Origin IGS:
acgttacggataaaccgccggcaaagatacgatttttgtactgctttctcgggtttcggcaggcgaacgcgctctttgcacaagaaaaagaaaagccgcaagcaaaatcgttcttgatccgttttgcctgcggcccttatagaccatgaatcgattttgttggttta
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
taaaccaacaaaatcgattcatggtctataagggccgcaggcaaaacggatcaagaacgattttgcttgcggcttttctttttcttgtgcaaagagcgcgttcgcctgccgaaacccgagaaagcagtacaaaaatcgtatctttgccggcggtttatccgtaacgt

Mask Tandem Repeat Region ================================================
acgttacggataaaccgccggcaaagatacgatttttgtactgctttctcgggtttcggcaggcgaacgcgctctttgcacaagaaaaagaaaagccgcaagcaaaatcgttcttgatccgttttgcctgcggcccttatagaccatgaatcgattttgttggttta

Find is-nt database================================================
Query_seq: TF0525:TF0527|TF0525:TF0527:conserved hypothetical protein:prolyl endopeptidase:->->:549645..549811 167
acgttacggataaaccgccggcaaagatacgatttttgtactgctttctcgggtttcggcaggcgaacgcgctctttgcacaagaaaaagaaaagccgcaagcaaaatcgttcttgatccgttttgcctgcggcccttatagaccatgaatcgattttgttggttta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: TF0525:TF0527|TF0525:TF0527:conserved hypothetical protein:prolyl endopeptidase:->->:549645..549811 167
acgttacggataaaccgccggcaaagatacgatttttgtactgctttctcgggtttcggcaggcgaacgcgctctttgcacaagaaaaagaaaagccgcaagcaaaatcgttcttgatccgttttgcctgcggcccttatagaccatgaatcgattttgttggttta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: TF0525:TF0527|TF0525:TF0527:conserved hypothetical protein:prolyl endopeptidase:->->:549645..549811 167
acgttacggataaaccgccggcaaagatacgatttttgtactgctttctcgggtttcggcaggcgaacgcgctctttgcacaagaaaaagaaaagccgcaagcaaaatcgttcttgatccgttttgcctgcggcccttatagaccatgaatcgattttgttggttta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

acgttacggataaaccgccggcaaagatacgatttttgtactgctttctcgggtttcggcaggcgaacgcgctctttgcacaagaaaaagaaaagccgcaagcaaaatcgttcttgatccgttttgcctgcggcccttatagaccatgaatcgattttgttggttta
Predict ORF larger than 30AA ================================================
Protein_Len: 35	Strand: +	Start: 10	End: 114
......... M  N  R  R  Q  R  Y  D  F  C  T  A  F  S  G  F  G  R  R  T  R  S  L  H  K  K  K  K  S  R  K  Q  N  R  S .....................................................
Protein_Len: 36	Strand: +	Start: 32	End: 139
............................... M  F  V  L  L  S  R  V  S  A  G  E  R  A  L  C  T  R  K  R  K  A  A  S  K  I  V  L  D  P  F  C  L  R  P  L ............................
Protein_Len: 40	Strand: +	Start: 27	End: 146
.......................... M  R  F  L  Y  C  F  L  G  F  R  Q  A  N  A  L  F  A  Q  E  K  E  K  P  Q  A  K  S  F  L  I  R  F  A  C  G  P  Y  R  P .....................
Protein_Len: 47	Strand: -	Start: 7	End: 147
...... P  Y  V  A  P  L  S  V  I  K  T  S  S  E  R  T  E  A  P  S  R  A  R  Q  V  L  F  L  F  A  A  L  L  I  T  R  S  G  N  Q  R  R  G  K  Y  V  M ....................
Protein_Len: 51	Strand: -	Start: 3	End: 155
.. N  R  I  F  R  R  C  L  Y  S  K  Q  V  A  K  E  P  K  P  L  R  V  R  E  K  C  L  F  F  F  L  R  L  C  F  R  E  Q  D  T  K  G  A  A  R  I  S  W  S  D  M ............
Protein_Len: 39	Strand: -	Start: 2	End: 118
. T  V  S  L  G  G  A  F  I  R  N  K  Y  Q  K  R  P  N  R  C  A  F  A  S  K  A  C  S  F  S  F  G  C  A  F  D  N  K  M .................................................

