Origin IGS:
cgcccgaggcctgagggacgaacgccgagggcgttcgaggcgagattcctcactacgttcggaatgacaaagggatatctaaatccatattcattcaggctttcagccctccgctgagatgcgatgcttttttccccaacgcttcgcattggactgaattaatgcgccctttcagggcttttacagcggtcagtaaacaattcaacaactaaacattttttcgaatc
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
gattcgaaaaaatgtttagttgttgaattgtttactgaccgctgtaaaagccctgaaagggcgcattaattcagtccaatgcgaagcgttggggaaaaaagcatcgcatctcagcggagggctgaaagcctgaatgaatatggatttagatatccctttgtcattccgaacgtagtgaggaatctcgcctcgaacgccctcggcgttcgtccctcaggcctcgggcg

Mask Tandem Repeat Region ================================================
cgcccgaggcctgagggacgaacgccgagggcgttcgaggcgagattcctcactacgttcggaatgacaaagggatatctaaatccatattcattcaggctttcagccctccgctgagatgcgatgcttttttccccaacgcttcgcattggactgaattaatgcgccctttcagggcttttacagcggtcagtaaacaattcaacaactaaacattttttcgaatc

Find is-nt database================================================
Query_seq: TF2640:TF2641|TF2640:TF2641:hypothetical protein:riboflavin kinase/FAD synthase:->->:2809594..2809820 227
cgcccgaggcctgagggacgaacgccgagggcgttcgaggcgagattcctcactacgttcggaatgacaaagggatatctaaatccatattcattcaggctttcagccctccgctgagatgcgatgcttttttccccaacgcttcgcattggactgaattaatgcgccctttcagggcttttacagcggtcagtaaacaattcaacaactaaacattttttcgaatc
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: TF2640:TF2641|TF2640:TF2641:hypothetical protein:riboflavin kinase/FAD synthase:->->:2809594..2809820 227
cgcccgaggcctgagggacgaacgccgagggcgttcgaggcgagattcctcactacgttcggaatgacaaagggatatctaaatccatattcattcaggctttcagccctccgctgagatgcgatgcttttttccccaacgcttcgcattggactgaattaatgcgccctttcagggcttttacagcggtcagtaaacaattcaacaactaaacattttttcgaatc
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: TF2640:TF2641|TF2640:TF2641:hypothetical protein:riboflavin kinase/FAD synthase:->->:2809594..2809820 227
cgcccgaggcctgagggacgaacgccgagggcgttcgaggcgagattcctcactacgttcggaatgacaaagggatatctaaatccatattcattcaggctttcagccctccgctgagatgcgatgcttttttccccaacgcttcgcattggactgaattaatgcgccctttcagggcttttacagcggtcagtaaacaattcaacaactaaacattttttcgaatc
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

cgcccgaggcctgagggacgaacgccgagggcgttcgaggcgagattcctcactacgttcggaatgacaaagggatatctaaatccatattcattcaggctttcagccctccgctgagatgcgatgcttttttccccaacgcttcgcattggactgaattaatgcgccctttcagggcttttacagcggtcagtaaacaattcaacaactaaacattttttcgaatc
Predict ORF larger than 30AA ================================================
Protein_Len: 55	Strand: +	Start: 45	End: 209
............................................ M  P  H  Y  V  R  N  D  K  G  I  S  K  S  I  F  I  Q  A  F  S  P  P  L  R  C  D  A  F  F  P  N  A  S  H  W  T  E  L  M  R  P  F  R  A  F  T  A  V  S  K  Q  F  N  N ..................
Protein_Len: 37	Strand: -	Start: 98	End: 208
................................................................................................. A  K  L  G  G  S  L  H  S  A  K  K  G  L  A  E  C  Q  V  S  N  I  R  G  K  L  A  K  V  A  T  L  L  C  N  L  M ...................
Protein_Len: 49	Strand: -	Start: 3	End: 149
.. G  L  G  S  P  R  V  G  L  A  N  S  A  L  N  R  V  V  N  P  I  V  F  P  Y  R  F  G  Y  E  N  L  S  E  A  R  R  Q  S  A  I  S  K  E  G  V  S  R  M ..............................................................................

