Origin IGS:
tattttatatcaggcttacagccctccgcaaggagattgctttttccccagcgcttcgcattgggctgaattaacacgccctttcagggctcttacagcagtcagccgtcagttccgcattcctccttggaagggggggaagggggatgttcatatcggcatta
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
taatgccgatatgaacatcccccttcccccccttccaaggaggaatgcggaactgacggctgactgctgtaagagccctgaaagggcgtgttaattcagcccaatgcgaagcgctggggaaaaagcaatctccttgcggagggctgtaagcctgatataaaata

Mask Tandem Repeat Region ================================================
tattttatatcaggcttacagccctccgcaaggagattgctttttccccagcgcttcgcattgggctgaattaacacgccctttcagggctcttacagcagtcagccgtcagttccgcattcctccttggaagggggggaagggggatgttcatatcggcatta

Find is-nt database================================================
Query_seq: TF0344:TF0346|TF0344:TF0346:hypothetical protein:hypothetical protein:->->:367024..367187 164
tattttatatcaggcttacagccctccgcaaggagattgctttttccccagcgcttcgcattgggctgaattaacacgccctttcagggctcttacagcagtcagccgtcagttccgcattcctccttggaagggggggaagggggatgttcatatcggcatta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: TF0344:TF0346|TF0344:TF0346:hypothetical protein:hypothetical protein:->->:367024..367187 164
tattttatatcaggcttacagccctccgcaaggagattgctttttccccagcgcttcgcattgggctgaattaacacgccctttcagggctcttacagcagtcagccgtcagttccgcattcctccttggaagggggggaagggggatgttcatatcggcatta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: TF0344:TF0346|TF0344:TF0346:hypothetical protein:hypothetical protein:->->:367024..367187 164
tattttatatcaggcttacagccctccgcaaggagattgctttttccccagcgcttcgcattgggctgaattaacacgccctttcagggctcttacagcagtcagccgtcagttccgcattcctccttggaagggggggaagggggatgttcatatcggcatta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

tattttatatcaggcttacagccctccgcaaggagattgctttttccccagcgcttcgcattgggctgaattaacacgccctttcagggctcttacagcagtcagccgtcagttccgcattcctccttggaagggggggaagggggatgttcatatcggcatta
Predict ORF larger than 30AA ================================================
Protein_Len: 31	Strand: +	Start: 70	End: 162
..................................................................... M  N  T  P  F  Q  G  S  Y  S  S  Q  P  S  V  P  H  S  S  L  E  G  G  E  G  G  C  S  Y  R  H ..
Protein_Len: 54	Strand: +	Start: 2	End: 163
. M  L  Y  Q  A  Y  S  P  P  Q  G  D  C  F  F  P  S  A  S  H  W  A  E  L  T  R  P  F  R  A  L  T  A  V  S  R  Q  F  R  I  P  P  W  K  G  G  K  G  D  V  H  I  G  I .

tattttatatcaggcttacagccctccgcaaggagattgctttttccccagcgcttcgcattgggctgaattaacacgccctttcagggctcttacagcagtcagccgtcagttccgcattcctccttggaagggggggaagggggatgttcatatcggcatta
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

tattttatatcaggcttacagccctccgcaaggagattgctttttccccagcgcttcgcattgggctgaattaacacgccctttcagggctcttacagcagtcagccgtcagttccgcattcctccttggaagggggggaagggggatgttcatatcggcatta
Predict TransTerm conf > 70================================================

Find igs database================================================
Query_seq: TF0344:TF0346|TF0344:TF0346:hypothetical protein:hypothetical protein:->->:367024..367187 164
tattttatatcaggcttacagccctccgcaaggagattgctttttccccagcgcttcgcattgggctgaattaacacgccctttcagggctcttacagcagtcagccgtcagttccgcattcctccttggaagggggggaagggggatgttcatatcggcatta
Intra-Species Hit: Count: 6	Min: 1	Max: 132	Len: 132
Subject: tfor_TF0344_TF0346|hypothetical protein:hypothetical protein|POSITIVE:POSITIVE|[367024,367187]|164
HSP  1	e-value: 3.0E-69	bit: 262.0	Len: 132	Query Start:1	Query End:132	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 132
tattttatatcaggcttacagccctccgcaaggagattgctttttccccagcgcttcgcattgggctgaattaacacgccctttcagggctcttacagcagtcagccgtcagttccgcattcctccttggaa................................
tattttatatcaggcttacagccctccgcaaggagattgctttttccccagcgcttcgcattgggctgaattaacacgccctttcagggctcttacagcagtcagccgtcagttccgcattcctccttggaa................................

