Origin IGS:
ttcaaaattagttcacgatatatataagatgccaaaaccatgccaaaacactcaaatcactaacatcaaaaaatttataaaatcattcaagaacagcctgtgtccaaaaattggacgtctgtgtccaatttttggacataaacagacgagccaacaataaaagacatgccccagacagttcattttttttcctaactttgcgaagcattatgtatatgcgttattattatatatgtattatatttctatattatcattaattttattttatacaat
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
attgtataaaataaaattaatgataatatagaaatataatacatatataataataacgcatatacataatgcttcgcaaagttaggaaaaaaaatgaactgtctggggcatgtcttttattgttggctcgtctgtttatgtccaaaaattggacacagacgtccaatttttggacacaggctgttcttgaatgattttataaattttttgatgttagtgatttgagtgttttggcatggttttggcatcttatatatatcgtgaactaattttgaa

Mask Tandem Repeat Region ================================================
ttcaaaattagttcacgatatatataagatgccaaaaccatgccaaaacactcaaatcactaacatcaaaaaatttataaaatcattcaagaacagcctgtgtccaaaaattggacgtctgtgtccaatttttggacataaacagacgagccaacaataaaagacatgccccagacagttcattttttttcctaactttgcgaagcattatgtatatgcgttattattatatatgtattatatttctatattatcattaattttattttatacaat

Find is-nt database================================================
Query_seq: TF1176:TF1177|TF1176:TF1177:outer membrane protein:conserved hypothetical protein; possible ribosomal protein S1:->->:1261039..1261314 276
ttcaaaattagttcacgatatatataagatgccaaaaccatgccaaaacactcaaatcactaacatcaaaaaatttataaaatcattcaagaacagcctgtgtccaaaaattggacgtctgtgtccaatttttggacataaacagacgagccaacaataaaagacatgccccagacagttcattttttttcctaactttgcgaagcattatgtatatgcgttattattatatatgtattatatttctatattatcattaattttattttatacaat
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: TF1176:TF1177|TF1176:TF1177:outer membrane protein:conserved hypothetical protein; possible ribosomal protein S1:->->:1261039..1261314 276
ttcaaaattagttcacgatatatataagatgccaaaaccatgccaaaacactcaaatcactaacatcaaaaaatttataaaatcattcaagaacagcctgtgtccaaaaattggacgtctgtgtccaatttttggacataaacagacgagccaacaataaaagacatgccccagacagttcattttttttcctaactttgcgaagcattatgtatatgcgttattattatatatgtattatatttctatattatcattaattttattttatacaat
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: TF1176:TF1177|TF1176:TF1177:outer membrane protein:conserved hypothetical protein; possible ribosomal protein S1:->->:1261039..1261314 276
ttcaaaattagttcacgatatatataagatgccaaaaccatgccaaaacactcaaatcactaacatcaaaaaatttataaaatcattcaagaacagcctgtgtccaaaaattggacgtctgtgtccaatttttggacataaacagacgagccaacaataaaagacatgccccagacagttcattttttttcctaactttgcgaagcattatgtatatgcgttattattatatatgtattatatttctatattatcattaattttattttatacaat
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

