Origin IGS:
gcgcgagccattggcagcgataccggcttcgtccgagataaacgtgatgccgtaaatacgtccctgctcgttttggcgggcatgcctggcaatgcgggcgattttctttaatattattgttaattattgcatacctttgaaggcgtataacaaaatgattaccattc
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
gaatggtaatcattttgttatacgccttcaaaggtatgcaataattaacaataatattaaagaaaatcgcccgcattgccaggcatgcccgccaaaacgagcagggacgtatttacggcatcacgtttatctcggacgaagccggtatcgctgccaatggctcgcgc

Mask Tandem Repeat Region ================================================
gcgcgagccattggcagcgataccggcttcgtccgagataaacgtgatgccgtaaatacgtccctgctcgttttggcgggcatgcctggcaatgcgggcgattttctttaatattattgttaattattgcatacctttgaaggcgtataacaaaatgattaccattc

Find is-nt database================================================
Query_seq: TF0880:TF0881|TF0880:TF0881:conserved hypothetical protein:conserved hypothetical protein:->->:934432..934598 167
gcgcgagccattggcagcgataccggcttcgtccgagataaacgtgatgccgtaaatacgtccctgctcgttttggcgggcatgcctggcaatgcgggcgattttctttaatattattgttaattattgcatacctttgaaggcgtataacaaaatgattaccattc
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: TF0880:TF0881|TF0880:TF0881:conserved hypothetical protein:conserved hypothetical protein:->->:934432..934598 167
gcgcgagccattggcagcgataccggcttcgtccgagataaacgtgatgccgtaaatacgtccctgctcgttttggcgggcatgcctggcaatgcgggcgattttctttaatattattgttaattattgcatacctttgaaggcgtataacaaaatgattaccattc
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: TF0880:TF0881|TF0880:TF0881:conserved hypothetical protein:conserved hypothetical protein:->->:934432..934598 167
gcgcgagccattggcagcgataccggcttcgtccgagataaacgtgatgccgtaaatacgtccctgctcgttttggcgggcatgcctggcaatgcgggcgattttctttaatattattgttaattattgcatacctttgaaggcgtataacaaaatgattaccattc
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

gcgcgagccattggcagcgataccggcttcgtccgagataaacgtgatgccgtaaatacgtccctgctcgttttggcgggcatgcctggcaatgcgggcgattttctttaatattattgttaattattgcatacctttgaaggcgtataacaaaatgattaccattc
Predict ORF larger than 30AA ================================================
Protein_Len: 33	Strand: +	Start: 10	End: 108
......... M  G  S  D  T  G  F  V  R  D  K  R  D  A  V  N  T  S  L  L  V  L  A  G  M  P  G  N  A  G  D  F  L ...........................................................
Protein_Len: 37	Strand: +	Start: 56	End: 166
....................................................... M  R  P  C  S  F  W  R  A  C  L  A  M  R  A  I  F  F  N  I  I  V  N  Y  C  I  P  L  K  A  Y  N  K  M  I  T  I .
Protein_Len: 30	Strand: -	Start: 3	End: 92
.. R  A  M  P  L  S  V  P  K  T  R  S  L  R  S  A  T  F  V  D  R  S  T  K  A  P  M  G  P  M ...........................................................................
Protein_Len: 49	Strand: -	Start: 2	End: 148
. A  L  W  Q  C  R  Y  R  S  R  G  L  Y  V  H  H  R  L  Y  T  G  A  R  K  P  P  C  A  Q  C  H  P  R  N  E  K  I  N  N  N  I  I  A  Y  R  Q  L  R  M ...................
Protein_Len: 39	Strand: -	Start: 1	End: 117
 R  S  G  N  A  A  I  G  A  E  D  S  I  F  T  I  G  Y  I  R  G  Q  E  N  Q  R  A  H  R  A  I  R  A  I  K  K  L  I  M ..................................................

