Origin IGS:
agatcgtaaaaagttctataaccgccaatagaatccgaataaaattttcataaacattgaatgctcctcctacgatcgattcactgcccctcctgattttctccgagaatggttgacacgaccttttcccaatggctcaaaatatttatttgttaaaatctgcaaaaatatcactaataaattattgtacaccaatagattatagcaataaaatgtccaataatgatacgtctgaaaaatacagaatgtccgatatgaataggtttttgtctgattatgatag
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
ctatcataatcagacaaaaacctattcatatcggacattctgtatttttcagacgtatcattattggacattttattgctataatctattggtgtacaataatttattagtgatatttttgcagattttaacaaataaatattttgagccattgggaaaaggtcgtgtcaaccattctcggagaaaatcaggaggggcagtgaatcgatcgtaggaggagcattcaatgtttatgaaaattttattcggattctattggcggttatagaactttttacgatct

Mask Tandem Repeat Region ================================================
agatcgtaaaaagttctataaccgccaatagaatccgaataaaattttcataaacattgaatgctcctcctacgatcgattcactgcccctcctgattttctccgagaatggttgacacgaccttttcccaatggctcaaaatatttatttgttaaaatctgcaaaaatatcactaataaattattgtacaccaatagattatagcaataaaatgtccaataatgatacgtctgaaaaatacagaatgtccgatatgaataggtttttgtctgattatgatag

Find is-nt database================================================
Query_seq: TF0530:TF0531|TF0530:TF0531:hypothetical protein with TPR domain:hypothetical protein:->->:556920..557202 283
agatcgtaaaaagttctataaccgccaatagaatccgaataaaattttcataaacattgaatgctcctcctacgatcgattcactgcccctcctgattttctccgagaatggttgacacgaccttttcccaatggctcaaaatatttatttgttaaaatctgcaaaaatatcactaataaattattgtacaccaatagattatagcaataaaatgtccaataatgatacgtctgaaaaatacagaatgtccgatatgaataggtttttgtctgattatgatag
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: TF0530:TF0531|TF0530:TF0531:hypothetical protein with TPR domain:hypothetical protein:->->:556920..557202 283
agatcgtaaaaagttctataaccgccaatagaatccgaataaaattttcataaacattgaatgctcctcctacgatcgattcactgcccctcctgattttctccgagaatggttgacacgaccttttcccaatggctcaaaatatttatttgttaaaatctgcaaaaatatcactaataaattattgtacaccaatagattatagcaataaaatgtccaataatgatacgtctgaaaaatacagaatgtccgatatgaataggtttttgtctgattatgatag
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: TF0530:TF0531|TF0530:TF0531:hypothetical protein with TPR domain:hypothetical protein:->->:556920..557202 283
agatcgtaaaaagttctataaccgccaatagaatccgaataaaattttcataaacattgaatgctcctcctacgatcgattcactgcccctcctgattttctccgagaatggttgacacgaccttttcccaatggctcaaaatatttatttgttaaaatctgcaaaaatatcactaataaattattgtacaccaatagattatagcaataaaatgtccaataatgatacgtctgaaaaatacagaatgtccgatatgaataggtttttgtctgattatgatag
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

agatcgtaaaaagttctataaccgccaatagaatccgaataaaattttcataaacattgaatgctcctcctacgatcgattcactgcccctcctgattttctccgagaatggttgacacgaccttttcccaatggctcaaaatatttatttgttaaaatctgcaaaaatatcactaataaattattgtacaccaatagattatagcaataaaatgtccaataatgatacgtctgaaaaatacagaatgtccgatatgaataggtttttgtctgattatgatag
Predict ORF larger than 30AA ================================================
Protein_Len: 53	Strand: +	Start: 44	End: 202
........................................... M  F  I  N  I  E  C  S  S  Y  D  R  F  T  A  P  P  D  F  L  R  E  W  L  T  R  P  F  P  N  G  S  K  Y  L  F  V  K  I  C  K  N  I  T  N  K  L  L  Y  T  N  R  L .................................................................................
Protein_Len: 50	Strand: +	Start: 132	End: 281
................................................................................................................................... M  A  Q  N  I  Y  L  L  K  S  A  K  I  S  L  I  N  Y  C  T  P  I  D  Y  S  N  K  M  S  N  N  D  T  S  E  K  Y  R  M  S  D  M  N  R  F  L  S  D  Y  D ..
Protein_Len: 35	Strand: -	Start: 177	End: 281
................................................................................................................................................................................ Y  I  I  T  C  W  Y  I  I  A  I  F  H  G  I  I  I  R  R  F  F  V  S  H  G  I  H  I  P  K  Q  R  I  I  M ..
Protein_Len: 56	Strand: -	Start: 73	End: 240
........................................................................ S  R  N  V  A  G  G  S  K  R  R  S  H  N  V  R  G  K  G  L  P  E  F  Y  K  N  T  L  I  Q  L  F  I  V  L  L  N  N  Y  V  L  L  N  Y  C  Y  F  T  W  Y  H  Y  T  Q  F  M ...........................................
Protein_Len: 44	Strand: -	Start: 2	End: 133
. I  T  F  L  E  I  V  A  L  L  I  R  I  F  N  E  Y  V  N  F  A  G  G  V  I  S  E  S  G  R  R  I  K  E  S  F  P  Q  C  S  R  K  G  M ......................................................................................................................................................

