Origin IGS:
taaccataagctgcgaaggaaaggggcgggctccgtgtccgccccccctttgtcattccgaacgtagtgaggaatctcgcgaggaaaaagaaggagattcttcgcttcgccctgaatgacaaattaatggttaattgtt
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
aacaattaaccattaatttgtcattcagggcgaagcgaagaatctccttctttttcctcgcgagattcctcactacgttcggaatgacaaagggggggcggacacggagcccgcccctttccttcgcagcttatggtta

Mask Tandem Repeat Region ================================================
taaccataagctgcgaaggaaaggggcgggctccgtgtccgccccccctttgtcattccgaacgtagtgaggaatctcgcgaggaaaaagaaggagattcttcgcttcgccctgaatgacaaattaatggttaattgtt

Find is-nt database================================================
Query_seq: TF0541:TF0542|TF0541:TF0542:conserved hypothetical protein:hypothetical protein:->->:571919..572057 139
taaccataagctgcgaaggaaaggggcgggctccgtgtccgccccccctttgtcattccgaacgtagtgaggaatctcgcgaggaaaaagaaggagattcttcgcttcgccctgaatgacaaattaatggttaattgtt
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: TF0541:TF0542|TF0541:TF0542:conserved hypothetical protein:hypothetical protein:->->:571919..572057 139
taaccataagctgcgaaggaaaggggcgggctccgtgtccgccccccctttgtcattccgaacgtagtgaggaatctcgcgaggaaaaagaaggagattcttcgcttcgccctgaatgacaaattaatggttaattgtt
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: TF0541:TF0542|TF0541:TF0542:conserved hypothetical protein:hypothetical protein:->->:571919..572057 139
taaccataagctgcgaaggaaaggggcgggctccgtgtccgccccccctttgtcattccgaacgtagtgaggaatctcgcgaggaaaaagaaggagattcttcgcttcgccctgaatgacaaattaatggttaattgtt
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

taaccataagctgcgaaggaaaggggcgggctccgtgtccgccccccctttgtcattccgaacgtagtgaggaatctcgcgaggaaaaagaaggagattcttcgcttcgccctgaatgacaaattaatggttaattgtt
Predict ORF larger than 30AA ================================================
Protein_Len: 37	Strand: +	Start: 6	End: 116
..... M  S  C  E  G  K  G  R  A  P  C  P  P  P  L  C  H  S  E  R  S  E  E  S  R  E  E  K  E  G  D  S  S  L  R  P  E .......................
Protein_Len: 42	Strand: -	Start: 3	End: 128
.. G  Y  A  A  F  S  L  P  P  S  R  T  R  G  G  K  T  M  G  F  T  T  L  F  R  A  L  F  F  F  S  I  R  R  K  A  R  F  S  L  N  M ...........
Protein_Len: 39	Strand: -	Start: 1	End: 117
 L  W  L  S  R  L  F  P  A  P  E  T  D  A  G  G  K  D  N  R  V  Y  H  P  I  E  R  P  F  L  L  L  N  K  A  E  G  Q  M ......................

taaccataagctgcgaaggaaaggggcgggctccgtgtccgccccccctttgtcattccgaacgtagtgaggaatctcgcgaggaaaaagaaggagattcttcgcttcgccctgaatgacaaattaatggttaattgtt
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

taaccataagctgcgaaggaaaggggcgggctccgtgtccgccccccctttgtcattccgaacgtagtgaggaatctcgcgaggaaaaagaaggagattcttcgcttcgccctgaatgacaaattaatggttaattgtt
Predict TransTerm conf > 70================================================
TransTerm Strand: -	Conf: 85	HP_score: -11.9	Tail_Score: -3.90856	Start: 23	End: 45	Full_Region: cggaatgacaaaggg ggggcggac acgga gcccgcccc tttccttcgcagctt
......................ggggcggacacggagcccgcccc..............................................................................................

Find igs database================================================
Query_seq: TF0541:TF0542|TF0541:TF0542:conserved hypothetical protein:hypothetical protein:->->:571919..572057 139
taaccataagctgcgaaggaaaggggcgggctccgtgtccgccccccctttgtcattccgaacgtagtgaggaatctcgcgaggaaaaagaaggagattcttcgcttcgccctgaatgacaaattaatggttaattgtt
Intra-Species Hit: Count: 1	Min: 1	Max: 139	Len: 139
Subject: tfor_TF0541_TF0542|conserved hypothetical protein:hypothetical protein|POSITIVE:POSITIVE|[571919,572057]|139
HSP  1	e-value: 6.0E-61	bit: 234.0	Len: 139	Query Start:1	Query End:139	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 139
taaccataagctgcgaaggaaaggggcgggctccgtgtccgnnnnnnntttgtcattccgaacgtagtgaggaatctcgcgaggaaaaagaaggagattcttcgcttcgccctgaatgacaaattaatggttaattgtt
taaccataagctgcgaaggaaaggggcgggctccgtgtccgccccccctttgtcattccgaacgtagtgaggaatctcgcgaggaaaaagaaggagattcttcgcttcgccctgaatgacaaattaatggttaattgtt