Subject: tfor_TF2165_TF2166|hypothetical protein:hypothetical protein|POSITIVE:POSITIVE|[2341983,2342254]|272
HSP  1	e-value: 1.0E-28	bit: 127.0	Len: 131	Query Start:2	Query End:132	Subject Strand: POSITIVE	Subject Start: 107	Subject End: 240
.attttatatcaggcttacagccctccgcaagga---gattgctttttccccagcgcttcgcattgggctgaattaacacgccctttcagggctcttacagcagtcagccgtcagttccgcattcctccttggaa................................
.attttatatcaggcttacagcccttcgccgagacgcgatgcctttttccccagcgcttcgcattgggctgaattaatgcgcccctgcggagctgttacagcggtcagccgtcagttccgcattcctccttggaa................................

Subject: tfor_TF2047_TF2048|hypothetical protein:conserved hypothetical protein|POSITIVE:POSITIVE|[2210359,2210782]|424
HSP  1	e-value: 4.0E-19	bit: 95.6	Len: 103	Query Start:10	Query End:112	Subject Strand: POSITIVE	Subject Start: 68	Subject End: 173
.........tcaggcttacagccctccgcaagga---gattgctttttccccagcgcttcgcattgggctgaattaacacgccctttcagggctcttacagcagtcagccgtcag....................................................
.........tcaggcttacagccctccgccgggatgcgatgcctttttccccaacgcttcgcattgggctgaattatctcgccctttcagggctctttctgcaatcagcagtcag....................................................

Subject: tfor_TF2169_TF2171|hypothetical protein:hypothetical protein|POSITIVE:POSITIVE|[2345415,2345624]|210
HSP  1	e-value: 2.0E-15	bit: 83.8	Len: 74	Query Start:59	Query End:132	Subject Strand: POSITIVE	Subject Start: 105	Subject End: 178
..........................................................cattgggctgaattaacacgccctttcagggctcttacagcagtcagccgtcagttccgcattcctccttggaa................................
..........................................................cattgggctgaattaatgcgcccctgcggagctgttacagcggtcagccgtcagttccgcattcctccttggaa................................
HSP  2	e-value: 9.0E-8	bit: 58.0	Len: 29	Query Start:2	Query End:30	Subject Strand: POSITIVE	Subject Start: 35	Subject End: 63
.attttatatcaggcttacagccctccgca......................................................................................................................................
.attttatatcaggcttacagccctccgca......................................................................................................................................

Subject: tfor_TF0365_TF0366|hypothetical protein:hypothetical protein|POSITIVE:POSITIVE|[383213,383703]|491
HSP  1	e-value: 2.0E-15	bit: 83.8	Len: 74	Query Start:59	Query End:132	Subject Strand: POSITIVE	Subject Start: 386	Subject End: 459
..........................................................cattgggctgaattaacacgccctttcagggctcttacagcagtcagccgtcagttccgcattcctccttggaa................................
..........................................................cattgggctgaattaacgcaccccttcggagctgttacagtggtcagccgtcagttccgcattcctccttggaa................................
HSP  2	e-value: 9.0E-8	bit: 58.0	Len: 29	Query Start:2	Query End:30	Subject Strand: POSITIVE	Subject Start: 316	Subject End: 344
.attttatatcaggcttacagccctccgca......................................................................................................................................
.attttatatcaggcttacagccctccgca......................................................................................................................................

Subject: tfor_TF0361_TF0362|hypothetical protein:hypothetical protein|POSITIVE:POSITIVE|[379871,380091]|221
HSP  1	e-value: 4.0E-13	bit: 75.8	Len: 74	Query Start:59	Query End:132	Subject Strand: POSITIVE	Subject Start: 116	Subject End: 189
..........................................................cattgggctgaattaacacgccctttcagggctcttacagcagtcagccgtcagttccgcattcctccttggaa................................
..........................................................cattgggctgaattaacgcatcccttcggagctgttacagtggtcagccgtcagttccgcattcctccttggaa................................
HSP  2	e-value: 9.0E-8	bit: 58.0	Len: 29	Query Start:2	Query End:30	Subject Strand: POSITIVE	Subject Start: 46	Subject End: 74
.attttatatcaggcttacagccctccgca......................................................................................................................................
.attttatatcaggcttacagccctccgca......................................................................................................................................