cgcccgaggcctgagggacgaacgccgagggcgttcgaggcgagattcctcactacgttcggaatgacaaagggatatctaaatccatattcattcaggctttcagccctccgctgagatgcgatgcttttttccccaacgcttcgcattggactgaattaatgcgccctttcagggcttttacagcggtcagtaaacaattcaacaactaaacattttttcgaatc
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

cgcccgaggcctgagggacgaacgccgagggcgttcgaggcgagattcctcactacgttcggaatgacaaagggatatctaaatccatattcattcaggctttcagccctccgctgagatgcgatgcttttttccccaacgcttcgcattggactgaattaatgcgccctttcagggcttttacagcggtcagtaaacaattcaacaactaaacattttttcgaatc
Predict TransTerm conf > 70================================================
TransTerm Strand: +	Conf: 81	HP_score: -9.1	Tail_Score: -4.08767	Start: 166	End: 178	Full_Region: GGACTGAATTAATGC GCCCT TTC AGGGC TTTTACAGCGGTCAG
.....................................................................................................................................................................GCCCTTTCAGGGC.................................................

Find igs database================================================
Query_seq: TF2640:TF2641|TF2640:TF2641:hypothetical protein:riboflavin kinase/FAD synthase:->->:2809594..2809820 227
cgcccgaggcctgagggacgaacgccgagggcgttcgaggcgagattcctcactacgttcggaatgacaaagggatatctaaatccatattcattcaggctttcagccctccgctgagatgcgatgcttttttccccaacgcttcgcattggactgaattaatgcgccctttcagggcttttacagcggtcagtaaacaattcaacaactaaacattttttcgaatc
Intra-Species Hit: Count: 8	Min: 1	Max: 227	Len: 227
Subject: tfor_TF2640_TF2641|hypothetical protein:riboflavin kinase/FAD synthase|POSITIVE:POSITIVE|[2809594,2809820]|227
HSP  1	e-value: 1.0E-126	bit: 450.0	Len: 227	Query Start:1	Query End:227	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 227
cgcccgaggcctgagggacgaacgccgagggcgttcgaggcgagattcctcactacgttcggaatgacaaagggatatctaaatccatattcattcaggctttcagccctccgctgagatgcgatgcttttttccccaacgcttcgcattggactgaattaatgcgccctttcagggcttttacagcggtcagtaaacaattcaacaactaaacattttttcgaatc
cgcccgaggcctgagggacgaacgccgagggcgttcgaggcgagattcctcactacgttcggaatgacaaagggatatctaaatccatattcattcaggctttcagccctccgctgagatgcgatgcttttttccccaacgcttcgcattggactgaattaatgcgccctttcagggcttttacagcggtcagtaaacaattcaacaactaaacattttttcgaatc

Subject: tfor_TF1181_TF1183|methylated-DNA--[protein]-cysteine S-methyltransferase:hypothetical protein|POSITIVE:POSITIVE|[1268052,1268530]|479
HSP  1	e-value: 3.0E-42	bit: 172.0	Len: 115	Query Start:104	Query End:218	Subject Strand: NEGATIVE	Subject Start: 343	Subject End: 457
.......................................................................................................cagccctccgctgagatgcgatgcttttttccccaacgcttcgcattggactgaattaatgcgccctttcagggcttttacagcggtcagtaaacaattcaacaactaaacattt.........
.......................................................................................................cagcccttcgccgagatgcgatgcctttttccccaacgcttcgcattgggctgaattaatgcgccctttcagggcttttacagtggtcagtaaacagatcaacaactaaacattt.........

Subject: tfor_TF0685_TF0686|hypothetical protein:hypothetical protein|POSITIVE:POSITIVE|[731193,732338]|1146
HSP  1	e-value: 1.0E-23	bit: 111.0	Len: 121	Query Start:95	Query End:215	Subject Strand: POSITIVE	Subject Start: 770	Subject End: 900
..............................................................................................tcaggctttcagccctccgctgagatgcgatgcttttttccccaacgcttcgc----------attggactgaattaatgcgccctttcagggcttttacagcggtcagtaaacaattcaacaactaaaca............
..............................................................................................tcaggcttacagccctccgccgagatgcgatgccttttttcccaacgcttcgctgcgctccacattgggctgaattaatgcgccctttcagggctgttacaacggtcagcaaacaaatcaacaactcaaca............