ttcaaaattagttcacgatatatataagatgccaaaaccatgccaaaacactcaaatcactaacatcaaaaaatttataaaatcattcaagaacagcctgtgtccaaaaattggacgtctgtgtccaatttttggacataaacagacgagccaacaataaaagacatgccccagacagttcattttttttcctaactttgcgaagcattatgtatatgcgttattattatatatgtattatatttctatattatcattaattttattttatacaat
Predict ORF larger than 30AA ================================================
Protein_Len: 46	Strand: +	Start: 20	End: 157
................... M  Y  K  M  P  K  P  C  Q  N  T  Q  I  T  N  I  K  K  F  I  K  S  F  K  N  S  L  C  P  K  I  G  R  L  C  P  I  F  G  H  K  Q  T  S  Q  Q .......................................................................................................................
Protein_Len: 49	Strand: +	Start: 111	End: 257
.............................................................................................................. M  D  V  C  V  Q  F  L  D  I  N  R  R  A  N  N  K  R  H  A  P  D  S  S  F  F  F  L  T  L  R  S  I  M  Y  M  R  Y  Y  Y  I  C  I  I  F  L  Y  Y  H ...................
Protein_Len: 31	Strand: +	Start: 182	End: 274
..................................................................................................................................................................................... M  F  F  P  N  F  A  K  H  Y  V  Y  A  L  L  L  Y  M  Y  Y  I  S  I  L  S  L  I  L  F  Y  T ..
Protein_Len: 44	Strand: -	Start: 86	End: 217
..................................................................................... E  L  V  A  Q  T  W  F  N  S  T  Q  T  W  N  K  S  M  F  L  R  A  L  L  L  L  C  A  G  S  L  E  N  K  K  R  V  K  R  L  M  I  Y  M ...........................................................
Protein_Len: 43	Strand: -	Start: 55	End: 183
...................................................... I  V  L  M  L  F  N  I  F  D  N  L  F  L  R  H  G  F  I  P  R  R  H  G  I  K  P  C  L  C  V  L  W  C  Y  F  V  H  G  L  C  N  M .............................................................................................

ttcaaaattagttcacgatatatataagatgccaaaaccatgccaaaacactcaaatcactaacatcaaaaaatttataaaatcattcaagaacagcctgtgtccaaaaattggacgtctgtgtccaatttttggacataaacagacgagccaacaataaaagacatgccccagacagttcattttttttcctaactttgcgaagcattatgtatatgcgttattattatatatgtattatatttctatattatcattaattttattttatacaat
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================
PromScan Matrix: RpoN	Strand: -	Score: 85	Start: 30	End: 46
.............................TTGGCATGGTTTTGGCA......................................................................................................................................................................................................................................

ttcaaaattagttcacgatatatataagatgccaaaaccatgccaaaacactcaaatcactaacatcaaaaaatttataaaatcattcaagaacagcctgtgtccaaaaattggacgtctgtgtccaatttttggacataaacagacgagccaacaataaaagacatgccccagacagttcattttttttcctaactttgcgaagcattatgtatatgcgttattattatatatgtattatatttctatattatcattaattttattttatacaat
Predict TransTerm conf > 70================================================
TransTerm Strand: -	Conf: 100	HP_score: -14.7	Tail_Score: -3.72527	Start: 94	End: 145	Full_Region: ttattgttggctcgt ctgtttatgtccaaaaattggac acagac gtccaatttttggacacaggctg ttcttgaatgatttt
.............................................................................................ctgtttatgtccaaaaattggacacagacgtccaatttttggacacaggctg...................................................................................................................................
TransTerm Strand: -	Conf: 100	HP_score: -15.9	Tail_Score: -3.43104	Start: 96	End: 143	Full_Region: attgttggctcgtct gtttatgtccaaaaattggac acagac gtccaatttttggacacaggc tgttcttgaatgatt
...............................................................................................gtttatgtccaaaaattggacacagacgtccaatttttggacacaggc.....................................................................................................................................
TransTerm Strand: +	Conf: 76	HP_score: -6.3	Tail_Score: -4.59773	Start: 111	End: 128	Full_Region: GCCTGTGTCCAAAAA TTGGACG TCTG TGTCCAA TTTTTGGACATAAAC
..............................................................................................................TTGGACGTCTGTGTCCAA....................................................................................................................................................
TransTerm Strand: -	Conf: 73	HP_score: -5.6	Tail_Score: -4.56597	Start: 111	End: 128	Full_Region: gtttatgtccaaaaa ttggac acagac gtccaa tttttggacacaggc
..............................................................................................................ttggacacagacgtccaa....................................................................................................................................................

