Origin IGS:
cgcggaaaccgtttacgtgtacaaaggtaggaaattgccaatagcttctttacgaaaaatgccggaaaagttttcaacaaatctgcgatcaatgtattgatgcagtctttaacgattttaagattttcctcgcgcctcgcaggcgggcgcaaggaaattttgggaagaggtgtta
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
taacacctcttcccaaaatttccttgcgcccgcctgcgaggcgcgaggaaaatcttaaaatcgttaaagactgcatcaatacattgatcgcagatttgttgaaaacttttccggcatttttcgtaaagaagctattggcaatttcctacctttgtacacgtaaacggtttccgcg

Mask Tandem Repeat Region ================================================
cgcggaaaccgtttacgtgtacaaaggtaggaaattgccaatagcttctttacgaaaaatgccggaaaagttttcaacaaatctgcgatcaatgtattgatgcagtctttaacgattttaagattttcctcgcgcctcgcaggcgggcgcaaggaaattttgggaagaggtgtta

Find is-nt database================================================
Query_seq: TF2038:TF2039|TF2038:TF2039:hypothetical protein:possible cell-cycle regulation histidine triad (HIT) protein:->->:2199283..2199457 175
cgcggaaaccgtttacgtgtacaaaggtaggaaattgccaatagcttctttacgaaaaatgccggaaaagttttcaacaaatctgcgatcaatgtattgatgcagtctttaacgattttaagattttcctcgcgcctcgcaggcgggcgcaaggaaattttgggaagaggtgtta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: TF2038:TF2039|TF2038:TF2039:hypothetical protein:possible cell-cycle regulation histidine triad (HIT) protein:->->:2199283..2199457 175
cgcggaaaccgtttacgtgtacaaaggtaggaaattgccaatagcttctttacgaaaaatgccggaaaagttttcaacaaatctgcgatcaatgtattgatgcagtctttaacgattttaagattttcctcgcgcctcgcaggcgggcgcaaggaaattttgggaagaggtgtta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: TF2038:TF2039|TF2038:TF2039:hypothetical protein:possible cell-cycle regulation histidine triad (HIT) protein:->->:2199283..2199457 175
cgcggaaaccgtttacgtgtacaaaggtaggaaattgccaatagcttctttacgaaaaatgccggaaaagttttcaacaaatctgcgatcaatgtattgatgcagtctttaacgattttaagattttcctcgcgcctcgcaggcgggcgcaaggaaattttgggaagaggtgtta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

cgcggaaaccgtttacgtgtacaaaggtaggaaattgccaatagcttctttacgaaaaatgccggaaaagttttcaacaaatctgcgatcaatgtattgatgcagtctttaacgattttaagattttcctcgcgcctcgcaggcgggcgcaaggaaattttgggaagaggtgtta
Predict ORF larger than 30AA ================================================
Protein_Len: 31	Strand: +	Start: 81	End: 173
................................................................................ M  C  D  Q  C  I  D  A  V  F  N  D  F  K  I  F  L  A  P  R  R  R  A  Q  G  N  F  G  K  R  C ..
Protein_Len: 47	Strand: +	Start: 34	End: 174
................................. M  A  N  S  F  F  T  K  N  A  G  K  V  F  N  K  S  A  I  N  V  L  M  Q  S  L  T  I  L  R  F  S  S  R  L  A  G  G  R  K  E  I  L  G  R  G  V .
Protein_Len: 30	Strand: -	Start: 16	End: 105
............... T  Y  L  P  L  F  N  G  I  A  E  K  R  F  I  G  S  F  N  E  V  F  R  R  D  I  Y  Q  H  M ......................................................................
Protein_Len: 52	Strand: -	Start: 3	End: 158
.. P  F  R  K  R  T  C  L  Y  S  I  A  L  L  K  K  V  F  F  A  P  F  T  K  L  L  D  A  I  L  T  N  I  C  D  K  V  I  K  L  N  E  E  R  R  A  P  P  R  L  S  M .................