agatcgtaaaaagttctataaccgccaatagaatccgaataaaattttcataaacattgaatgctcctcctacgatcgattcactgcccctcctgattttctccgagaatggttgacacgaccttttcccaatggctcaaaatatttatttgttaaaatctgcaaaaatatcactaataaattattgtacaccaatagattatagcaataaaatgtccaataatgatacgtctgaaaaatacagaatgtccgatatgaataggtttttgtctgattatgatag
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

agatcgtaaaaagttctataaccgccaatagaatccgaataaaattttcataaacattgaatgctcctcctacgatcgattcactgcccctcctgattttctccgagaatggttgacacgaccttttcccaatggctcaaaatatttatttgttaaaatctgcaaaaatatcactaataaattattgtacaccaatagattatagcaataaaatgtccaataatgatacgtctgaaaaatacagaatgtccgatatgaataggtttttgtctgattatgatag
Predict TransTerm conf > 70================================================

Find igs database================================================
Query_seq: TF0530:TF0531|TF0530:TF0531:hypothetical protein with TPR domain:hypothetical protein:->->:556920..557202 283
agatcgtaaaaagttctataaccgccaatagaatccgaataaaattttcataaacattgaatgctcctcctacgatcgattcactgcccctcctgattttctccgagaatggttgacacgaccttttcccaatggctcaaaatatttatttgttaaaatctgcaaaaatatcactaataaattattgtacaccaatagattatagcaataaaatgtccaataatgatacgtctgaaaaatacagaatgtccgatatgaataggtttttgtctgattatgatag
Intra-Species Hit: Count: 1	Min: 1	Max: 283	Len: 283
Subject: tfor_TF0530_TF0531|hypothetical protein with TPR domain:hypothetical protein|POSITIVE:POSITIVE|[556920,557202]|283
HSP  1	e-value: 1.0E-159	bit: 561.0	Len: 283	Query Start:1	Query End:283	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 283
agatcgtaaaaagttctataaccgccaatagaatccgaataaaattttcataaacattgaatgctcctcctacgatcgattcactgcccctcctgattttctccgagaatggttgacacgaccttttcccaatggctcaaaatatttatttgttaaaatctgcaaaaatatcactaataaattattgtacaccaatagattatagcaataaaatgtccaataatgatacgtctgaaaaatacagaatgtccgatatgaataggtttttgtctgattatgatag
agatcgtaaaaagttctataaccgccaatagaatccgaataaaattttcataaacattgaatgctcctcctacgatcgattcactgcccctcctgattttctccgagaatggttgacacgaccttttcccaatggctcaaaatatttatttgttaaaatctgcaaaaatatcactaataaattattgtacaccaatagattatagcaataaaatgtccaataatgatacgtctgaaaaatacagaatgtccgatatgaataggtttttgtctgattatgatag

