Origin IGS:
tagccatcgttcgtgaatgaggagagtgagaaacgaagaacgaaaagtgaaatatgcgtttatttgcgtcatttgcgttactcgcgttcgaatcgaacatcgcaattcgtaattcgacattcgtaattcattctta
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
taagaatgaattacgaatgtcgaattacgaattgcgatgttcgattcgaacgcgagtaacgcaaatgacgcaaataaacgcatatttcacttttcgttcttcgtttctcactctcctcattcacgaacgatggcta

Mask Tandem Repeat Region ================================================
tagccatcgttcgtgaatgaggagagtgagaaacgaagaacgaaaagtgaaatatgcgtttatttgcgtcatttgcgttactcgcgttcgaatcgaacatcgcaattcgtaattcgacattcgtaattcattctta

Find is-nt database================================================
Query_seq: TF2013:TF2014|TF2013:TF2014:polysaccharide deacetylase:dipeptidyl aminopeptidase IV:->->:2169402..2169537 136
tagccatcgttcgtgaatgaggagagtgagaaacgaagaacgaaaagtgaaatatgcgtttatttgcgtcatttgcgttactcgcgttcgaatcgaacatcgcaattcgtaattcgacattcgtaattcattctta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: TF2013:TF2014|TF2013:TF2014:polysaccharide deacetylase:dipeptidyl aminopeptidase IV:->->:2169402..2169537 136
tagccatcgttcgtgaatgaggagagtgagaaacgaagaacgaaaagtgaaatatgcgtttatttgcgtcatttgcgttactcgcgttcgaatcgaacatcgcaattcgtaattcgacattcgtaattcattctta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: TF2013:TF2014|TF2013:TF2014:polysaccharide deacetylase:dipeptidyl aminopeptidase IV:->->:2169402..2169537 136
tagccatcgttcgtgaatgaggagagtgagaaacgaagaacgaaaagtgaaatatgcgtttatttgcgtcatttgcgttactcgcgttcgaatcgaacatcgcaattcgtaattcgacattcgtaattcattctta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

tagccatcgttcgtgaatgaggagagtgagaaacgaagaacgaaaagtgaaatatgcgtttatttgcgtcatttgcgttactcgcgttcgaatcgaacatcgcaattcgtaattcgacattcgtaattcattctta
Predict ORF larger than 30AA ================================================
Protein_Len: 31	Strand: +	Start: 17	End: 109
................ M  R  R  V  R  N  E  E  R  K  V  K  Y  A  F  I  C  V  I  C  V  T  R  V  R  I  E  H  R  N  S ...........................
Protein_Len: 37	Strand: +	Start: 13	End: 123
............ M  N  E  E  S  E  K  R  R  T  K  S  E  I  C  V  Y  L  R  H  L  R  Y  S  R  S  N  R  T  S  Q  F  V  I  R  H  S .............
Protein_Len: 42	Strand: -	Start: 2	End: 127
. A  M  T  R  S  H  P  S  H  S  V  F  F  S  F  H  F  I  R  K  N  A  D  N  A  N  S  A  N  S  D  F  M  A  I  R  L  E  V  N  T  M .........
Protein_Len: 40	Strand: -	Start: 1	End: 120
 L  W  R  E  H  I  L  L  T  L  F  S  S  R  F  T  F  Y  A  N  I  Q  T  M  Q  T  V  R  T  R  I  S  C  R  L  E  Y  N  S  M ................

tagccatcgttcgtgaatgaggagagtgagaaacgaagaacgaaaagtgaaatatgcgtttatttgcgtcatttgcgttactcgcgttcgaatcgaacatcgcaattcgtaattcgacattcgtaattcattctta
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

tagccatcgttcgtgaatgaggagagtgagaaacgaagaacgaaaagtgaaatatgcgtttatttgcgtcatttgcgttactcgcgttcgaatcgaacatcgcaattcgtaattcgacattcgtaattcattctta
Predict TransTerm conf > 70================================================

Find igs database================================================
Query_seq: TF2013:TF2014|TF2013:TF2014:polysaccharide deacetylase:dipeptidyl aminopeptidase IV:->->:2169402..2169537 136
tagccatcgttcgtgaatgaggagagtgagaaacgaagaacgaaaagtgaaatatgcgtttatttgcgtcatttgcgttactcgcgttcgaatcgaacatcgcaattcgtaattcgacattcgtaattcattctta
Intra-Species Hit: Count: 1	Min: 1	Max: 136	Len: 136
Subject: tfor_TF2013_TF2014|polysaccharide deacetylase:dipeptidyl aminopeptidase IV|POSITIVE:POSITIVE|[2169402,2169537]|136
HSP  1	e-value: 1.0E-71	bit: 270.0	Len: 136	Query Start:1	Query End:136	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 136
tagccatcgttcgtgaatgaggagagtgagaaacgaagaacgaaaagtgaaatatgcgtttatttgcgtcatttgcgttactcgcgttcgaatcgaacatcgcaattcgtaattcgacattcgtaattcattctta
tagccatcgttcgtgaatgaggagagtgagaaacgaagaacgaaaagtgaaatatgcgtttatttgcgtcatttgcgttactcgcgttcgaatcgaacatcgcaattcgtaattcgacattcgtaattcattctta