cgcggaaaccgtttacgtgtacaaaggtaggaaattgccaatagcttctttacgaaaaatgccggaaaagttttcaacaaatctgcgatcaatgtattgatgcagtctttaacgattttaagattttcctcgcgcctcgcaggcgggcgcaaggaaattttgggaagaggtgtta
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

cgcggaaaccgtttacgtgtacaaaggtaggaaattgccaatagcttctttacgaaaaatgccggaaaagttttcaacaaatctgcgatcaatgtattgatgcagtctttaacgattttaagattttcctcgcgcctcgcaggcgggcgcaaggaaattttgggaagaggtgtta
Predict TransTerm conf > 70================================================
TransTerm Strand: +	Conf: 100	HP_score: -12.8	Tail_Score: -4.07885	Start: 125	End: 157	Full_Region: TAACGATTTTAAGAT TTTCCTCGCGCCTCG CAGG CGGGCGCAAGGAAA TTTTGGGAAGAGGTG
............................................................................................................................TTTCCTCGCGCCTCGCAGGCGGGCGCAAGGAAA..................

Find igs database================================================
Query_seq: TF2038:TF2039|TF2038:TF2039:hypothetical protein:possible cell-cycle regulation histidine triad (HIT) protein:->->:2199283..2199457 175
cgcggaaaccgtttacgtgtacaaaggtaggaaattgccaatagcttctttacgaaaaatgccggaaaagttttcaacaaatctgcgatcaatgtattgatgcagtctttaacgattttaagattttcctcgcgcctcgcaggcgggcgcaaggaaattttgggaagaggtgtta
Intra-Species Hit: Count: 1	Min: 1	Max: 175	Len: 175
Subject: tfor_TF2038_TF2039|hypothetical protein:possible cell-cycle regulation histidine triad (HIT) protein|POSITIVE:POSITIVE|[2199283,2199457]|175
HSP  1	e-value: 8.0E-95	bit: 347.0	Len: 175	Query Start:1	Query End:175	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 175
cgcggaaaccgtttacgtgtacaaaggtaggaaattgccaatagcttctttacgaaaaatgccggaaaagttttcaacaaatctgcgatcaatgtattgatgcagtctttaacgattttaagattttcctcgcgcctcgcaggcgggcgcaaggaaattttgggaagaggtgtta
cgcggaaaccgtttacgtgtacaaaggtaggaaattgccaatagcttctttacgaaaaatgccggaaaagttttcaacaaatctgcgatcaatgtattgatgcagtctttaacgattttaagattttcctcgcgcctcgcaggcgggcgcaaggaaattttgggaagaggtgtta