gcgcgagccattggcagcgataccggcttcgtccgagataaacgtgatgccgtaaatacgtccctgctcgttttggcgggcatgcctggcaatgcgggcgattttctttaatattattgttaattattgcatacctttgaaggcgtataacaaaatgattaccattc
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

gcgcgagccattggcagcgataccggcttcgtccgagataaacgtgatgccgtaaatacgtccctgctcgttttggcgggcatgcctggcaatgcgggcgattttctttaatattattgttaattattgcatacctttgaaggcgtataacaaaatgattaccattc
Predict TransTerm conf > 70================================================
TransTerm Strand: +	Conf: 70	HP_score: -2.5	Tail_Score: -4.99568	Start: 64	End: 101	Full_Region: GCCGTAAATACGTCC CTGCTCGTTTTGGCGGG CATG CCTGGCAATGCGGGCGA TTTTCTTTAATATTA
...............................................................CTGCTCGTTTTGGCGGGCATGCCTGGCAATGCGGGCGA..................................................................

Find igs database================================================
Query_seq: TF0880:TF0881|TF0880:TF0881:conserved hypothetical protein:conserved hypothetical protein:->->:934432..934598 167
gcgcgagccattggcagcgataccggcttcgtccgagataaacgtgatgccgtaaatacgtccctgctcgttttggcgggcatgcctggcaatgcgggcgattttctttaatattattgttaattattgcatacctttgaaggcgtataacaaaatgattaccattc
Intra-Species Hit: Count: 1	Min: 1	Max: 167	Len: 167
Subject: tfor_TF0880_TF0881|conserved hypothetical protein:conserved hypothetical protein|POSITIVE:POSITIVE|[934432,934598]|167
HSP  1	e-value: 4.0E-90	bit: 331.0	Len: 167	Query Start:1	Query End:167	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 167
gcgcgagccattggcagcgataccggcttcgtccgagataaacgtgatgccgtaaatacgtccctgctcgttttggcgggcatgcctggcaatgcgggcgattttctttaatattattgttaattattgcatacctttgaaggcgtataacaaaatgattaccattc
gcgcgagccattggcagcgataccggcttcgtccgagataaacgtgatgccgtaaatacgtccctgctcgttttggcgggcatgcctggcaatgcgggcgattttctttaatattattgttaattattgcatacctttgaaggcgtataacaaaatgattaccattc

