Origin IGS:
tgcagtaagtatttatattctattccatgttataaatataagtctgacagtatatttttctcttctgacgtcgcatttttccgttctgacgatatattttttcgatctgacatcgcatttacctttccggcattgcattttacccttttgacatgccgtgatta
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
taatcacggcatgtcaaaagggtaaaatgcaatgccggaaaggtaaatgcgatgtcagatcgaaaaaatatatcgtcagaacggaaaaatgcgacgtcagaagagaaaaatatactgtcagacttatatttataacatggaatagaatataaatacttactgca

Mask Tandem Repeat Region ================================================
tgcagtaagtatttatattctattccatgttataaatataagtctgacagtatatttttctctnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnacctttccggcattgcattttacccttttgacatgccgtgatta

Find is-nt database================================================
Query_seq: TF1175:TF1176|TF1175:TF1176:membrane-fusion protein:outer membrane protein:->->:1259531..1259694 164
tgcagtaagtatttatattctattccatgttataaatataagtctgacagtatatttttctcttctgacgtcgcatttttccgttctgacgatatattttttcgatctgacatcgcatttacctttccggcattgcattttacccttttgacatgccgtgatta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: TF1175:TF1176|TF1175:TF1176:membrane-fusion protein:outer membrane protein:->->:1259531..1259694 164
tgcagtaagtatttatattctattccatgttataaatataagtctgacagtatatttttctcttctgacgtcgcatttttccgttctgacgatatattttttcgatctgacatcgcatttacctttccggcattgcattttacccttttgacatgccgtgatta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: TF1175:TF1176|TF1175:TF1176:membrane-fusion protein:outer membrane protein:->->:1259531..1259694 164
tgcagtaagtatttatattctattccatgttataaatataagtctgacagtatatttttctcttctgacgtcgcatttttccgttctgacgatatattttttcgatctgacatcgcatttacctttccggcattgcattttacccttttgacatgccgtgatta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

tgcagtaagtatttatattctattccatgttataaatataagtctgacagtatatttttctcttctgacgtcgcatttttccgttctgacgatatattttttcgatctgacatcgcatttacctttccggcattgcattttacccttttgacatgccgtgatta
Predict ORF larger than 30AA ================================================
Protein_Len: 46	Strand: +	Start: 11	End: 148
.......... M  Y  I  L  F  H  V  I  N  I  S  L  T  V  Y  F  S  L  L  T  S  H  F  S  V  L  T  I  Y  F  F  D  L  T  S  H  L  P  F  R  H  C  I  L  P  F ................
Protein_Len: 47	Strand: +	Start: 22	End: 162
..................... M  P  C  Y  K  Y  K  S  D  S  I  F  F  S  S  D  V  A  F  F  R  S  D  D  I  F  F  R  S  D  I  A  F  T  F  P  A  L  H  F  T  L  L  T  C  R  D ..
Protein_Len: 32	Strand: -	Start: 23	End: 118
...................... E  M  N  Y  I  Y  T  Q  C  Y  I  K  R  K  Q  R  R  M  K  G  N  Q  R  Y  I  K  E  I  Q  C  R  M ..............................................
Protein_Len: 49	Strand: -	Start: 16	End: 162
............... I  R  N  W  T  I  F  I  L  R  V  T  Y  K  E  R  R  V  D  C  K  E  T  R  V  I  Y  K  K  S  R  V  D  C  K  G  K  R  C  Q  M  K  G  K  Q  C  A  T  M ..

tgcagtaagtatttatattctattccatgttataaatataagtctgacagtatatttttctcttctgacgtcgcatttttccgttctgacgatatattttttcgatctgacatcgcatttacctttccggcattgcattttacccttttgacatgccgtgatta
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

tgcagtaagtatttatattctattccatgttataaatataagtctgacagtatatttttctcttctgacgtcgcatttttccgttctgacgatatattttttcgatctgacatcgcatttacctttccggcattgcattttacccttttgacatgccgtgatta
Predict TransTerm conf > 70================================================