Subject: tfor_TF2914_TF2915|hypothetical protein:hypothetical protein|POSITIVE:POSITIVE|[3109704,3110561]|858
HSP  1	e-value: 3.0E-21	bit: 103.0	Len: 60	Query Start:15	Query End:74	Subject Strand: POSITIVE	Subject Start: 522	Subject End: 581
..............gggacgaacgccgagggcgttcgaggcgagattcctcactacgttcggaatgacaaaggg.........................................................................................................................................................
..............gggacgaacgccgagggcgttcgaggcgagattccttacttcgttcggaatgacaaaggg.........................................................................................................................................................
HSP  2	e-value: 6.0E-13	bit: 75.8	Len: 105	Query Start:95	Query End:199	Subject Strand: POSITIVE	Subject Start: 358	Subject End: 466
..............................................................................................tcaggctttcagccctccgctgagatgcgatgcttttttccccaacgcttcgc-----attggactgaattaatgcgccctttcagggcttttacagcggtcagtaaaca............................
..............................................................................................tcaggctttcagccctccgccgagggggg-tgcctgttttcccaacgcttcgctgcacattgggctgaattaacgtgccctttcagggcttttacagcggtcagcaaaca............................
HSP  3	e-value: 1.0E-7	bit: 58.0	Len: 41	Query Start:34	Query End:74	Subject Strand: POSITIVE	Subject Start: 253	Subject End: 293
.................................ttcgaggcgagattcctcactacgttcggaatgacaaaggg.........................................................................................................................................................
.................................ttcgaggcgagattcctcacggtgttcggaatgacaaaggg.........................................................................................................................................................

Subject: tfor_TF1588_TF1589|hypothetical protein:surface antigen BspA|POSITIVE:POSITIVE|[1702621,1703328]|708
HSP  1	e-value: 4.0E-20	bit: 99.6	Len: 85	Query Start:34	Query End:118	Subject Strand: POSITIVE	Subject Start: 234	Subject End: 319
.................................ttcgaggcgagattcctcactacgttcggaatgacaaagggatatctaaatccat-attcattcaggctttcagccctccgctgag.............................................................................................................
.................................ttcggggcgggattcctcactgcgttcggaatgacaaagggacatccaaatcaatcattcattcaggcttccagccctccgctgag.............................................................................................................
HSP  2	e-value: 1.0E-13	bit: 77.8	Len: 63	Query Start:131	Query End:193	Subject Strand: POSITIVE	Subject Start: 331	Subject End: 393
..................................................................................................................................tttccccaacgcttcgcattggactgaattaatgcgccctttcagggcttttacagcggtcag..................................
..................................................................................................................................tttccccaacgctgcgcattgggctgaattaacacgccctttcagggctcttacagcagtcag..................................
HSP  3	e-value: 5.0E-7	bit: 56.0	Len: 32	Query Start:41	Query End:72	Subject Strand: POSITIVE	Subject Start: 527	Subject End: 558
........................................cgagattcctcactacgttcggaatgacaaag...........................................................................................................................................................
........................................cgagattcctcactgcgttcggaatgacaaag...........................................................................................................................................................

Subject: tfor_TF2920_TF2921|conserved hypothetical protein:hypothetical protein|POSITIVE:POSITIVE|[3117231,3118637]|1407
HSP  1	e-value: 2.0E-16	bit: 87.7	Len: 77	Query Start:42	Query End:118	Subject Strand: POSITIVE	Subject Start: 775	Subject End: 853
.........................................gagattcctcactacgttcggaatgacaaagggat--atctaaatccatattcattcaggctttcagccctccgctgag.............................................................................................................
.........................................gagattcctcactgcgttcggaatgacaaagggcagcatccaaatcattattcattcaggctttcagccctccgctgag.............................................................................................................
HSP  2	e-value: 2.0E-16	bit: 87.7	Len: 76	Query Start:140	Query End:215	Subject Strand: POSITIVE	Subject Start: 888	Subject End: 963
...........................................................................................................................................cgcttcgcattggactgaattaatgcgccctttcagggcttttacagcggtcagtaaacaattcaacaactaaaca............
...........................................................................................................................................cgctgcgcattgggctgaattaatacgccctttcagggctcttacaacggtcagcaaacagatcaacaactaaaca............
HSP  3	e-value: 6.0E-13	bit: 75.8	Len: 71	Query Start:44	Query End:114	Subject Strand: POSITIVE	Subject Start: 458	Subject End: 530
...........................................gattcctcactacgttcggaatgacaaaggg--atatctaaatccatattcattcaggctttcagccctccgc.................................................................................................................
...........................................gattcctcactgcgttcggaatgacaaagggcagcatccaaatcattattcattcaggctttcagccctccgc.................................................................................................................
HSP  4	e-value: 2.0E-9	bit: 63.9	Len: 40	Query Start:147	Query End:186	Subject Strand: POSITIVE	Subject Start: 572	Subject End: 611
..................................................................................................................................................cattggactgaattaatgcgccctttcagggcttttacag.........................................
..................................................................................................................................................cattggactgaattaacgcgccctttcagggctgttacag.........................................