Find igs database================================================
Query_seq: TF1176:TF1177|TF1176:TF1177:outer membrane protein:conserved hypothetical protein; possible ribosomal protein S1:->->:1261039..1261314 276
ttcaaaattagttcacgatatatataagatgccaaaaccatgccaaaacactcaaatcactaacatcaaaaaatttataaaatcattcaagaacagcctgtgtccaaaaattggacgtctgtgtccaatttttggacataaacagacgagccaacaataaaagacatgccccagacagttcattttttttcctaactttgcgaagcattatgtatatgcgttattattatatatgtattatatttctatattatcattaattttattttatacaat
Intra-Species Hit: Count: 1	Min: 1	Max: 182	Len: 182
Subject: tfor_TF1176_TF1177|outer membrane protein:conserved hypothetical protein; possible ribosomal protein S1|POSITIVE:POSITIVE|[1261039,1261314]|276
HSP  1	e-value: 8.0E-99	bit: 361.0	Len: 182	Query Start:1	Query End:182	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 182
ttcaaaattagttcacgatatatataagatgccaaaaccatgccaaaacactcaaatcactaacatcaaaaaatttataaaatcattcaagaacagcctgtgtccaaaaattggacgtctgtgtccaatttttggacataaacagacgagccaacaataaaagacatgccccagacagttca..............................................................................................
ttcaaaattagttcacgatatatataagatgccaaaaccatgccaaaacactcaaatcactaacatcaaaaaatttataaaatcattcaagaacagcctgtgtccaaaaattggacgtctgtgtccaatttttggacataaacagacgagccaacaataaaagacatgccccagacagttca..............................................................................................

