Origin IGS:
tagacgcggatggggggtggttcagcagcggaattttgggggaagcggccggtaaggcttgactgcaaacggcggtgaagaatcctatccacaagatccacagcaaaacgcgagttgtgttctttttcattggtttgtcggtcgggctgttggcacttttttttaaaattaaacatatttaaacgttta
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
taaacgtttaaatatgtttaattttaaaaaaaagtgccaacagcccgaccgacaaaccaatgaaaaagaacacaactcgcgttttgctgtggatcttgtggataggattcttcaccgccgtttgcagtcaagccttaccggccgcttcccccaaaattccgctgctgaaccaccccccatccgcgtcta

Mask Tandem Repeat Region ================================================
tagacgcggatggggggtggttcagcagcggaattttgggggaagcggccggtaaggcttgactgcaaacggcggtgaagaatcctatccacaagatccacagcaaaacgcgagttgtgttctttttcattggtttgtcggtcgggctgttggcacttttttttaaaattaaacatatttaaacgttta

Find is-nt database================================================
Query_seq: TF2366:TF2367|TF2366:TF2367:conserved hypothetical protein:delta-1-pyrroline-5-carboxylate dehydrogenase:->->:2531953..2532141 189
tagacgcggatggggggtggttcagcagcggaattttgggggaagcggccggtaaggcttgactgcaaacggcggtgaagaatcctatccacaagatccacagcaaaacgcgagttgtgttctttttcattggtttgtcggtcgggctgttggcacttttttttaaaattaaacatatttaaacgttta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: TF2366:TF2367|TF2366:TF2367:conserved hypothetical protein:delta-1-pyrroline-5-carboxylate dehydrogenase:->->:2531953..2532141 189
tagacgcggatggggggtggttcagcagcggaattttgggggaagcggccggtaaggcttgactgcaaacggcggtgaagaatcctatccacaagatccacagcaaaacgcgagttgtgttctttttcattggtttgtcggtcgggctgttggcacttttttttaaaattaaacatatttaaacgttta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: TF2366:TF2367|TF2366:TF2367:conserved hypothetical protein:delta-1-pyrroline-5-carboxylate dehydrogenase:->->:2531953..2532141 189
tagacgcggatggggggtggttcagcagcggaattttgggggaagcggccggtaaggcttgactgcaaacggcggtgaagaatcctatccacaagatccacagcaaaacgcgagttgtgttctttttcattggtttgtcggtcgggctgttggcacttttttttaaaattaaacatatttaaacgttta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

tagacgcggatggggggtggttcagcagcggaattttgggggaagcggccggtaaggcttgactgcaaacggcggtgaagaatcctatccacaagatccacagcaaaacgcgagttgtgttctttttcattggtttgtcggtcgggctgttggcacttttttttaaaattaaacatatttaaacgttta
Predict ORF larger than 30AA ================================================
Protein_Len: 35	Strand: +	Start: 59	End: 163
.......................................................... M  T  A  N  G  G  E  E  S  Y  P  Q  D  P  Q  Q  N  A  S  C  V  L  F  H  W  F  V  G  R  A  V  G  T  F  F ..........................
Protein_Len: 39	Strand: +	Start: 63	End: 179
.............................................................. M  Q  T  A  V  K  N  P  I  H  K  I  H  S  K  T  R  V  V  F  F  F  I  G  L  S  V  G  L  L  A  L  F  F  K  I  K  H  I ..........
Protein_Len: 36	Strand: +	Start: 82	End: 189
................................................................................. M  L  S  T  R  S  T  A  K  R  E  L  C  S  F  S  L  V  C  R  S  G  C  W  H  F  F  L  K  L  N  I  F  K  R  L 
Protein_Len: 58	Strand: -	Start: 3	End: 176
.. V  R  I  P  P  P  E  A  A  S  N  Q  P  F  R  G  T  L  S  S  Q  L  R  R  H  L  I  R  D  V  L  D  V  A  F  R  S  N  H  E  K  E  N  T  Q  R  D  P  Q  Q  C  K  K  K  F  N  F  M .............
Protein_Len: 59	Strand: -	Start: 2	End: 178
. S  A  S  P  P  H  N  L  L  P  I  K  P  S  A  A  P  L  A  Q  S  C  V  A  T  F  F  G  I  W  L  I  W  L  L  V  R  T  T  N  K  K  M  P  K  D  T  P  S  N  A  S  K  K  L  I  L  C  M ...........