Subject: tfor_TF2823_TF2824|TPR-containing protein:nucleoside-transporting protein nupG|POSITIVE:POSITIVE|[3014398,3014840]|443
HSP  1	e-value: 4.0E-14	bit: 79.8	Len: 63	Query Start:131	Query End:193	Subject Strand: NEGATIVE	Subject Start: 331	Subject End: 394
..................................................................................................................................tttccccaacgcttcgcattggactgaattaatgc-gccctttcagggcttttacagcggtcag..................................
..................................................................................................................................tttccccaacgcttcgcattgggctgaattaacacagccctttcagggctgttacagcggtcag..................................
HSP  2	e-value: 9.0E-9	bit: 61.9	Len: 35	Query Start:40	Query End:74	Subject Strand: NEGATIVE	Subject Start: 101	Subject End: 135
.......................................gcgagattcctcactacgttcggaatgacaaaggg.........................................................................................................................................................
.......................................gcgagattcctcactgcgttcggaatgacaaaggg.........................................................................................................................................................

Subject: tfor_TF2922_TF2923|surface antigen BspA:hypothetical protein|POSITIVE:POSITIVE|[3121599,3122307]|709
HSP  1	e-value: 9.0E-12	bit: 71.9	Len: 72	Query Start:76	Query End:147	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 72
...........................................................................tatctaaatccatattcattcaggctttcagccctccgctgagatgcgatgcttttttccccaacgcttcgc................................................................................
...........................................................................tatccaaatccatattcattcaggctttcagccctccgccgaggggggcgccctttttccccaacgcttcgc................................................................................
HSP  2	e-value: 9.0E-9	bit: 61.9	Len: 31	Query Start:44	Query End:74	Subject Strand: POSITIVE	Subject Start: 468	Subject End: 498
...........................................gattcctcactacgttcggaatgacaaaggg.........................................................................................................................................................
...........................................gattcctcactacgttcggaatgacaaaggg.........................................................................................................................................................