Find igs database================================================
Query_seq: TF1175:TF1176|TF1175:TF1176:membrane-fusion protein:outer membrane protein:->->:1259531..1259694 164
tgcagtaagtatttatattctattccatgttataaatataagtctgacagtatatttttctcttctgacgtcgcatttttccgttctgacgatatattttttcgatctgacatcgcatttacctttccggcattgcattttacccttttgacatgccgtgatta
Intra-Species Hit: Count: 1	Min: 1	Max: 164	Len: 164
Subject: tfor_TF1175_TF1176|membrane-fusion protein:outer membrane protein|POSITIVE:POSITIVE|[1259531,1259694]|164
HSP  1	e-value: 3.0E-88	bit: 325.0	Len: 164	Query Start:1	Query End:164	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 164
tgcagtaagtatttatattctattccatgttataaatataagtctgacagtatatttttctcttctgacgtcgcatttttccgttctgacgatatattttttcgatctgacatcgcatttacctttccggcattgcattttacccttttgacatgccgtgatta
tgcagtaagtatttatattctattccatgttataaatataagtctgacagtatatttttctcttctgacgtcgcatttttccgttctgacgatatattttttcgatctgacatcgcatttacctttccggcattgcattttacccttttgacatgccgtgatta

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UGCAGUAAGUAUUUAUAUUCUAUUCCAUGUUAUAAAUAUAAGUCUGACAGUAUAUUUUUCUCUUCUGACGUCGCAUUUUUCCGUUCUGACGAUAUAUUUUUUCGAUCUGACAUCGCAUUUACCUUUCCGGCAUUGCAUUUUACCCUUUUGACAUGCCGUGAUUA
(((.....(((((((((..(........).)))))))))..(((.(((((..............))).(((((.............)))))..............)).)))...)))........((((((((..((...........))..)))))).))... (-23.16)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UAAUCACGGCAUGUCAAAAGGGUAAAAUGCAAUGCCGGAAAGGUAAAUGCGAUGUCAGAUCGAAAAAAUAUAUCGUCAGAACGGAAAAAUGCGACGUCAGAAGAGAAAAAUAUACUGUCAGACUUAUAUUUAUAACAUGGAAUAGAAUAUAAAUACUUACUGCA
...((.((((((...................))))))))..(((((....((((((.((.(((.........)))))....((......)).))))))...........((((.(((((....((((....))))....).)))).))))......)))))... (-22.01)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
427	160	113	53	6	tfor:TF0944|5end_TonB-dependent_receptor_986340..986570_POSITIVE
348	130	82	126	64	tfor:TF1740|5end_hypothetical_protein_1868645..1868875_POSITIVE
335	157	112	60	6	tfor:TF2709|5end_hypothetical_protein_2882160..2882390_POSITIVE
316	158	112	155	113	tfor:TF0236|5end_multidrug_resistance_protein_261779..262009_POSITIVE
315	91	59	193	150	tfor:TF3071|5end_integral_membrane_protein,_possible_MotA/TolQ/ExbB_proton_channel_family_3294703..3294933_POSITIVE
307	88	44	50	13	tfor:TF2846|5end_cobyric_acid_synthase_3034896..3035126_POSITIVE
306	110	63	203	164	tfor:TF2832|5end_possible_proton/sodium:glutamate_symporter_protein_3022660..3022890_POSITIVE
304	109	69	64	23	tfor:TF2328|5end_conserved_hypothetical_protein_2487184..2487414_POSITIVE
303	159	112	164	111	tfor:TF1925|5end_hypothetical_protein_2074458..2074688_POSITIVE
303	159	112	121	68	tfor:TF1926|5end_hypothetical_protein_2074415..2074645_POSITIVE
301	160	111	44	2	tfor:TF1493|5end_thioredoxin_family_protein_1592883..1593113_POSITIVE