tagacgcggatggggggtggttcagcagcggaattttgggggaagcggccggtaaggcttgactgcaaacggcggtgaagaatcctatccacaagatccacagcaaaacgcgagttgtgttctttttcattggtttgtcggtcgggctgttggcacttttttttaaaattaaacatatttaaacgttta
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

tagacgcggatggggggtggttcagcagcggaattttgggggaagcggccggtaaggcttgactgcaaacggcggtgaagaatcctatccacaagatccacagcaaaacgcgagttgtgttctttttcattggtttgtcggtcgggctgttggcacttttttttaaaattaaacatatttaaacgttta
Predict TransTerm conf > 70================================================

Find igs database================================================
Query_seq: TF2366:TF2367|TF2366:TF2367:conserved hypothetical protein:delta-1-pyrroline-5-carboxylate dehydrogenase:->->:2531953..2532141 189
tagacgcggatggggggtggttcagcagcggaattttgggggaagcggccggtaaggcttgactgcaaacggcggtgaagaatcctatccacaagatccacagcaaaacgcgagttgtgttctttttcattggtttgtcggtcgggctgttggcacttttttttaaaattaaacatatttaaacgttta
Intra-Species Hit: Count: 1	Min: 1	Max: 189	Len: 189
Subject: tfor_TF2366_TF2367|conserved hypothetical protein:delta-1-pyrroline-5-carboxylate dehydrogenase|POSITIVE:POSITIVE|[2531953,2532141]|189
HSP  1	e-value: 8.0E-89	bit: 327.0	Len: 189	Query Start:1	Query End:189	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 189
tagacgcggatggggggtggttcagcagcggaattttgggggaagcggccggtaaggcttgactgcaaacggcggtgaagaatcctatccacaagatccacagcaaaacgcgagttgtgttctttttcattggtttgtcggtcgggctgttggcacnnnnnnnnaaaattaaacatatttaaacgttta
tagacgcggatggggggtggttcagcagcggaattttgggggaagcggccggtaaggcttgactgcaaacggcggtgaagaatcctatccacaagatccacagcaaaacgcgagttgtgttctttttcattggtttgtcggtcgggctgttggcacttttttttaaaattaaacatatttaaacgttta