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UAUUUUAUAUCAGGCUUACAGCCCUCCGCAAGGAGAUUGCUUUUUCCCCAGCGCUUCGCAUUGGGCUGAAUUAACACGCCCUUUCAGGGCUCUUACAGCAGUCAGCCGUCAGUUCCGCAUUCCUCCUUGGAA
............((((.((....((((....))))..((((.......((((.(........).)))).........((((.....))))......)))))).))))............((((.....)))) (-37.20)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UUCCAAGGAGGAAUGCGGAACUGACGGCUGACUGCUGUAAGAGCCCUGAAAGGGCGUGUUAAUUCAGCCCAAUGCGAAGCGCUGGGGAAAAAGCAAUCUCCUUGCGGAGGGCUGUAAGCCUGAUAUAAAAUA
(((((((((((..(((....((.(((((.....))))).))..((((....((((.((......))))))...(((...))).)))).....))).)))))))).)))((((.....))))........... (-43.00)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
953	90	41	189	139	tfor:TF2824|5end_nucleoside-transporting_protein_nupG_3014701..3014931_POSITIVE
913	90	41	198	149	tfor:TF0828|5end_hypothetical_protein_887090..887320_POSITIVE
909	90	41	188	139	tfor:TF1183|5end_hypothetical_protein_1268391..1268621_POSITIVE
895	90	41	115	66	tfor:TF2191|5end_hypothetical_protein_2365934..2366164_POSITIVE
895	90	41	192	143	tfor:TF1186|5end_hypothetical_protein_1269568..1269798_POSITIVE
895	90	41	77	28	tfor:TF0822|5end_hypothetical_protein_880487..880717_POSITIVE
848	70	21	198	143	tfor:TF2478|5end_hypothetical_protein_2655375..2655605_POSITIVE
846	60	11	220	169	tfor:TF0823|5end_conserved_hypothetical_protein_880660..880890_POSITIVE
829	59	11	73	23	tfor:TF0679|5end_hypothetical_protein_721155..721385_POSITIVE
820	90	41	77	29	tfor:TF0821|5end_hypothetical_protein_879879..880109_POSITIVE
819	90	41	215	166	tfor:TF1184|5end_hypothetical_protein_1269004..1269234_POSITIVE
764	60	11	219	167	tfor:TF1187|5end_hypothetical_protein_1269625..1269855_POSITIVE
762	99	52	184	137	tfor:TF2517|5end_hypothetical_protein_2695089..2695319_POSITIVE
755	90	43	122	65	tfor:TF0538|5end_hypothetical_protein_566891..567121_POSITIVE
755	90	43	115	58	tfor:TF0539|5end_hypothetical_protein_566884..567114_POSITIVE
747	59	11	65	14	tfor:TF3107|5end_hypothetical_protein_3338459..3338689_POSITIVE
704	59	11	69	17	tfor:TF1716|5end_hypothetical_protein_1837442..1837672_POSITIVE
692	90	41	63	3	tfor:TF0678|5end_hypothetical_protein_721103..721333_POSITIVE
691	60	11	190	140	tfor:TF2036|5end_possible_pyruvate_formate-lyase_activating_enzyme_2196302..2196532_POSITIVE
596	99	52	131	79	tfor:TF0534|5end_hypothetical_protein_559509..559739_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
895	90	41	107	58	tfor:TF1185|3end_hypothetical_protein_1269563..1269713_POSITIVE
820	90	41	60	12	tfor:TF0820|3end_hypothetical_protein_879942..880092_POSITIVE
819	90	41	69	20	tfor:TF1182|3end_hypothetical_protein_1268938..1269088_POSITIVE
747	59	11	134	83	tfor:TF3106|3end_hypothetical_protein_3338608..3338758_POSITIVE
739	90	41	81	23	tfor:TF2840|3end_hypothetical_protein_3031289..3031439_POSITIVE
738	60	11	115	63	tfor:TF2547|3end_hypothetical_protein_2730947..2731097_POSITIVE
596	99	52	61	9	tfor:TF0533|3end_hypothetical_protein_559519..559669_POSITIVE
553	59	11	141	89	tfor:TF1405|3end_conserved_hypothetical_protein_1481819..1481969_POSITIVE
486	67	32	40	4	tfor:TF0370|3end_hypothetical_protein_386317..386467_POSITIVE
481	53	11	140	89	tfor:TF1274|3end_hypothetical_protein_1357895..1358045_POSITIVE
472	130	81	104	42	tfor:TF0685|3end_hypothetical_protein_731132..731282_POSITIVE
410	70	21	54	4	tfor:TF2172|3end_hypothetical_protein_2346135..2346285_POSITIVE
387	69	25	66	13	tfor:TF2748|3end_ATP-dependent_Clp_protease_2933151..2933301_POSITIVE
384	119	74	79	28	tfor:TF0825|3end_hypothetical_protein_883850..884000_POSITIVE
382	37	10	149	122	tfor:TF0678|3end_hypothetical_protein_721335..721485_POSITIVE
378	49	5	127	75	tfor:TF2816|3end_hypothetical_protein_3007184..3007334_POSITIVE
375	90	45	117	73	tfor:TF2640|3end_hypothetical_protein_2809533..2809683_POSITIVE
375	66	21	62	3	tfor:TF2340|3end_hypothetical_protein_2500915..2501065_POSITIVE
373	90	44	149	98	tfor:TF1590|3end_hypothetical_protein_1706043..1706193_POSITIVE
370	128	98	109	77	tfor:TF1660|3end_hypothetical_protein_1775600..1775750_POSITIVE