Origin IGS:
tagcagcctgtttcgtcccgaaacacagttcaaatataccggtatgaatctttccggccatggccggaaggattcttgcattgagctgtgctttcccgttgcgacggaagataggaaaacattacgctacgatttttcaggagatcatgacaggggtatctcttcttttta
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
taaaaagaagagatacccctgtcatgatctcctgaaaaatcgtagcgtaatgttttcctatcttccgtcgcaacgggaaagcacagctcaatgcaagaatccttccggccatggccggaaagattcataccggtatatttgaactgtgtttcgggacgaaacaggctgcta

Mask Tandem Repeat Region ================================================
tagcagcctgtttcgtcccgaaacacagttcaaatataccggtatgaatctttccggccatggccggaaggattcttgcattgagctgtgctttcccgttgcgacggaagataggaaaacattacgctacgatttttcaggagatcatgacaggggtatctcttcttttta

Find is-nt database================================================
Query_seq: TF0308:TF0309|TF0308:TF0309:hypothetical protein:conserved hypothetical protein:->->:334143..334313 171
tagcagcctgtttcgtcccgaaacacagttcaaatataccggtatgaatctttccggccatggccggaaggattcttgcattgagctgtgctttcccgttgcgacggaagataggaaaacattacgctacgatttttcaggagatcatgacaggggtatctcttcttttta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: TF0308:TF0309|TF0308:TF0309:hypothetical protein:conserved hypothetical protein:->->:334143..334313 171
tagcagcctgtttcgtcccgaaacacagttcaaatataccggtatgaatctttccggccatggccggaaggattcttgcattgagctgtgctttcccgttgcgacggaagataggaaaacattacgctacgatttttcaggagatcatgacaggggtatctcttcttttta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: TF0308:TF0309|TF0308:TF0309:hypothetical protein:conserved hypothetical protein:->->:334143..334313 171
tagcagcctgtttcgtcccgaaacacagttcaaatataccggtatgaatctttccggccatggccggaaggattcttgcattgagctgtgctttcccgttgcgacggaagataggaaaacattacgctacgatttttcaggagatcatgacaggggtatctcttcttttta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

tagcagcctgtttcgtcccgaaacacagttcaaatataccggtatgaatctttccggccatggccggaaggattcttgcattgagctgtgctttcccgttgcgacggaagataggaaaacattacgctacgatttttcaggagatcatgacaggggtatctcttcttttta
Predict ORF larger than 30AA ================================================
Protein_Len: 54	Strand: +	Start: 8	End: 169
....... M  F  R  P  E  T  Q  F  K  Y  T  G  M  N  L  S  G  H  G  R  K  D  S  C  I  E  L  C  F  P  V  A  T  E  D  R  K  T  L  R  Y  D  F  S  G  D  H  D  R  G  I  S  S  F ..
Protein_Len: 41	Strand: +	Start: 48	End: 170
............................................... M  F  P  A  M  A  G  R  I  L  A  L  S  C  A  F  P  L  R  R  K  I  G  K  H  Y  A  T  I  F  Q  E  I  M  T  G  V  S  L  L  F .
Protein_Len: 36	Strand: -	Start: 33	End: 140
................................ I  Y  R  Y  S  D  K  R  G  H  G  S  P  N  K  C  Q  A  T  S  E  R  Q  S  P  L  Y  S  F  M  V  S  R  N  K  M ...............................
Protein_Len: 37	Strand: -	Start: 2	End: 112
. A  A  Q  K  T  G  F  C  L  E  F  I  G  T  H  I  K  G  A  M  A  P  L  I  R  A  N  L  Q  A  K  G  N  R  R  F  M ...........................................................