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
GCGCGAGCCAUUGGCAGCGAUACCGGCUUCGUCCGAGAUAAACGUGAUGCCGUAAAUACGUCCCUGCUCGUUUUGGCGGGCAUGCCUGGCAAUGCGGGCGAUUUUCUUUAAUAUUAUUGUUAAUUAUUGCAUACCUUUGAAGGCGUAUAACAAAAUGAUUACCAUUC
.(((..(((...))).)))....((((...(((((.......)).)))))))...(((((((..(((((((.(((.((((....)))).))).))))))).......((((((....))))))..................)))))))................... (-44.20)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
GAAUGGUAAUCAUUUUGUUAUACGCCUUCAAAGGUAUGCAAUAAUUAACAAUAAUAUUAAAGAAAAUCGCCCGCAUUGCCAGGCAUGCCCGCCAAAACGAGCAGGGACGUAUUUACGGCAUCACGUUUAUCUCGGACGAAGCCGGUAUCGCUGCCAAUGGCUCGCGC
...((((((((...(((((.((..(((....)))..)).))))).................(.....)....).)))))))(((......)))....(((((..((..((.....((((....(((((.....)))))..)))).....))..))....)))))... (-35.60)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
491	102	64	57	8	tfor:TF1479|5end_ABC_transporter,_permease_component_1572241..1572471_POSITIVE
458	100	59	159	117	tfor:TF2079|5end_permease_2245585..2245815_POSITIVE
445	90	44	220	163	tfor:TF0529|5end_transposase_554776..555006_POSITIVE
442	101	64	229	181	tfor:TF2229.1|5end_rteR_regulatory_ortholog_(with_internal_stop)_2399454..2399684_POSITIVE
435	100	62	36	3	tfor:TF2264|5end_transfer_region-related_protein,_TraO_2432890..2433120_POSITIVE
434	100	51	66	4	tfor:TF0888|5end_transfer_region-related_protein,_TraN_938392..938622_POSITIVE
433	100	59	231	181	tfor:TF0543|5end_glycine_cleavage_system_p-protein_572251..572481_POSITIVE
424	90	42	190	146	tfor:TF2530|5end_conserved_hypothetical_protein_2711416..2711646_POSITIVE
418	100	59	225	176	tfor:TF1462|5end_erythronate-4-phosphate_dehydrogenase_1552184..1552414_POSITIVE
417	102	62	68	24	tfor:TF0594|5end_conserved_hypothetical_protein;_possible_PAP2_superfamily_protein_626971..627201_POSITIVE
416	100	51	223	164	tfor:TF2820|5end_argininosuccinate_synthetase_3009876..3010106_POSITIVE
414	100	62	148	91	tfor:TF1182|5end_hypothetical_protein_1268565..1268795_POSITIVE
413	50	1	196	148	tfor:TF2535|5end_histidyl-tRNA_synthetase_2717740..2717970_POSITIVE
412	88	42	206	153	tfor:TF0890|5end_transfer_region-related_protein,_TraQ_940014..940244_POSITIVE
410	90	43	230	189	tfor:TF3160|5end_conserved_hypothetical_protein_3395531..3395761_POSITIVE
410	100	59	74	24	tfor:TF2817|5end_hypothetical_protein_3007358..3007588_POSITIVE
410	100	59	229	179	tfor:TF1185|5end_hypothetical_protein_1269238..1269468_POSITIVE
407	99	57	67	23	tfor:TF2263|5end_transfer_region-related_protein,_TraN_2431901..2432131_POSITIVE
407	70	24	60	18	tfor:TF0538|5end_hypothetical_protein_566891..567121_POSITIVE
407	70	24	53	11	tfor:TF0539|5end_hypothetical_protein_566884..567114_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
445	90	44	143	86	tfor:TF0528|3end_two-component_system_sensor_histidine_kinase_554779..554929_POSITIVE
439	100	59	52	5	tfor:TF1834|3end_3-isopropylmalate_dehydrogenase_1984311..1984461_POSITIVE
417	102	62	68	24	tfor:TF0593|3end_membrane-associated_phospholipid_phosphatase_627051..627201_POSITIVE
414	100	62	148	91	tfor:TF1186|3end_hypothetical_protein_1269815..1269965_POSITIVE
403	106	63	61	18	tfor:TF1403|3end_hypothetical_protein_1478025..1478175_POSITIVE
399	102	73	32	1	tfor:TF1478|3end_membrane_fusion_efflux_protein_1572296..1572446_POSITIVE
395	109	64	52	5	tfor:TF1908|3end_possible_phosphoglycerate_mutase_2063299..2063449_POSITIVE
391	100	59	54	1	tfor:TF2256|3end_transfer_region-related_protein,_TraI_2428614..2428764_POSITIVE
384	100	59	47	6	tfor:TF2895|3end_hypothetical_protein_3084192..3084342_POSITIVE
383	99	56	60	12	tfor:TF2248|3end_transfer_region-related_protein,_TraB_2423068..2423218_POSITIVE
382	50	4	142	92	tfor:TF2673|3end_conserved_hypothetical_protein_2848272..2848422_POSITIVE
377	99	59	112	71	tfor:TF2640|3end_hypothetical_protein_2809533..2809683_POSITIVE
376	99	59	63	8	tfor:TF2266|3end_transfer_region-related_protein,_TraQ_2434949..2435099_POSITIVE
372	35	1	44	5	tfor:TF2118|3end_conserved_hypothetical_protein_2291693..2291843_POSITIVE
369	50	1	86	41	tfor:TF1852|3end_prtQ_protein_2006546..2006696_POSITIVE
369	50	1	141	91	tfor:TF1663|3end_ABC_transporter,_permease_component_1778755..1778905_POSITIVE
368	99	60	129	80	tfor:TF2654|3end_arginyl-tRNA_synthetase_2824559..2824709_POSITIVE
367	90	44	81	20	tfor:TF1762|3end_hypothetical_protein_1899648..1899798_POSITIVE
366	102	63	151	105	tfor:TF2550|3end_translation_elongation_factor_G_2734492..2734642_POSITIVE
365	49	3	139	93	tfor:TF1105|3end_arylsulfatase_regulator;_Fe-S_oxidoreductase_1174178..1174328_POSITIVE