Origin IGS:
tgagaaaaactaataatgagatagaacgatgaaagtaagaacatctttaaagaaacggacgcccgactgcaagattgtacgccggaaggggcgtttatatgtgattaacaagaagaaccccaagttcaaggtacgtcaggggtagtagtaaactgcaaataaactaaacatctaaataat
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
attatttagatgtttagtttatttgcagtttactactacccctgacgtaccttgaacttggggttcttcttgttaatcacatataaacgccccttccggcgtacaatcttgcagtcgggcgtccgtttctttaaagatgttcttactttcatcgttctatctcattattagtttttctca

Mask Tandem Repeat Region ================================================
tgagaaaaactaataatgagatagaacgatgaaagtaagaacatctttaaagaaacggacgcccgactgcaagattgtacgccggaaggggcgtttatatgtgattaacaagaagaaccccaagttcaaggtacgtcaggggtagtagtaaactgcaaataaactaaacatctaaataat

Find is-nt database================================================
Query_seq: TF2576:TF2577|TF2576:TF2577:translation initiation factor IF-1:30S ribosomal protein S13:->->:2746268..2746447 180
tgagaaaaactaataatgagatagaacgatgaaagtaagaacatctttaaagaaacggacgcccgactgcaagattgtacgccggaaggggcgtttatatgtgattaacaagaagaaccccaagttcaaggtacgtcaggggtagtagtaaactgcaaataaactaaacatctaaataat
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: TF2576:TF2577|TF2576:TF2577:translation initiation factor IF-1:30S ribosomal protein S13:->->:2746268..2746447 180
tgagaaaaactaataatgagatagaacgatgaaagtaagaacatctttaaagaaacggacgcccgactgcaagattgtacgccggaaggggcgtttatatgtgattaacaagaagaaccccaagttcaaggtacgtcaggggtagtagtaaactgcaaataaactaaacatctaaataat
Intra-Species Hit: Count: 0

Inter-species Hit: Count: 1	Min: 29	Max: 142	Len: 114
Subject: gi|89107170|ref|AP_000950.1| predicted ribosomal protein [Escherichia coli W3110]
HSP  1	e-value: 8.0E-8	bit: 52.4	Len: 114	Query Start:29	Query End:142	Subject Strand: null	Subject Start: 1	Subject End: 41
............................ M  K  V  R  T  S  L  -  -  -  K  K  R  T  P  D  C  K  I  V  R  R  K  G  R  L  Y  V  I  N  K  K  N  P  K  F  K  V  R  Q  G ......................................
............................ M  K  V  L  N  S  L  R  T  A  K  E  R  H  P  D  C  Q  I  V  K  R  K  G  R  L  Y  V  I  C  K  S  N  P  R  F  K  A  V  Q  G ......................................


Find nr database================================================
Query_seq: TF2576:TF2577|TF2576:TF2577:translation initiation factor IF-1:30S ribosomal protein S13:->->:2746268..2746447 180
tgagaaaaactaataatgagatagaacgnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntagtagtaaactgcaaataaactaaacatctaaataat
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

tgagaaaaactaataatgagatagaacgnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntagtagtaaactgcaaataaactaaacatctaaataat
Predict ORF larger than 30AA ================================================
Protein_Len: 38	Strand: +	Start: 29	End: 142
............................ M  K  V  R  T  S  L  K  K  R  T  P  D  C  K  I  V  R  R  K  G  R  L  Y  V  I  N  K  K  N  P  K  F  K  V  R  Q  G ......................................
Protein_Len: 39	Strand: -	Start: 13	End: 129
............ Y  H  S  L  V  I  F  T  L  V  D  K  F  F  R  V  G  S  Q  L  I  T  R  R  F  P  R  K  Y  T  I  L  L  F  F  G  L  N  M ...................................................
Protein_Len: 32	Strand: -	Start: 3	End: 98
.. S  F  S  I  I  L  Y  F  S  S  L  L  F  M  K  L  S  V  S  A  R  S  C  S  Q  V  G  S  P  A  N  M ..................................................................................

tgagaaaaactaataatgagatagaacgnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntagtagtaaactgcaaataaactaaacatctaaataat
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

tgagaaaaactaataatgagatagaacgnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntagtagtaaactgcaaataaactaaacatctaaataat
Predict TransTerm conf > 70================================================

Find igs database================================================
Query_seq: TF2576:TF2577|TF2576:TF2577:translation initiation factor IF-1:30S ribosomal protein S13:->->:2746268..2746447 180
tgagaaaaactaataatgagatagaacgnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntagtagtaaactgcaaataaactaaacatctaaataat
Intra-Species Hit: Count: 1	Min: 1	Max: 180	Len: 180
Subject: tfor_TF2576_TF2577|translation initiation factor IF-1:30S ribosomal protein S13|POSITIVE:POSITIVE|[2746268,2746447]|180
HSP  1	e-value: 4.0E-13	bit: 75.8	Len: 38	Query Start:143	Query End:180	Subject Strand: POSITIVE	Subject Start: 143	Subject End: 180
..............................................................................................................................................tagtagtaaactgcaaataaactaaacatctaaataat
..............................................................................................................................................tagtagtaaactgcaaataaactaaacatctaaataat
HSP  2	e-value: 2.0E-6	bit: 54.0	Len: 27	Query Start:1	Query End:27	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 27
tgagaaaaactaataatgagatagaac.........................................................................................................................................................
tgagaaaaactaataatgagatagaac.........................................................................................................................................................

