	tfor:TF0405|3end_conserved_hypothetical_protein_424308..424458_POSITIVE
323	229	186	137	89	tfor:TF2042|3end_sugar_phosphate_isomerase,_polysialic_acid_capsule_expression_protein_2202356..2202506_POSITIVE