tagcagcctgtttcgtcccgaaacacagttcaaatataccggtatgaatctttccggccatggccggaaggattcttgcattgagctgtgctttcccgttgcgacggaagataggaaaacattacgctacgatttttcaggagatcatgacaggggtatctcttcttttta
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

tagcagcctgtttcgtcccgaaacacagttcaaatataccggtatgaatctttccggccatggccggaaggattcttgcattgagctgtgctttcccgttgcgacggaagataggaaaacattacgctacgatttttcaggagatcatgacaggggtatctcttcttttta
Predict TransTerm conf > 70================================================
TransTerm Strand: +	Conf: 100	HP_score: -17.3	Tail_Score: -3.1875	Start: 46	End: 75	Full_Region: CAAATATACCGGTAT GAATCTTTCCGGC CATG GCCGGAAGGATTC TTGCATTGAGCTGTG
.............................................GAATCTTTCCGGCCATGGCCGGAAGGATTC................................................................................................
TransTerm Strand: +	Conf: 93	HP_score: -13.2	Tail_Score: -3.73336	Start: 49	End: 72	Full_Region: ATATACCGGTATGAA TCTTTCCGGC CATG GCCGGAAGGA TTCTTGCATTGAGCT
................................................TCTTTCCGGCCATGGCCGGAAGGA...................................................................................................

Find igs database================================================
Query_seq: TF0308:TF0309|TF0308:TF0309:hypothetical protein:conserved hypothetical protein:->->:334143..334313 171
tagcagcctgtttcgtcccgaaacacagttcaaatataccggtatgaatctttccggccatggccggaaggattcttgcattgagctgtgctttcccgttgcgacggaagataggaaaacattacgctacgatttttcaggagatcatgacaggggtatctcttcttttta
Intra-Species Hit: Count: 1	Min: 1	Max: 171	Len: 171
Subject: tfor_TF0308_TF0309|hypothetical protein:conserved hypothetical protein|POSITIVE:POSITIVE|[334143,334313]|171
HSP  1	e-value: 2.0E-92	bit: 339.0	Len: 171	Query Start:1	Query End:171	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 171
tagcagcctgtttcgtcccgaaacacagttcaaatataccggtatgaatctttccggccatggccggaaggattcttgcattgagctgtgctttcccgttgcgacggaagataggaaaacattacgctacgatttttcaggagatcatgacaggggtatctcttcttttta
tagcagcctgtttcgtcccgaaacacagttcaaatataccggtatgaatctttccggccatggccggaaggattcttgcattgagctgtgctttcccgttgcgacggaagataggaaaacattacgctacgatttttcaggagatcatgacaggggtatctcttcttttta