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
AGAUCGUAAAAAGUUCUAUAACCGCCAAUAGAAUCCGAAUAAAAUUUUCAUAAACAUUGAAUGCUCCUCCUACGAUCGAUUCACUGCCCCUCCUGAUUUUCUCCGAGAAUGGUUGACACGACCUUUUCCCAAUGGCUCAAAAUAUUUAUUUGUUAAAAUCUGCAAAAAUAUCACUAAUAAAUUAUUGUACACCAAUAGAUUAUAGCAAUAAAAUGUCCAAUAAUGAUACGUCUGAAAAAUACAGAAUGUCCGAUAUGAAUAGGUUUUUGUCUGAUUAUGAUAG
.(((((((....(((((((........)))))))............((((.......)))).........)))))))...(((..(((.(((..((.....)).)))...))).((((.(((((.(((....(((......((((((..((((((.((((((.........((.(((....))).))........)))))).))))))..))))))))).....((((..((((.......)))).))))......))).)))))..))))......)))... (-43.23)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
CUAUCAUAAUCAGACAAAAACCUAUUCAUAUCGGACAUUCUGUAUUUUUCAGACGUAUCAUUAUUGGACAUUUUAUUGCUAUAAUCUAUUGGUGUACAAUAAUUUAUUAGUGAUAUUUUUGCAGAUUUUAACAAAUAAAUAUUUUGAGCCAUUGGGAAAAGGUCGUGUCAACCAUUCUCGGAGAAAAUCAGGAGGGGCAGUGAAUCGAUCGUAGGAGGAGCAUUCAAUGUUUAUGAAAAUUUUAUUCGGAUUCUAUUGGCGGUUAUAGAACUUUUUACGAUCU
...((((.....((((...((((.(((.((..((.(..((((.......((((.(((((((((.((((....((((((.((((.((....)))))))))))))))).))))))))).))))))))......((((.......)))).)))..)).))).))))..)))).....(((((.((.....))..)))))...))))...((((((((((((...((((((((...((....))..)))).))))(((((........))))).)))))))))))). (-56.61)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
369	107	68	200	156	tfor:TF1703|5end_conserved_hypothetical_protein_1822065..1822295_POSITIVE
363	104	61	142	102	tfor:TF0662|5end_hypothetical_protein_708316..708546_POSITIVE
355	108	64	91	39	tfor:TF0239|5end_conserved_hypothetical_protein_268894..269124_POSITIVE
334	120	71	137	77	tfor:TF1598|5end_conserved_hypothetical_protein_1713358..1713588_POSITIVE
328	129	84	163	126	tfor:TF1768|5end_conserved_hypothetical_protein;_possible_transposase_1906526..1906756_POSITIVE
326	130	89	52	1	tfor:TF1829|5end_2-isopropylmalate_synthase_1977365..1977595_POSITIVE
325	116	73	223	172	tfor:TF2561|5end_50S_ribosomal_protein_L16_2738693..2738923_POSITIVE
321	107	62	144	94	tfor:TF1182|5end_hypothetical_protein_1268565..1268795_POSITIVE
316	103	62	61	23	tfor:TF0330|5end_excinuclease_ABC,_subunit_A_356196..356426_POSITIVE
311	108	62	80	29	tfor:TF2817|5end_hypothetical_protein_3007358..3007588_POSITIVE
307	117	73	133	70	tfor:TF2043|5end_fructokinase_2202267..2202497_POSITIVE
307	127	81	83	39	tfor:TF1148|5end_para-aminobenzoate_synthase_component_I_1228219..1228449_POSITIVE
307	122	85	89	49	tfor:TF0024|5end_conserved_hypothetical_protein;_possible_ATPase_20191..20421_POSITIVE
306	109	61	223	163	tfor:TF1511|5end_outer_membrane_protein,_TonB_dependent_receptor_1621069..1621299_POSITIVE
305	129	83	205	163	tfor:TF2802|5end_possible_outer_membrane_protein_2989842..2990072_POSITIVE
303	134	91	229	180	tfor:TF1484|5end_penicillin_binding_protein_1579559..1579789_POSITIVE
302	95	55	84	43	tfor:TF1718|5end_conserved_hypothetical_protein_1840462..1840692_POSITIVE
302	96	59	210	168	tfor:TF1416|5end_outer_membrane_protein_1497576..1497806_POSITIVE
300	106	67	100	62	tfor:TF3160|5end_conserved_hypothetical_protein_3395531..3395761_POSITIVE
299	130	86	228	185	tfor:TF2682|5end_N_utilization_substance_protein_A_2856308..2856538_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
369	107	68	130	86	tfor:TF1702|3end_conserved_hypothetical_protein_1822075..1822225_POSITIVE
355	108	64	74	22	tfor:TF0238|3end_outer_membrane_protein_268957..269107_POSITIVE
334	120	71	117	57	tfor:TF1597|3end_TatD_family_protein_1713418..1713568_POSITIVE
332	126	82	106	54	tfor:TF0541|3end_conserved_hypothetical_protein_571858..572008_POSITIVE
330	106	61	99	54	tfor:TF0178|3end_ferritin_188223..188373_POSITIVE
321	107	62	144	94	tfor:TF1186|3end_hypothetical_protein_1269815..1269965_POSITIVE
312	118	71	72	6	tfor:TF3109|3end_hypothetical_protein_3342803..3342953_POSITIVE
307	117	73	142	79	tfor:TF2042|3end_sugar_phosphate_isomerase,_polysialic_acid_capsule_expression_protein_2202356..2202506_POSITIVE
307	122	85	51	11	tfor:TF0023|3end_possible_response_element_in_two_component_regulation_20233..20383_POSITIVE
300	106	67	100	62	tfor:TF3159|3end_conserved_hypothetical_protein;_possible_transcriptional_regulator_3395611..3395761_POSITIVE
295	110	61	70	14	tfor:TF2770|3end_conserved_hypothetical_protein_2956639..2956789_POSITIVE
292	89	62	151	123	tfor:TF2795|3end_hypothetical_protein_2980909..2981059_POSITIVE
291	115	73	38	2	tfor:TF1139|3end_adenylosuccinate_lyase_1216667..1216817_POSITIVE
291	130	85	78	28	tfor:TF0409|3end_conserved_hypothetical_protein_427672..427822_POSITIVE
290	109	63	55	15	tfor:TF1915|3end_NAD-dependent_protein_deacetylase,_SIR2_family_2068489..2068639_POSITIVE
288	105	63	140	99	tfor:TF1405|3end_conserved_hypothetical_protein_1481819..1481969_POSITIVE
288	129	81	134	61	tfor:TF0629|3end_hypothetical_protein_666710..666860_POSITIVE
286	115	73	67	6	tfor:TF2702|3end_hypothetical_protein_2876136..2876286_POSITIVE
285	252	223	67	38	tfor:TF3024|3end_periplasmic_protease_3248714..3248864_POSITIVE
283	138	97	84	41	tfor:TF0599|3end_hypothetical_protein_630130..630280_POSITIVE