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UAGACGCGGAUGGGGGGUGGUUCAGCAGCGGAAUUUUGGGGGAAGCGGCCGGUAAGGCUUGACUGCAAACGGCGGUGAAGAAUCCUAUCCACAAGAUCCACAGCAAAACGCGAGUUGUGUUCUUUUUCAUUGGUUUGUCGGUCGGGCUGUUGGCACUUUUUUUUAAAAUUAAACAUAUUUAAACGUUUA
....(((...((((......))))...))).((((((((((((((..(((((...(((((((((((((((..((((((((((....(((.....)))....((((.(((....))).)))).))))))))))))))).)))))))))).)))))..))))))))))))))................... (-52.50)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UAAACGUUUAAAUAUGUUUAAUUUUAAAAAAAAGUGCCAACAGCCCGACCGACAAACCAAUGAAAAAGAACACAACUCGCGUUUUGCUGUGGAUCUUGUGGAUAGGAUUCUUCACCGCCGUUUGCAGUCAAGCCUUACCGGCCGCUUCCCCCAAAAUUCCGCUGCUGAACCACCCCCCAUCCGCGUCUA
(((((((......)))))))...........(((..(((.((((..((((((........................))).)))..)))))))..)))((((((.((...(((.((.((.....)).)).)))......((((.((...............)).))))........)).))))))..... (-34.92)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
485	50	6	196	154	tfor:TF0712|5end_TPR-repeat-containing_protein_761348..761578_POSITIVE
439	60	11	134	92	tfor:TF2017|5end_conserved_hypothetical_protein_2173504..2173734_POSITIVE
437	149	110	51	10	tfor:TF2261|5end_transfer_region-related_protein,_TraM_2430496..2430726_POSITIVE
436	59	12	79	20	tfor:TF2640|5end_hypothetical_protein_2809106..2809336_POSITIVE
433	49	1	173	111	tfor:TF2410|5end_possible_endo-1,4-beta-xylanase_2584000..2584230_POSITIVE
433	80	32	150	103	tfor:TF1312|5end_hypothetical_protein_1388465..1388695_POSITIVE
433	80	32	150	103	tfor:TF1311|5end_hypothetical_protein_1388242..1388472_POSITIVE
433	80	32	150	103	tfor:TF1310|5end_hypothetical_protein_1388019..1388249_POSITIVE
421	52	11	215	175	tfor:TF0745|5end_conserved_hypothetical_protein_790653..790883_POSITIVE
409	77	33	74	27	tfor:TF1822|5end_outer_membrane_lipoprotein_silC_precursor_1967599..1967829_POSITIVE
409	59	11	150	81	tfor:TF1274|5end_hypothetical_protein_1357621..1357851_POSITIVE
408	50	3	79	29	tfor:TF2911|5end_hypothetical_protein_3105871..3106101_POSITIVE
406	67	28	177	130	tfor:TF0529|5end_transposase_554776..555006_POSITIVE
401	50	3	102	29	tfor:TF2273|5end_conserved_hypothetical_protein_2436398..2436628_POSITIVE
401	51	11	148	107	tfor:TF0085|5end_ABC_transporter,_ATP-binding_protein_91517..91747_POSITIVE
399	81	43	225	182	tfor:TF2083|5end_conserved_hypothetical_protein_2250834..2251064_POSITIVE
397	58	13	87	28	tfor:TF0697|5end_glycerol-3-phosphate_cytidyltransferase_740667..740897_POSITIVE
395	59	13	203	132	tfor:TF2631|5end_conserved_hypothetical_protein_2801694..2801924_POSITIVE
395	77	35	216	171	tfor:TF1268|5end_conserved_hypothetical_protein_1354085..1354315_POSITIVE
393	50	2	160	99	tfor:TF1084|5end_transposase_1153310..1153540_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
454	43	6	147	111	tfor:TF0710|3end_two_component_system_histidine_kinase_761385..761535_POSITIVE
437	149	110	67	26	tfor:TF2260|3end_transfer_region-related_protein,_TraL_2430592..2430742_POSITIVE
433	80	32	51	4	tfor:TF1311|3end_hypothetical_protein_1388558..1388708_POSITIVE
433	80	32	51	4	tfor:TF1310|3end_hypothetical_protein_1388335..1388485_POSITIVE
431	58	11	149	104	tfor:TF0815|3end_conserved_hypothetical_protein_873974..874124_POSITIVE
429	70	23	48	10	tfor:TF2016|3end_hypothetical_protein_2173492..2173642_POSITIVE
408	50	3	84	34	tfor:TF2909|3end_GTP-binding_protein,_possible_GTP1/OBG_family_3105956..3106106_POSITIVE
406	67	28	100	53	tfor:TF0528|3end_two-component_system_sensor_histidine_kinase_554779..554929_POSITIVE
405	58	11	146	78	tfor:TF1167|3end_hypothetical_protein_1248932..1249082_POSITIVE
403	59	12	61	5	tfor:TF2922|3end_surface_antigen_BspA_3121538..3121688_POSITIVE
401	50	3	138	65	tfor:TF2272|3end_conserved_hypothetical_protein_2436514..2436664_POSITIVE
401	51	11	148	107	tfor:TF0084|3end_possible_membrane-fusion_protein_91597..91747_POSITIVE
400	75	37	42	2	tfor:TF1474|3end_6-phosphogluconolactonase_1568123..1568273_POSITIVE
399	58	13	99	30	tfor:TF2342|3end_glutathione_peroxidase_2506639..2506789_POSITIVE
397	58	13	81	22	tfor:TF0696|3end_3-oxoacyl-(acyl-carrier-protein)_reductase_740741..740891_POSITIVE
394	43	4	79	41	tfor:TF2092|3end_ribonuclease_III_2261823..2261973_POSITIVE
391	50	2	53	17	tfor:TF3113|3end_hypothetical_protein_3349706..3349856_POSITIVE
385	59	12	135	75	tfor:TF0759|3end_heat_shock_protein_15,_RNA-binding_domain_S4_806366..806516_POSITIVE
381	66	21	74	8	tfor:TF0993|3end_hypothetical_protein_1048782..1048932_POSITIVE
380	59	12	149	99	tfor:TF1312|3end_hypothetical_protein_1388781..1388931_POSITIVE