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UAGCAGCCUGUUUCGUCCCGAAACACAGUUCAAAUAUACCGGUAUGAAUCUUUCCGGCCAUGGCCGGAAGGAUUCUUGCAUUGAGCUGUGCUUUCCCGUUGCGACGGAAGAUAGGAAAACAUUACGCUACGAUUUUUCAGGAGAUCAUGACAGGGGUAUCUCUUCUUUUUA
..((..((((((..(((((((((((((((((((........(((.(((((((((((((....))))))))))))).))).)))))))))).)))).(((.(((.(....)...(.....)....))).)))........)).)))...)))))).)).............. (-59.50)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UAAAAAGAAGAGAUACCCCUGUCAUGAUCUCCUGAAAAAUCGUAGCGUAAUGUUUUCCUAUCUUCCGUCGCAACGGGAAAGCACAGCUCAAUGCAAGAAUCCUUCCGGCCAUGGCCGGAAAGAUUCAUACCGGUAUAUUUGAACUGUGUUUCGGGACGAAACAGGCUGCUA
.........(((((............)))))..........(((((....(((((((((...((((((....))))))((((((((.(((((((..(((((.(((((((....))))))).)))))......))))...))).)))))))).))))..))))).))))).. (-52.70)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
423	107	61	72	6	tfor:TF1465|5end_modulator_of_DNA_gyrase_1554148..1554378_POSITIVE
418	80	35	190	138	tfor:TF1066|5end_hypothetical_protein_1136545..1136775_POSITIVE
416	96	52	60	4	tfor:TF3136|5end_Na+-translocating_NADH-quinone_reductase,_subunit_F_3369994..3370224_POSITIVE
404	108	64	47	1	tfor:TF2499|5end_possible_thioesterase_family_protein_2673903..2674133_POSITIVE
397	110	63	184	137	tfor:TF0992|5end_hypothetical_protein_1048251..1048481_POSITIVE
391	103	63	170	113	tfor:TF2877|5end_regulatory_protein_3065601..3065831_POSITIVE
389	106	61	182	124	tfor:TF1853|5end_homoserine_O-succinyltransferase_2006470..2006700_POSITIVE
387	107	62	229	175	tfor:TF0032|5end_sugar_phosphate_permease,_major_facilitator_superfamily_27911..28141_POSITIVE
385	106	61	105	59	tfor:TF2517|5end_hypothetical_protein_2695089..2695319_POSITIVE
384	100	54	51	9	tfor:TF1835|5end_possible_dihydroxy-acid_dehydratase_1984201..1984431_POSITIVE
381	99	54	55	3	tfor:TF0093|5end_outer_membrane_protein,_TonB_dependent_receptor_100497..100727_POSITIVE
378	98	54	207	143	tfor:TF1475|5end_glucose-6-phosphate_1-dehydrogenase_1568034..1568264_POSITIVE
374	100	54	74	16	tfor:TF1664|5end_conserved_hypothetical_protein_1778761..1778991_POSITIVE
362	79	40	160	116	tfor:TF2788|5end_hypothetical_protein_2972201..2972431_POSITIVE
361	100	55	56	1	tfor:TF1775|5end_oxidoreductase,_Gfo/Idh/MocA_family_1913135..1913365_POSITIVE
357	99	51	52	4	tfor:TF2184|5end_conserved_hypothetical_protein_2355578..2355808_POSITIVE
353	78	36	227	179	tfor:TF0425|5end_outer_membrane_protein_443069..443299_POSITIVE
352	79	39	176	139	tfor:TF2259|5end_transfer_region-related_protein,_TraK_2429577..2429807_POSITIVE
352	66	24	52	7	tfor:TF0119|5end_gluconate_aldolase_130577..130807_POSITIVE
351	97	52	52	7	tfor:TF2412|5end_outer_membrane_protein_2587017..2587247_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
664	90	42	67	12	tfor:TF0308|3end_hypothetical_protein_334082..334232_POSITIVE
416	96	52	60	4	tfor:TF3135|3end_hypothetical_protein_3370074..3370224_POSITIVE
388	89	41	75	29	tfor:TF1834|3end_3-isopropylmalate_dehydrogenase_1984311..1984461_POSITIVE
375	95	55	132	92	tfor:TF2876|3end_cytosine_deaminase_3065664..3065814_POSITIVE
363	110	61	151	92	tfor:TF0425|3end_outer_membrane_protein_444705..444855_POSITIVE
362	79	40	137	93	tfor:TF2787|3end_30S_ribosomal_protein_S1_2972258..2972408_POSITIVE
357	79	38	146	96	tfor:TF2515|3end_outer_membrane_protein,_TonB_dependent_receptor_2694865..2695015_POSITIVE
352	79	39	141	104	tfor:TF2257|3end_transfer_region-related_protein,_TraJ_2429622..2429772_POSITIVE
345	88	49	105	67	tfor:TF0351|3end_hypothetical_protein_371226..371376_POSITIVE
342	68	29	145	106	tfor:TF2571|3end_30S_ribosomal_protein_S5_2743140..2743290_POSITIVE
338	98	55	59	7	tfor:TF2113|3end_phosphoribosylaminoimidazole_carboxylase_2283086..2283236_POSITIVE
338	106	61	115	70	tfor:TF1846|3end_hypothetical_protein_1997015..1997165_POSITIVE
338	106	61	105	60	tfor:TF1845|3end_hypothetical_protein_1997005..1997155_POSITIVE
338	79	38	44	6	tfor:TF0336|3end_Xaa-Pro_aminopeptidase_361868..362018_POSITIVE
336	90	51	82	38	tfor:TF1479|3end_ABC_transporter,_permease_component_1573592..1573742_POSITIVE
333	107	64	121	75	tfor:TF1066|3end_hypothetical_protein_1136858..1137008_POSITIVE
331	99	52	59	5	tfor:TF2127|3end_hypothetical_protein_2304306..2304456_POSITIVE
331	106	65	115	73	tfor:TF1184|3end_hypothetical_protein_1269311..1269461_POSITIVE
330	99	55	69	15	tfor:TF2846|3end_cobyric_acid_synthase_3036469..3036619_POSITIVE
329	88	41	82	34	tfor:TF1588|3end_hypothetical_protein_1702560..1702710_POSITIVE