Origin IGS:
tgacaatgctctatctgacgattgttttgttttatgattcatatcgtcgtcttatcctctcaaaaaaagaaatcccggaaatgcactgcacgtccgagactttttcagaagaaagtaattgctctaatcgatgcaagccctctcttttcctta
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
taaggaaaagagagggcttgcatcgattagagcaattactttcttctgaaaaagtctcggacgtgcagtgcatttccgggatttctttttttgagaggataagacgacgatatgaatcataaaacaaaacaatcgtcagatagagcattgtca

Mask Tandem Repeat Region ================================================
tgacaatgctctatctgacgattgttttgttttatgattcatatcgtcgtcttatcctctcaaaaaaagaaatcccggaaatgcactgcacgtccgagactttttcagaagaaagtaattgctctaatcgatgcaagccctctcttttcctta

Find is-nt database================================================
Query_seq: TF1448:TF1449|TF1448:TF1449:possible competence protein:RNA polymerase sigma factor, RpoD:->->:1533111..1533263 153
tgacaatgctctatctgacgattgttttgttttatgattcatatcgtcgtcttatcctctcaaaaaaagaaatcccggaaatgcactgcacgtccgagactttttcagaagaaagtaattgctctaatcgatgcaagccctctcttttcctta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: TF1448:TF1449|TF1448:TF1449:possible competence protein:RNA polymerase sigma factor, RpoD:->->:1533111..1533263 153
tgacaatgctctatctgacgattgttttgttttatgattcatatcgtcgtcttatcctctcaaaaaaagaaatcccggaaatgcactgcacgtccgagactttttcagaagaaagtaattgctctaatcgatgcaagccctctcttttcctta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: TF1448:TF1449|TF1448:TF1449:possible competence protein:RNA polymerase sigma factor, RpoD:->->:1533111..1533263 153
tgacaatgctctatctgacgattgttttgttttatgattcatatcgtcgtcttatcctctcaaaaaaagaaatcccggaaatgcactgcacgtccgagactttttcagaagaaagtaattgctctaatcgatgcaagccctctcttttcctta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

tgacaatgctctatctgacgattgttttgttttatgattcatatcgtcgtcttatcctctcaaaaaaagaaatcccggaaatgcactgcacgtccgagactttttcagaagaaagtaattgctctaatcgatgcaagccctctcttttcctta
Predict ORF larger than 30AA ================================================
Protein_Len: 49	Strand: +	Start: 6	End: 152
..... M  L  Y  L  T  I  V  L  F  Y  D  S  Y  R  R  L  I  L  S  K  K  E  I  P  E  M  H  C  T  S  E  T  F  S  E  E  S  N  C  S  N  R  C  K  P  S  L  F  L .
Protein_Len: 44	Strand: +	Start: 22	End: 153
..................... M  F  C  F  M  I  H  I  V  V  L  S  S  Q  K  K  K  S  R  K  C  T  A  R  P  R  L  F  Q  K  K  V  I  A  L  I  D  A  S  P  L  F  S  L 
Protein_Len: 34	Strand: -	Start: 35	End: 136
.................................. S  E  Y  R  R  R  I  R  E  F  F  S  I  G  S  I  C  Q  V  D  S  V  K  E  S  S  L  L  Q  E  L  R  H  M .................

tgacaatgctctatctgacgattgttttgttttatgattcatatcgtcgtcttatcctctcaaaaaaagaaatcccggaaatgcactgcacgtccgagactttttcagaagaaagtaattgctctaatcgatgcaagccctctcttttcctta
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

tgacaatgctctatctgacgattgttttgttttatgattcatatcgtcgtcttatcctctcaaaaaaagaaatcccggaaatgcactgcacgtccgagactttttcagaagaaagtaattgctctaatcgatgcaagccctctcttttcctta
Predict TransTerm conf > 70================================================
TransTerm Strand: -	Conf: 91	HP_score: -6.4	Tail_Score: -5.40474	Start: 69	End: 103	Full_Region: ttactttcttctgaa aaagtctcggacgtgc agt gcatttccgggatttc tttttttgagaggat
....................................................................aaagtctcggacgtgcagtgcatttccgggatttc..................................................
TransTerm Strand: -	Conf: 100	HP_score: -9.4	Tail_Score: -5.20328	Start: 73	End: 99	Full_Region: tttcttctgaaaaag tctcggacgtgc agt gcatttccggga tttctttttttgaga
........................................................................tctcggacgtgcagtgcatttccggga......................................................