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UAGCCAUCGUUCGUGAAUGAGGAGAGUGAGAAACGAAGAACGAAAAGUGAAAUAUGCGUUUAUUUGCGUCAUUUGCGUUACUCGCGUUCGAAUCGAACAUCGCAAUUCGUAAUUCGACAUUCGUAAUUCAUUCUUA
......(((((....))))).(((((((((..((((((((((...(((((...((((((......))).))).....)))))..)))))...(((((...((.....))...)))))..)))))..))))))))). (-33.90)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UAAGAAUGAAUUACGAAUGUCGAAUUACGAAUUGCGAUGUUCGAUUCGAACGCGAGUAACGCAAAUGACGCAAAUAAACGCAUAUUUCACUUUUCGUUCUUCGUUUCUCACUCUCCUCAUUCACGAACGAUGGCUA
...((((((....((((((((((((.....))).)))))))))....(((.(((((.((((.((((((.((........)).....))).))).)))).)))))))).........)))))).............. (-26.90)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
477	90	41	224	175	tfor:TF1841|5end_hypothetical_protein_1991936..1992166_POSITIVE
448	100	55	102	53	tfor:TF1184|5end_hypothetical_protein_1269004..1269234_POSITIVE
440	90	47	55	11	tfor:TF2652|5end_hypothetical_protein_2821803..2822033_POSITIVE
427	96	55	226	179	tfor:TF1844|5end_hypothetical_protein_1996389..1996619_POSITIVE
423	99	55	137	87	tfor:TF3105|5end_hypothetical_protein_3338068..3338298_POSITIVE
423	50	1	119	64	tfor:TF1173|5end_ABC_transporter,_permease_component_1255444..1255674_POSITIVE
410	48	7	140	99	tfor:TF2779|5end_fucose_permease_2964566..2964796_POSITIVE
410	50	8	211	167	tfor:TF1588|5end_hypothetical_protein_1702268..1702498_POSITIVE
403	107	61	166	116	tfor:TF2816|5end_hypothetical_protein_3006925..3007155_POSITIVE
383	50	1	129	72	tfor:TF1589|5end_surface_antigen_BspA_1703189..1703419_POSITIVE
382	57	13	136	87	tfor:TF1172|5end_ABC_transporter,_permease_component_1252806..1253036_POSITIVE
377	57	18	127	92	tfor:TF0359|5end_conserved_hypothetical_protein_376943..377173_POSITIVE
370	100	55	136	87	tfor:TF1187|5end_hypothetical_protein_1269625..1269855_POSITIVE
370	100	55	79	30	tfor:TF1186|5end_hypothetical_protein_1269568..1269798_POSITIVE
367	69	21	145	102	tfor:TF0347|5end_possible_serine_protease_367542..367772_POSITIVE
358	102	61	36	2	tfor:TF0373|5end_conserved_hypothetical_protein,_yngK-related_391038..391268_POSITIVE
357	69	21	143	93	tfor:TF2167|5end_hypothetical_protein_2342586..2342816_POSITIVE
331	48	1	120	72	tfor:TF1591|5end_surface_antigen_BspA_1706387..1706617_POSITIVE
329	89	41	165	119	tfor:TF0307|5end_conserved_hypothetical_protein_332783..333013_POSITIVE
327	57	18	127	92	tfor:TF0351|5end_hypothetical_protein_370922..371152_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
475	90	55	128	93	tfor:TF1841|3end_hypothetical_protein_1992267..1992417_POSITIVE
369	100	55	68	20	tfor:TF2823|3end_TPR-containing_protein_3014337..3014487_POSITIVE
358	102	61	36	2	tfor:TF0372|3end_transcriptional_regulator_391118..391268_POSITIVE
356	57	14	49	1	tfor:TF1170|3end_conserved_hypothetical_protein_1252799..1252949_POSITIVE
329	89	41	51	5	tfor:TF0306|3end_transglutaminase-like_enzyme/cysteine_protease_332749..332899_POSITIVE
316	110	61	64	4	tfor:TF2659|3end_conserved_hypothetical_protein_2833055..2833205_POSITIVE
315	36	3	72	38	tfor:TF3155|3end_glycosyltransferase,_group_2_family_protein_3391444..3391594_POSITIVE
315	124	81	91	56	tfor:TF2430|3end_hypothetical_protein_2613204..2613354_POSITIVE
314	88	47	44	8	tfor:TF0078|3end_aminopeptidase_C,_peptidase_C1-like_family_85802..85952_POSITIVE
313	104	62	124	82	tfor:TF1291|3end_response_regulator_(fimR__protein)_1372647..1372797_POSITIVE
312	102	64	149	118	tfor:TF1245|3end_LemA_protein_1329462..1329612_POSITIVE
309	56	21	82	47	tfor:TF1783|3end_conserved_hypothetical_protein_1923865..1924015_POSITIVE
306	109	62	151	93	tfor:TF1104|3end_hypothetical_protein_1172194..1172344_POSITIVE
301	40	7	69	27	tfor:TF1985|3end_surface_antigen_BspA_2136905..2137055_POSITIVE
300	100	57	43	1	tfor:TF2816|3end_hypothetical_protein_3007184..3007334_POSITIVE
299	109	63	148	97	tfor:TF1184|3end_hypothetical_protein_1269311..1269461_POSITIVE
299	109	63	148	97	tfor:TF1183|3end_hypothetical_protein_1268728..1268878_POSITIVE
297	85	57	145	119	tfor:TF1276|3end_acyl-CoA_dehydrogenase_(short_chain_coenzyme_A_dehydrogenase)_1363080..1363230_POSITIVE
296	42	1	143	105	tfor:TF2852|3end_conserved_hypothetical_protein_3040221..3040371_POSITIVE
295	44	7	49	15	tfor:TF2365|3end_conserved_hypothetical_protein_2531280..2531430_POSITIVE