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UUCAAAAUUAGUUCACGAUAUAUAUAAGAUGCCAAAACCAUGCCAAAACACUCAAAUCACUAACAUCAAAAAAUUUAUAAAAUCAUUCAAGAACAGCCUGUGUCCAAAAAUUGGACGUCUGUGUCCAAUUUUUGGACAUAAACAGACGAGCCAACAAUAAAAGACAUGCCCCAGACAGUUCA
..........((((.............((((................................))))...............................(((((((((((((((((((....))))))))))))))))))).......))))............................... (-31.45)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UGAACUGUCUGGGGCAUGUCUUUUAUUGUUGGCUCGUCUGUUUAUGUCCAAAAAUUGGACACAGACGUCCAAUUUUUGGACACAGGCUGUUCUUGAAUGAUUUUAUAAAUUUUUUGAUGUUAGUGAUUUGAGUGUUUUGGCAUGGUUUUGGCAUCUUAUAUAUAUCGUGAACUAAUUUUGAA
.((((.(((((.(((..(((..........)))..)))......((((((((((((((((......))))))))))))))))))))).))))....(((((..(((((.......((((((((.(((....((((....)))).))))))))))))))))...))))).............. (-49.71)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
301	159	113	62	2	tfor:TF1090|5end_hypothetical_protein_1159032..1159262_POSITIVE
296	156	115	199	151	tfor:TF1130|5end_ABC_transporter_ATP-binding_protein/permease_component_1205387..1205617_POSITIVE
284	157	113	179	121	tfor:TF0986|5end_50S_ribosomal_protein_L31_1041426..1041656_POSITIVE
280	133	91	212	168	tfor:TF2880|5end_phenylalanyl-tRNA_synthetase,_beta_subunit_3069052..3069282_POSITIVE
275	151	111	96	54	tfor:TF3139|5end_Na+-translocating_NADH-quinone_reductase,_subunit_C_3372581..3372811_POSITIVE
274	128	82	87	47	tfor:TF0893|5end_conserved_hypothetical_protein_941754..941984_POSITIVE
272	124	81	168	120	tfor:TF3147|5end_adenylate_kinase_3383049..3383279_POSITIVE
269	124	83	55	6	tfor:TF2504|5end_peptidyl-prolyl_cis-trans_isomerase_2680031..2680261_POSITIVE
267	156	113	170	113	tfor:TF2590|5end_transposase_2756056..2756286_POSITIVE
266	156	111	192	140	tfor:TF2902|5end_holliday_junction_DNA_helicase_3097813..3098043_POSITIVE
265	148	101	123	81	tfor:TF2239|5end_hypothetical_protein_2414537..2414767_POSITIVE
265	156	116	54	11	tfor:TF0496|5end_conserved_hypothetical_protein_522332..522562_POSITIVE
264	148	104	214	165	tfor:TF3134|5end_HD_superfamily_hydrolase_3367990..3368220_POSITIVE
257	178	137	177	118	tfor:TF2977|5end_candidate_b-glycosyltransferase,_Glycosyltransferase_Family_2_protein_3185228..3185458_POSITIVE
254	138	92	65	5	tfor:TF2469|5end_oxidoreductase,_possible_Gfo/Idh/MocA_family_2646505..2646735_POSITIVE
252	140	95	56	10	tfor:TF2629|5end_conserved_hypothetical_protein;_possible_lactoylglutathione_lyase_2801296..2801526_POSITIVE
252	125	92	58	27	tfor:TF1834|5end_3-isopropylmalate_dehydrogenase_1983161..1983391_POSITIVE
251	129	100	65	38	tfor:TF3093|5end_30S_ribosomal_protein_S2_3325244..3325474_POSITIVE
250	127	87	90	55	tfor:TF2446|5end_riboflavin-specific_deaminase_2622370..2622600_POSITIVE
245	179	133	51	12	tfor:TF2290|5end_ABC_transporter,_ATP-binding/permease_component_2443942..2444172_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
284	157	113	97	39	tfor:TF0984|3end_possible_mucin-desulfating_sulfatase_(MdsC_protein)_1041424..1041574_POSITIVE
280	133	91	88	44	tfor:TF2879|3end_tRNA_(guanine-N-1)-methyltransferase_3069008..3069158_POSITIVE
275	151	111	89	47	tfor:TF3138|3end_Na+-translocating_quinone_reductase,_subunit_D_3372654..3372804_POSITIVE
272	124	81	119	71	tfor:TF3146|3end_GTP-binding_protein_Obg_3383080..3383230_POSITIVE
272	139	94	108	68	tfor:TF2478|3end_hypothetical_protein_2655613..2655763_POSITIVE
269	124	83	55	6	tfor:TF2503|3end_conserved_hypothetical_protein_2680111..2680261_POSITIVE
265	160	112	62	1	tfor:TF2299|3end_hypothetical_protein_2450247..2450397_POSITIVE
265	148	101	94	52	tfor:TF2238|3end_conserved_hypothetical_protein_2414588..2414738_POSITIVE
255	126	84	106	61	tfor:TF2793|3end_possible_L-lysine_2,3-aminomutase_2979888..2980038_POSITIVE
254	138	92	62	2	tfor:TF2468|3end_hypothetical_protein_2646582..2646732_POSITIVE
252	140	95	56	10	tfor:TF2628|3end_conserved_hypothetical_protein_2801376..2801526_POSITIVE
247	159	115	59	2	tfor:TF1089|3end_ABC_transporter,_ATP-binding_fragment,_bacteriocin/lantibiotic_exporter_1159109..1159259_POSITIVE
242	126	93	120	77	tfor:TF0537|3end_conserved_hypothetical_protein_566836..566986_POSITIVE
240	149	111	150	110	tfor:TF3147|3end_adenylate_kinase_3383704..3383854_POSITIVE
239	135	97	43	13	tfor:TF1165|3end_conserved_hypothetical_protein_1245921..1246071_POSITIVE
237	149	101	119	68	tfor:TF0064|3end_conserved_hypothetical_protein_70412..70562_POSITIVE
235	179	142	33	2	tfor:TF2289|3end_secretion_protein,_possible_HlyD_family_2444004..2444154_POSITIVE
235	179	131	145	97	tfor:TF0444|3end_Na+-translocating_NADH-quinone_oxidoreductase,_subunit_5_466518..466668_POSITIVE
232	126	90	143	104	tfor:TF3065|3end_enolase_3292412..3292562_POSITIVE
232	179	132	64	10	tfor:TF1622|3end_conserved_hypothetical_protein_1736763..1736913_POSITIVE