Find igs database================================================
Query_seq: TF1448:TF1449|TF1448:TF1449:possible competence protein:RNA polymerase sigma factor, RpoD:->->:1533111..1533263 153
tgacaatgctctatctgacgattgttttgttttatgattcatatcgtcgtcttatcctctcaaaaaaagaaatcccggaaatgcactgcacgtccgagactttttcagaagaaagtaattgctctaatcgatgcaagccctctcttttcctta
Intra-Species Hit: Count: 1	Min: 1	Max: 153	Len: 153
Subject: tfor_TF1448_TF1449|possible competence protein:RNA polymerase sigma factor, RpoD|POSITIVE:POSITIVE|[1533111,1533263]|153
HSP  1	e-value: 3.0E-69	bit: 262.0	Len: 153	Query Start:1	Query End:153	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 153
tgacaatgctctatctgacgattgttttgttttatgattcatatcgtcgtcttatcctctcnnnnnnngaaatcccggaaatgcactgcacgtccgagactttttcagaagaaagtaattgctctaatcgatgcaagccctctcttttcctta
tgacaatgctctatctgacgattgttttgttttatgattcatatcgtcgtcttatcctctcaaaaaaagaaatcccggaaatgcactgcacgtccgagactttttcagaagaaagtaattgctctaatcgatgcaagccctctcttttcctta