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UGAGAAAAACUAAUAAUGAGAUAGAACGAUGAAAGUAAGAACAUCUUUAAAGAAACGGACGCCCGACUGCAAGAUUGUACGCCGGAAGGGGCGUUUAUAUGUGAUUAACAAGAAGAACCCCAAGUUCAAGGUACGUCAGGGGUAGUAGUAAACUGCAAAUAAACUAAACAUCUAAAUAAU
...........................((((..(((.......(((((........((((((((...((((....))))...(....)))))))))...(((.....))).)))))(((((..((.......))....))))).((((....))))......)))...))))........ (-32.10)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
AUUAUUUAGAUGUUUAGUUUAUUUGCAGUUUACUACUACCCCUGACGUACCUUGAACUUGGGGUUCUUCUUGUUAAUCACAUAUAAACGCCCCUUCCGGCGUACAAUCUUGCAGUCGGGCGUCCGUUUCUUUAAAGAUGUUCUUACUUUCAUCGUUCUAUCUCAUUAUUAGUUUUUCUCA
........((((...(((....((((((.........(((((.................)))))......................(((((......)))))......))))))..(((((((..(......)..)))))))..)))..))))........................... (-30.13)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
407	97	51	81	25	tfor:TF1304|5end_conserved_hypothetical_protein_1385008..1385238_POSITIVE
395	96	62	212	167	tfor:TF0637|5end_TPR-repeat-containing_protein_673195..673425_POSITIVE
384	102	61	51	5	tfor:TF0089|5end_conserved_hypothetical_protein_95437..95667_POSITIVE
377	93	53	165	114	tfor:TF3064|5end_oxidoreductase,_aldo/keto_reductase_family_3289765..3289995_POSITIVE
376	96	55	57	11	tfor:TF0996|5end_ribonuclease_D_1050882..1051112_POSITIVE
371	93	55	186	140	tfor:TF2825|5end_transposase_3016390..3016620_POSITIVE
371	93	55	186	140	tfor:TF2591|5end_transposase_2757641..2757871_POSITIVE
371	93	55	186	140	tfor:TF2110|5end_transposase_2279217..2279447_POSITIVE
371	93	55	186	140	tfor:TF0942|5end_transposase_982998..983228_POSITIVE
371	93	55	186	140	tfor:TF0716|5end_transposase_766297..766527_POSITIVE
363	90	56	65	33	tfor:TF1939|5end_hypothetical_protein_2086299..2086529_POSITIVE
356	95	55	127	77	tfor:TF0833|5end_conserved_hypothetical_protein_888757..888987_POSITIVE
351	98	51	156	110	tfor:TF0842|5end_long-chain-fatty-acid--CoA_ligase_893053..893283_POSITIVE
348	94	51	201	152	tfor:TF0881|5end_conserved_hypothetical_protein_934459..934689_POSITIVE
347	95	53	129	90	tfor:TF0253|5end_conserved_hypothetical_protein_283707..283937_POSITIVE
346	93	55	186	140	tfor:TF3000|5end_hypothetical_protein_3216412..3216642_POSITIVE
346	95	56	194	140	tfor:TF2372|5end_acyl-(acyl-carrier-protein)-UDP-N-acetylglucosami_ne_acyltransferase_2537558..2537788_POSITIVE
346	92	51	72	30	tfor:TF0611|5end_lysine_decarboxylase_642750..642980_POSITIVE
342	95	60	40	6	tfor:TF3105|5end_hypothetical_protein_3338068..3338298_POSITIVE
338	93	56	157	123	tfor:TF1947|5end_conserved_hypothetical_protein_2095521..2095751_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
377	93	53	141	90	tfor:TF3063|3end_ferredoxin-type_protein_3289821..3289971_POSITIVE
376	96	55	57	11	tfor:TF0995|3end_conserved_hypothetical_protein_1050962..1051112_POSITIVE
358	93	52	65	21	tfor:TF0616|3end_conserved_hypothetical_protein_650658..650808_POSITIVE
356	95	55	78	28	tfor:TF0832|3end_conserved_hypothetical_protein_888788..888938_POSITIVE
351	98	51	71	25	tfor:TF0841|3end_NADH_dehydrogenase/NAD(P)H_nitroreductase_893048..893198_POSITIVE
350	104	66	47	7	tfor:TF1327|3end_L-fucose_permease_1407195..1407345_POSITIVE
347	95	53	101	62	tfor:TF0252|3end_hypothetical_protein_283759..283909_POSITIVE
346	92	51	55	13	tfor:TF0609|3end_conserved_hypothetical_protein_642813..642963_POSITIVE
336	93	56	65	26	tfor:TF2012|3end_conserved_hypothetical_protein_2168720..2168870_POSITIVE
329	94	55	53	11	tfor:TF2205|3end_conserved_hypothetical_protein;_possible_transcriptional_regulator_2380010..2380160_POSITIVE
324	99	53	148	90	tfor:TF2189|3end_conserved_hypothetical_protein_2364884..2365034_POSITIVE
324	83	41	62	18	tfor:TF1638|3end_conserved_hypothetical_protein_1747732..1747882_POSITIVE
322	93	55	47	6	tfor:TF2409|3end_hypothetical_protein_2584155..2584305_POSITIVE
322	93	56	111	69	tfor:TF1775|3end_oxidoreductase,_Gfo/Idh/MocA_family_1914618..1914768_POSITIVE
321	96	51	61	12	tfor:TF2803|3end_dehydrogenase,_possible_NADH-dependent_dehydrogenase_2993467..2993617_POSITIVE
321	95	56	150	109	tfor:TF1186|3end_hypothetical_protein_1269815..1269965_POSITIVE
320	98	59	49	6	tfor:TF2374|3end_UDP-3-O-(R-3-hydoxymyristoyl)-glucosamine-N-acylt_ransferase_2540892..2541042_POSITIVE
319	96	57	137	95	tfor:TF2893|3end_conserved_hypothetical_protein;_possible_phosphoesterase_3082039..3082189_POSITIVE
315	93	56	149	119	tfor:TF2895|3end_hypothetical_protein_3084192..3084342_POSITIVE
315	99	52	88	29	tfor:TF2444|3end_regulatory_protein_RecX_2621549..2621699_POSITIVE