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
CGCCCGAGGCCUGAGGGACGAACGCCGAGGGCGUUCGAGGCGAGAUUCCUCACUACGUUCGGAAUGACAAAGGGAUAUCUAAAUCCAUAUUCAUUCAGGCUUUCAGCCCUCCGCUGAGAUGCGAUGCUUUUUUCCCCAACGCUUCGCAUUGGACUGAAUUAAUGCGCCCUUUCAGGGCUUUUACAGCGGUCAGUAAACAAUUCAACAACUAAACAUUUUUUCGAAUC
.((..((((((.((((((((((((((...))))))))........))))))..........((((((.....((((......))))....)))))).))))))..))...((((((.(((((((.((.............)).)))))))...............((((.....)))).....))))))...................................... (-66.72)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
GAUUCGAAAAAAUGUUUAGUUGUUGAAUUGUUUACUGACCGCUGUAAAAGCCCUGAAAGGGCGCAUUAAUUCAGUCCAAUGCGAAGCGUUGGGGAAAAAAGCAUCGCAUCUCAGCGGAGGGCUGAAAGCCUGAAUGAAUAUGGAUUUAGAUAUCCCUUUGUCAUUCCGAACGUAGUGAGGAAUCUCGCCUCGAACGCCCUCGGCGUUCGUCCCUCAGGCCUCGGGCG
(((((((...(((.....))).))))))).........((((((.....((((.....)))).......(((...(((((((...))))))).)))...............))))))..(.((((..((((((.......((((....((((......))))..))))......(((((....)))))..((((((((...))))))))....)))))).)))).). (-69.80)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
1111	50	1	55	6	tfor:TF3105|5end_hypothetical_protein_3338068..3338298_POSITIVE
1064	50	1	55	7	tfor:TF1187|5end_hypothetical_protein_1269625..1269855_POSITIVE
1064	50	1	165	117	tfor:TF1182|5end_hypothetical_protein_1268565..1268795_POSITIVE
946	70	21	60	11	tfor:TF1846|5end_hypothetical_protein_1996726..1996956_POSITIVE
937	180	131	190	141	tfor:TF1183|5end_hypothetical_protein_1268391..1268621_POSITIVE
933	70	26	45	1	tfor:TF1844|5end_hypothetical_protein_1996389..1996619_POSITIVE
899	150	104	164	118	tfor:TF1186|5end_hypothetical_protein_1269568..1269798_POSITIVE
899	150	104	49	4	tfor:TF0821|5end_hypothetical_protein_879879..880109_POSITIVE
873	190	141	187	138	tfor:TF2517|5end_hypothetical_protein_2695089..2695319_POSITIVE
860	147	104	65	22	tfor:TF3107|5end_hypothetical_protein_3338459..3338689_POSITIVE
858	180	131	200	151	tfor:TF0828|5end_hypothetical_protein_887090..887320_POSITIVE
823	179	131	190	141	tfor:TF2824|5end_nucleoside-transporting_protein_nupG_3014701..3014931_POSITIVE
823	150	104	187	141	tfor:TF1184|5end_hypothetical_protein_1269004..1269234_POSITIVE
819	179	131	116	68	tfor:TF2191|5end_hypothetical_protein_2365934..2366164_POSITIVE
819	179	131	78	30	tfor:TF0822|5end_hypothetical_protein_880487..880717_POSITIVE
771	179	135	219	170	tfor:TF2478|5end_hypothetical_protein_2655375..2655605_POSITIVE
767	180	131	124	65	tfor:TF0538|5end_hypothetical_protein_566891..567121_POSITIVE
767	180	131	117	58	tfor:TF0539|5end_hypothetical_protein_566884..567114_POSITIVE
740	90	41	213	163	tfor:TF1842|5end_hypothetical_protein_1992571..1992801_POSITIVE
663	74	34	185	145	tfor:TF0542|5end_hypothetical_protein_571918..572148_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
943	150	104	117	71	tfor:TF2547|3end_hypothetical_protein_2730947..2731097_POSITIVE
899	150	104	79	33	tfor:TF1185|3end_hypothetical_protein_1269563..1269713_POSITIVE
860	147	104	134	91	tfor:TF3106|3end_hypothetical_protein_3338608..3338758_POSITIVE
814	160	112	51	3	tfor:TF1182|3end_hypothetical_protein_1268938..1269088_POSITIVE
752	179	135	61	17	tfor:TF0820|3end_hypothetical_protein_879942..880092_POSITIVE
733	90	41	94	45	tfor:TF0369|3end_hypothetical_protein_386186..386336_POSITIVE
723	36	1	151	117	tfor:TF1186|3end_hypothetical_protein_1269815..1269965_POSITIVE
663	74	34	45	5	tfor:TF0541|3end_conserved_hypothetical_protein_571858..572008_POSITIVE
625	179	131	82	25	tfor:TF2840|3end_hypothetical_protein_3031289..3031439_POSITIVE
551	190	141	64	10	tfor:TF0533|3end_hypothetical_protein_559519..559669_POSITIVE
530	73	34	84	45	tfor:TF1841|3end_hypothetical_protein_1992267..1992417_POSITIVE
523	147	101	141	94	tfor:TF1405|3end_conserved_hypothetical_protein_1481819..1481969_POSITIVE
497	137	95	128	80	tfor:TF2816|3end_hypothetical_protein_3007184..3007334_POSITIVE
495	138	93	132	86	tfor:TF1274|3end_hypothetical_protein_1357895..1358045_POSITIVE
461	49	2	119	64	tfor:TF2911|3end_hypothetical_protein_3106640..3106790_POSITIVE
455	45	2	144	93	tfor:TF2076|3end_lipopolysaccharide_biosynthesis_protein_2243381..2243531_POSITIVE
442	42	1	117	65	tfor:TF0629|3end_hypothetical_protein_666710..666860_POSITIVE
437	45	1	73	25	tfor:TF2749|3end_possible_hemolysin_2934518..2934668_POSITIVE
434	50	4	65	22	tfor:TF2994|3end_hypothetical_protein_3210849..3210999_POSITIVE
423	43	2	149	115	tfor:TF3087|3end_conserved_hypothetical_protein_3322582..3322732_POSITIVE