acgttacggataaaccgccggcaaagatacgatttttgtactgctttctcgggtttcggcaggcgaacgcgctctttgcacaagaaaaagaaaagccgcaagcaaaatcgttcttgatccgttttgcctgcggcccttatagaccatgaatcgattttgttggttta
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

acgttacggataaaccgccggcaaagatacgatttttgtactgctttctcgggtttcggcaggcgaacgcgctctttgcacaagaaaaagaaaagccgcaagcaaaatcgttcttgatccgttttgcctgcggcccttatagaccatgaatcgattttgttggttta
Predict TransTerm conf > 70================================================
TransTerm Strand: -	Conf: 100	HP_score: -10.9	Tail_Score: -5.44638	Start: 95	End: 134	Full_Region: tcatggtctataagg gccgcaggcaaaacg gatcaagaa cgattttgcttgcggc ttttctttttcttgt
..............................................................................................gccgcaggcaaaacggatcaagaacgattttgcttgcggc.................................

Find igs database================================================
Query_seq: TF0525:TF0527|TF0525:TF0527:conserved hypothetical protein:prolyl endopeptidase:->->:549645..549811 167
acgttacggataaaccgccggcaaagatacgatttttgtactgctttctcgggtttcggcaggcgaacgcgctctttgcacaagaaaaagaaaagccgcaagcaaaatcgttcttgatccgttttgcctgcggcccttatagaccatgaatcgattttgttggttta
Intra-Species Hit: Count: 1	Min: 1	Max: 167	Len: 167
Subject: tfor_TF0525_TF0527|conserved hypothetical protein:prolyl endopeptidase|POSITIVE:POSITIVE|[549645,549811]|167
HSP  1	e-value: 4.0E-90	bit: 331.0	Len: 167	Query Start:1	Query End:167	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 167
acgttacggataaaccgccggcaaagatacgatttttgtactgctttctcgggtttcggcaggcgaacgcgctctttgcacaagaaaaagaaaagccgcaagcaaaatcgttcttgatccgttttgcctgcggcccttatagaccatgaatcgattttgttggttta
acgttacggataaaccgccggcaaagatacgatttttgtactgctttctcgggtttcggcaggcgaacgcgctctttgcacaagaaaaagaaaagccgcaagcaaaatcgttcttgatccgttttgcctgcggcccttatagaccatgaatcgattttgttggttta