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UAACCAUAAGCUGCGAAGGAAAGGGGCGGGCUCCGUGUCCGCCCCCCCUUUGUCAUUCCGAACGUAGUGAGGAAUCUCGCGAGGAAAAAGAAGGAGAUUCUUCGCUUCGCCCUGAAUGACAAAUUAAUGGUUAAUUGUU
(((((((.......(((((...(((((((((.....))))))))).)))))(((((((.(..((.(((((((((((((.(............)))))))))))))).))..).)))))))......)))))))...... (-61.40)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
AACAAUUAACCAUUAAUUUGUCAUUCAGGGCGAAGCGAAGAAUCUCCUUCUUUUUCCUCGCGAGAUUCCUCACUACGUUCGGAAUGACAAAGGGGGGGCGGACACGGAGCCCGCCCCUUUCCUUCGCAGCUUAUGGUUA
......(((((((...((((((((((.(((((.((.((.((((((((............).))))))).)).)).))))).))))))))))((((((((((.(.....).))))))))..))..........))))))) (-53.10)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
806	120	71	165	117	tfor:TF0017|5end_hypothetical_protein_10504..10734_POSITIVE
757	100	51	174	124	tfor:TF1579|5end_hypothetical_protein_1686889..1687119_POSITIVE
755	120	71	89	39	tfor:TF2994|5end_hypothetical_protein_3210605..3210835_POSITIVE
755	80	32	189	144	tfor:TF2922|5end_surface_antigen_BspA_3119122..3119352_POSITIVE
733	110	61	117	68	tfor:TF2653|5end_hypothetical_protein_2822093..2822323_POSITIVE
731	120	71	171	122	tfor:TF2668|5end_hypothetical_protein_2842471..2842701_POSITIVE
731	120	71	95	46	tfor:TF2667|5end_hypothetical_protein_2842395..2842625_POSITIVE
714	90	41	224	169	tfor:TF1593|5end_hypothetical_protein_1708859..1709089_POSITIVE
705	100	51	214	160	tfor:TF1583|5end_conserved_hypothetical_protein;_possible_endonuclease_1689445..1689675_POSITIVE
701	88	41	231	184	tfor:TF1591|5end_surface_antigen_BspA_1706387..1706617_POSITIVE
693	120	71	99	49	tfor:TF0470|5end_hypothetical_protein_487253..487483_POSITIVE
681	120	71	208	159	tfor:TF2669|5end_possible_Fe-S_oxidoreductase_2842971..2843201_POSITIVE
681	120	71	171	122	tfor:TF2665|5end_hypothetical_protein_2841973..2842203_POSITIVE
638	100	51	156	102	tfor:TF1585|5end_hypothetical_protein_1690369..1690599_POSITIVE
638	100	51	156	102	tfor:TF1584|5end_hypothetical_protein_1690245..1690475_POSITIVE
638	100	51	156	102	tfor:TF1582|5end_hypothetical_protein_1690121..1690351_POSITIVE
589	97	51	67	17	tfor:TF1581|5end_hypothetical_protein_1689199..1689429_POSITIVE
577	124	83	45	4	tfor:TF0018|5end_hypothetical_protein_11250..11480_POSITIVE
567	50	1	210	160	tfor:TF0538|5end_hypothetical_protein_566891..567121_POSITIVE
567	50	1	203	153	tfor:TF0539|5end_hypothetical_protein_566884..567114_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
761	100	51	89	35	tfor:TF1582|3end_hypothetical_protein_1690506..1690656_POSITIVE
733	110	61	66	17	tfor:TF2652|3end_hypothetical_protein_2822122..2822272_POSITIVE
729	100	51	142	94	tfor:TF0016|3end_hypothetical_protein_10581..10731_POSITIVE
715	99	51	151	102	tfor:TF2350|3end_hypothetical_protein_2515364..2515514_POSITIVE
694	110	61	53	5	tfor:TF2997|3end_hypothetical_protein_3211664..3211814_POSITIVE
682	86	45	150	111	tfor:TF2173|3end_hypothetical_protein_2346063..2346213_POSITIVE
682	86	45	150	111	tfor:TF0346|3end_hypothetical_protein_367316..367466_POSITIVE
670	85	41	55	1	tfor:TF2913|3end_conserved_hypothetical_protein_3109117..3109267_POSITIVE
663	86	46	57	17	tfor:TF2640|3end_hypothetical_protein_2809533..2809683_POSITIVE
652	110	61	146	96	tfor:TF0017|3end_hypothetical_protein_11231..11381_POSITIVE
644	86	47	150	111	tfor:TF2166|3end_hypothetical_protein_2342362..2342512_POSITIVE
643	86	45	150	111	tfor:TF0366|3end_hypothetical_protein_383811..383961_POSITIVE
643	86	45	150	111	tfor:TF0362|3end_hypothetical_protein_380199..380349_POSITIVE
624	120	71	74	20	tfor:TF1583|3end_conserved_hypothetical_protein;_possible_endonuclease_1690223..1690373_POSITIVE
613	70	22	151	96	tfor:TF1584|3end_hypothetical_protein_1690603..1690753_POSITIVE
612	95	51	151	102	tfor:TF1581|3end_hypothetical_protein_1689467..1689617_POSITIVE
579	130	83	52	2	tfor:TF1578|3end_hypothetical_protein_1686416..1686566_POSITIVE
567	50	1	75	25	tfor:TF0537|3end_conserved_hypothetical_protein_566836..566986_POSITIVE
543	128	83	84	44	tfor:TF2639|3end_hypothetical_protein_2809333..2809483_POSITIVE
512	55	12	79	36	tfor:TF0541|3end_conserved_hypothetical_protein_571858..572008_POSITIVE