298	93	55	175	138	tfor:TF2561|5end_50S_ribosomal_protein_L16_2738693..2738923_POSITIVE
296	158	112	62	11	tfor:TF0816|5end_hypothetical_protein_874217..874447_POSITIVE
293	158	122	177	140	tfor:TF3141|5end_NADH:_ubiquinone_oxidoreductase,_subunit_A_3374667..3374897_POSITIVE
290	130	81	70	14	tfor:TF0380|5end_conserved_hypothetical_protein_400762..400992_POSITIVE
287	89	45	108	63	tfor:TF2569|5end_50S_ribosomal_protein_L6_2741622..2741852_POSITIVE
287	140	99	106	48	tfor:TF1667|5end_biotin_acetyl-CoA_carboxylase_ligase/biotin_operon_repressor_bifunctional_protein_1779809..1780039_POSITIVE
286	130	81	230	173	tfor:TF2419|5end_conserved_hypothetical_protein;_possible_DNA_uptake-related_protein_2598358..2598588_POSITIVE
286	159	111	178	129	tfor:TF2261|5end_transfer_region-related_protein,_TraM_2430496..2430726_POSITIVE
286	130	82	230	166	tfor:TF1617|5end_conserved_hypothetical_protein;_possible_methyltransferase_1733150..1733380_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
316	158	112	145	103	tfor:TF0235|3end_hypothetical_protein_261849..261999_POSITIVE
307	88	44	59	22	tfor:TF2847|3end_hypothetical_protein_3034985..3035135_POSITIVE
306	110	63	134	95	tfor:TF2831|3end_ABC_transporter,_permease_component_3022671..3022821_POSITIVE
303	159	112	143	90	tfor:TF1915|3end_NAD-dependent_protein_deacetylase,_SIR2_family_2068489..2068639_POSITIVE
298	93	55	149	112	tfor:TF2560|3end_30S_ribosomal_protein_S3_2738747..2738897_POSITIVE
287	89	45	85	40	tfor:TF2568|3end_30S_ribosomal_protein_S8_2741679..2741829_POSITIVE
285	116	71	140	83	tfor:TF3124|3end_dTDP-glucose_4,6-dehydratase_3359883..3360033_POSITIVE
285	159	112	134	94	tfor:TF2660|3end_hypothetical_protein_2833540..2833690_POSITIVE
284	108	64	113	69	tfor:TF2789|3end_enoyl-[acyl-carrier-protein]_reductase_2973365..2973515_POSITIVE
281	117	73	62	11	tfor:TF2245|3end_conserved_hypothetical_protein_2421291..2421441_POSITIVE
281	160	123	33	1	tfor:TF1818|3end_conserved_hypothetical_protein_1958754..1958904_POSITIVE
280	144	102	83	31	tfor:TF0810|3end_possible_outer_membrane_efflux_protein_869696..869846_POSITIVE
278	160	114	133	82	tfor:TF2173|3end_hypothetical_protein_2346063..2346213_POSITIVE
278	160	114	133	82	tfor:TF0346|3end_hypothetical_protein_367316..367466_POSITIVE
277	159	111	140	94	tfor:TF1540|3end_possible_ATPase_1645987..1646137_POSITIVE
273	160	113	120	56	tfor:TF2008|3end_DNA_polymerase_I_2162183..2162333_POSITIVE
272	136	96	150	115	tfor:TF2433|3end_possible_UDP-2,3-diacylglucosamine_hydrolase_2614043..2614193_POSITIVE
271	129	81	47	1	tfor:TF1488|3end_conserved_hypothetical_protein_1588975..1589125_POSITIVE
270	157	112	59	6	tfor:TF0336|3end_Xaa-Pro_aminopeptidase_361868..362018_POSITIVE
268	131	100	131	100	tfor:TF2937|3end_translation_elongation_factor_Tu_3140502..3140652_POSITIVE