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
ACGUUACGGAUAAACCGCCGGCAAAGAUACGAUUUUUGUACUGCUUUCUCGGGUUUCGGCAGGCGAACGCGCUCUUUGCACAAGAAAAAGAAAAGCCGCAAGCAAAAUCGUUCUUGAUCCGUUUUGCCUGCGGCCCUUAUAGACCAUGAAUCGAUUUUGUUGGUUUA
................((((((((((...((((((.((..(((.(((((....((((.(((((((....))))...)))....)))).))))).((((((.(((((((.(........).))))))).)))))).....)))..)).)))))).))))))))))... (-47.40)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UAAACCAACAAAAUCGAUUCAUGGUCUAUAAGGGCCGCAGGCAAAACGGAUCAAGAACGAUUUUGCUUGCGGCUUUUCUUUUUCUUGUGCAAAGAGCGCGUUCGCCUGCCGAAACCCGAGAAAGCAGUACAAAAAUCGUAUCUUUGCCGGCGGUUUAUCCGUAACGU
........((((..(((((..((..((..(((((((((((((((((((.........)).)))))))))))))))))(((((((..((((.....)))).((((.....))))....))))))).))..))..)))))....))))...((((.....))))..... (-48.10)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
431	100	53	212	165	tfor:TF0597|5end_hypothetical_protein_628788..629018_POSITIVE
421	80	42	45	1	tfor:TF0553|5end_Bacteroides_aerotolerance_protein,_BatD_584462..584692_POSITIVE
386	152	111	83	45	tfor:TF0170|5end_possible_CRISPR-associated_protein_Cas2_179566..179796_POSITIVE
375	60	15	161	113	tfor:TF0307|5end_conserved_hypothetical_protein_332783..333013_POSITIVE
371	69	37	125	90	tfor:TF1763|5end_K+-dependent_Na+/Ca+_exchanger_related-protein_1900406..1900636_POSITIVE
370	79	41	231	184	tfor:TF1256|5end_hypothetical_protein_1338083..1338313_POSITIVE
369	73	35	58	5	tfor:TF1023|5end_ABC_transporter,_permease_component_1079197..1079427_POSITIVE
367	80	31	213	145	tfor:TF2214|5end_peptidyl-prolyl_cis-trans_isomerase_2386897..2387127_POSITIVE
364	70	21	174	121	tfor:TF0615|5end_mannose-1-phosphate_guanylyltransferase_648832..649062_POSITIVE
363	136	96	174	139	tfor:TF2259|5end_transfer_region-related_protein,_TraK_2429577..2429807_POSITIVE
359	58	16	230	186	tfor:TF1049|5end_cobyrinic_acid_a,c-diamide_synthase_1110140..1110370_POSITIVE
358	81	41	191	136	tfor:TF2430|5end_hypothetical_protein_2612660..2612890_POSITIVE
353	60	19	61	19	tfor:TF2738|5end_30S_ribosomal_protein_S16_2919303..2919533_POSITIVE
353	67	23	64	18	tfor:TF2498|5end_electron_transfer_flavoprotein,_alpha_subunit_2672801..2673031_POSITIVE
352	135	95	230	194	tfor:TF1598|5end_conserved_hypothetical_protein_1713358..1713588_POSITIVE
350	74	37	137	92	tfor:TF2912|5end_hypothetical_protein_3106508..3106738_POSITIVE
350	78	31	189	128	tfor:TF2255|5end_transfer_region-related_protein,_TraH_2427504..2427734_POSITIVE
349	53	15	42	9	tfor:TF2998|5end_surface_antigen_BspA_3211811..3212041_POSITIVE
349	60	16	116	65	tfor:TF0065|5end_conserved_hypothetical_protein_70274..70504_POSITIVE
347	79	38	72	20	tfor:TF0301|5end_outer_membrane_protein,_TonB_dependent_receptor_325457..325687_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
403	60	17	70	28	tfor:TF0178|3end_ferritin_188223..188373_POSITIVE
387	133	94	126	82	tfor:TF1738|3end_outer_membrane_protein_1866946..1867096_POSITIVE
386	152	111	80	42	tfor:TF0169|3end_possible_CRISPR-associated_protein_Cas1_179643..179793_POSITIVE
364	70	21	125	72	tfor:TF0614|3end_UDP-glucose_6-dehydrogenase/UDP-N-acetyl-D-mannosaminuronate_dehydrogenase_648863..649013_POSITIVE
363	136	96	139	104	tfor:TF2257|3end_transfer_region-related_protein,_TraJ_2429622..2429772_POSITIVE
360	99	51	68	14	tfor:TF2260|3end_transfer_region-related_protein,_TraL_2430592..2430742_POSITIVE
360	83	43	147	91	tfor:TF0624|3end_Xaa-Pro_dipeptidase_(aminopeptidase_P)_661015..661165_POSITIVE
350	78	31	136	75	tfor:TF2253|3end_conjugative_transposon_protein,_TraG_2427531..2427681_POSITIVE
347	65	21	48	6	tfor:TF0306|3end_transglutaminase-like_enzyme/cysteine_protease_332749..332899_POSITIVE
347	79	38	76	24	tfor:TF0300|3end_hypothetical_protein_325541..325691_POSITIVE
344	102	62	44	8	tfor:TF2243|3end_possible_mobilization_protein_2419470..2419620_POSITIVE
338	136	93	76	28	tfor:TF1296|3end_possible_DNA-binding_protein,_histone-like_family_1378982..1379132_POSITIVE
338	98	54	108	62	tfor:TF0309|3end_conserved_hypothetical_protein_334775..334925_POSITIVE
337	77	31	151	86	tfor:TF2581|3end_50S_ribosomal_protein_L17_2749370..2749520_POSITIVE
336	76	37	59	5	tfor:TF2455|3end_conserved_hypothetical_protein;_possible_membrane_protein_2632437..2632587_POSITIVE
334	153	115	50	4	tfor:TF2807|3end_possible_chloride_channel_protein_2998534..2998684_POSITIVE
333	138	95	138	94	tfor:TF2042|3end_sugar_phosphate_isomerase,_polysialic_acid_capsule_expression_protein_2202356..2202506_POSITIVE
330	59	17	71	16	tfor:TF0964|3end_conserved_hypothetical_protein_1013376..1013526_POSITIVE
330	143	107	67	31	tfor:TF0175|3end_hypothetical_protein_185907..186057_POSITIVE
327	77	42	147	105	tfor:TF2426|3end_conserved_hypothetical_protein;_possible_TonB_receptor_2605931..2606081_POSITIVE