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UGACAAUGCUCUAUCUGACGAUUGUUUUGUUUUAUGAUUCAUAUCGUCGUCUUAUCCUCUCAAAAAAAGAAAUCCCGGAAAUGCACUGCACGUCCGAGACUUUUUCAGAAGAAAGUAAUUGCUCUAAUCGAUGCAAGCCCUCUCUUUUCCUUA
................((((((((..(..(...)..)..)).))))))..................(((((.((.((((..(((...)))..)))).)).))))).((((((.((...((((((.....)).))))...)).))))))..... (-27.10)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UAAGGAAAAGAGAGGGCUUGCAUCGAUUAGAGCAAUUACUUUCUUCUGAAAAAGUCUCGGACGUGCAGUGCAUUUCCGGGAUUUCUUUUUUUGAGAGGAUAAGACGACGAUAUGAAUCAUAAAACAAAACAAUCGUCAGAUAGAGCAUUGUCA
.........((.((.((((..(((..............(((((((((.(((((((((((((.((((...)))).)))))))).....))))).)))))).)))..((((((.((...............)))))))).))).)))).)).)). (-40.66)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
351	140	91	80	34	tfor:TF1975|5end_uridylate_kinase_2121536..2121766_POSITIVE
305	111	73	167	118	tfor:TF1745|5end_hypothetical_protein_1879154..1879384_POSITIVE
301	90	44	141	98	tfor:TF0435|5end_DNA_mismatch_repair_protein_457182..457412_POSITIVE
300	144	106	118	77	tfor:TF2966|5end_hypothetical_protein_3176948..3177178_POSITIVE
296	139	91	117	56	tfor:TF1624|5end_carboxyl-terminal_protease_1737252..1737482_POSITIVE
292	89	42	93	37	tfor:TF2766|5end_shikimate_kinase_2951619..2951849_POSITIVE
292	96	71	72	41	tfor:TF0001|5end_hypothetical_protein_-116..114_POSITIVE
287	100	65	98	67	tfor:TF2018|5end_hypothetical_protein_2175077..2175307_POSITIVE
282	64	23	180	129	tfor:TF1296|5end_possible_DNA-binding_protein,_histone-like_family_1378432..1378662_POSITIVE
281	96	60	197	153	tfor:TF1555|5end_hypothetical_protein_1661061..1661291_POSITIVE
277	150	129	227	209	tfor:TF3149|5end_conserved_hypothetical_protein_3384424..3384654_POSITIVE
275	113	76	204	162	tfor:TF0606|5end_signal_peptidase_II_636816..637046_POSITIVE
273	130	81	174	104	tfor:TF0941|5end_transposase_fragment_981973..982203_POSITIVE
273	140	93	51	6	tfor:TF0114|5end_conserved_hypothetical_protein_123852..124082_POSITIVE
272	106	74	68	30	tfor:TF1912|5end_transcriptional_regulator,_TetR_family_2065970..2066200_POSITIVE
272	96	57	224	191	tfor:TF0809|5end_cation_efflux_protein_865358..865588_POSITIVE
269	140	91	175	123	tfor:TF1730|5end_diaminopimelate_decarboxylase_1854670..1854900_POSITIVE
269	140	91	124	72	tfor:TF1732|5end_conserved_hypothetical_protein_1854619..1854849_POSITIVE
269	50	1	107	49	tfor:TF1585|5end_hypothetical_protein_1690369..1690599_POSITIVE
269	50	1	107	49	tfor:TF1584|5end_hypothetical_protein_1690245..1690475_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
305	111	73	151	102	tfor:TF1744|3end_phenylacetate-CoA_ligase_1879218..1879368_POSITIVE
300	144	106	52	11	tfor:TF2965|3end_conserved_hypothetical_protein_3176962..3177112_POSITIVE
296	139	91	117	56	tfor:TF1623|3end_5-formyltetrahydrofolate_cyclo-ligase_1737332..1737482_POSITIVE
287	100	65	42	11	tfor:TF2017|3end_conserved_hypothetical_protein_2175101..2175251_POSITIVE
281	96	60	69	25	tfor:TF1554|3end_UDP-glucose_dehydrogenase_1661013..1661163_POSITIVE
275	85	44	131	88	tfor:TF0268|3end_hypothetical_protein_297032..297182_POSITIVE
269	140	91	143	91	tfor:TF1729|3end_aspartokinase_1854718..1854868_POSITIVE
269	50	1	129	71	tfor:TF1583|3end_conserved_hypothetical_protein;_possible_endonuclease_1690223..1690373_POSITIVE
263	149	121	23	2	tfor:TF0020|3end_possible_glycoprotein_endopeptidase_16029..16179_POSITIVE
257	96	56	100	53	tfor:TF1940|3end_TPR-repeat-containing_protein_2088814..2088964_POSITIVE
257	80	42	118	66	tfor:TF0673|3end_conserved_hypothetical_protein_717355..717505_POSITIVE
255	60	19	136	96	tfor:TF2770|3end_conserved_hypothetical_protein_2956639..2956789_POSITIVE
254	98	55	120	74	tfor:TF0061|3end_hypothetical_protein_65006..65156_POSITIVE
248	106	74	57	23	tfor:TF3010|3end_possible_anti-sigma_factor_3230888..3231038_POSITIVE
247	88	41	121	69	tfor:TF2617|3end_conserved_hypothetical_protein_2795172..2795322_POSITIVE
247	90	44	112	64	tfor:TF2549|3end_30S_ribosomal_protein_S7_2732345..2732495_POSITIVE
245	57	15	93	49	tfor:TF2896|3end_conserved_hypothetical_protein;_possible_ATPase,_AAA_superfamily_3085687..3085837_POSITIVE
243	114	76	85	43	tfor:TF1619|3end_riboflavin_synthase,_beta_subunit_1734528..1734678_POSITIVE
243	89	43	148	103	tfor:TF1397|3end_glucosyltransferase_1471534..1471684_POSITIVE
243	118	74	54	3	tfor:TF0433|3end_60_kDa_inner_membrane_protein_455386..455536_POSITIVE