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
CGCGGAAACCGUUUACGUGUACAAAGGUAGGAAAUUGCCAAUAGCUUCUUUACGAAAAAUGCCGGAAAAGUUUUCAACAAAUCUGCGAUCAAUGUAUUGAUGCAGUCUUUAACGAUUUUAAGAUUUUCCUCGCGCCUCGCAGGCGGGCGCAAGGAAAUUUUGGGAAGAGGUGUUA
((((...........))))......(((((....)))))....(((((((..(((((.....((..((((............((((.(((((....))))))))).))))..))..........((((((.(((((.((....))))))).)))))))))))..))))))).... (-49.22)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UAACACCUCUUCCCAAAAUUUCCUUGCGCCCGCCUGCGAGGCGCGAGGAAAAUCUUAAAAUCGUUAAAGACUGCAUCAAUACAUUGAUCGCAGAUUUGUUGAAAACUUUUCCGGCAUUUUUCGUAAAGAAGCUAUUGGCAAUUUCCUACCUUUGUACACGUAAACGGUUUCCGCG
..................((((((((((((((....)).))))))))))))......((((((((.....(((((((((....))))).))))..((((..(...(((((...((.......))..)))))...)..)))).....................))))))))..... (-45.20)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
436	170	121	82	35	tfor:TF1931|5end_ATPase/GTPase_2078123..2078353_POSITIVE
421	154	122	132	93	tfor:TF2912|5end_hypothetical_protein_3106508..3106738_POSITIVE
420	170	129	58	3	tfor:TF0349|5end_hypothetical_protein_370367..370597_POSITIVE
414	165	128	79	26	tfor:TF2165|5end_hypothetical_protein_2341654..2341884_POSITIVE
409	165	132	228	180	tfor:TF2177|5end_hypothetical_protein_2349281..2349511_POSITIVE
389	168	126	216	156	tfor:TF0344|5end_hypothetical_protein_366722..366952_POSITIVE
387	163	132	230	184	tfor:TF0369|5end_hypothetical_protein_385933..386163_POSITIVE
379	168	125	147	79	tfor:TF1814|5end_conserved_hypothetical_protein;_possible_biotin_synthase_related_domain_containing_protein_1955325..1955555_POSITIVE
374	169	127	157	114	tfor:TF2664|5end_hypothetical_protein_2841399..2841629_POSITIVE
371	170	124	209	151	tfor:TF3087|5end_conserved_hypothetical_protein_3319878..3320108_POSITIVE
366	170	122	114	58	tfor:TF2108|5end_hypothetical_protein_2277385..2277615_POSITIVE
366	150	103	198	137	tfor:TF0449|5end_transposase_467891..468121_POSITIVE
364	170	132	206	156	tfor:TF1638|5end_conserved_hypothetical_protein_1747359..1747589_POSITIVE
363	150	101	161	112	tfor:TF1948|5end_conserved_hypothetical_protein_2095942..2096172_POSITIVE
361	170	131	101	57	tfor:TF2643|5end_possible_O-antigen_transporter_2811744..2811974_POSITIVE
361	154	112	224	180	tfor:TF1409|5end_outer_membrane_protein_TolC_1485479..1485709_POSITIVE
356	164	122	109	49	tfor:TF2996|5end_hypothetical_protein_3210802..3211032_POSITIVE
356	170	131	85	41	tfor:TF0433|5end_60_kDa_inner_membrane_protein_453357..453587_POSITIVE
355	151	112	73	21	tfor:TF1780|5end_formiminotransferase-cyclodeaminases_1921114..1921344_POSITIVE
354	170	123	190	134	tfor:TF2915|5end_hypothetical_protein_3110422..3110652_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
436	170	121	82	35	tfor:TF1930|3end_two-component_response_regulator_2078203..2078353_POSITIVE
420	170	129	58	3	tfor:TF0348|3end_hypothetical_protein_370447..370597_POSITIVE
417	170	132	57	4	tfor:TF2170|3end_hypothetical_protein_2345070..2345220_POSITIVE
416	170	132	57	4	tfor:TF2176|3end_hypothetical_protein_2349185..2349335_POSITIVE
416	170	132	58	5	tfor:TF0368|3end_hypothetical_protein_385834..385984_POSITIVE
409	165	132	53	5	tfor:TF2164|3end_hypothetical_protein_2341708..2341858_POSITIVE
387	168	132	57	3	tfor:TF0342|3end_hypothetical_protein_366643..366793_POSITIVE
366	170	122	85	29	tfor:TF2107|3end_hypothetical_protein_2277436..2277586_POSITIVE
366	169	131	145	98	tfor:TF0998|3end_[acyl-carrier-protein]_S-malonyltransferase_1052977..1053127_POSITIVE
366	150	103	138	77	tfor:TF0448|3end_hypothetical_protein_467911..468061_POSITIVE
361	170	131	104	60	tfor:TF2642|3end_acetylornithine_deacetylase_2811827..2811977_POSITIVE
356	164	122	76	16	tfor:TF2994|3end_hypothetical_protein_3210849..3210999_POSITIVE
348	149	118	47	11	tfor:TF3126|3end_glycosyltransferase,_group_2_family_3361685..3361835_POSITIVE
348	170	128	126	73	tfor:TF1730|3end_diaminopimelate_decarboxylase_1855907..1856057_POSITIVE
345	170	122	81	35	tfor:TF0583|3end_possible_gliding_motility-related_protein_613829..613979_POSITIVE
340	170	126	58	1	tfor:TF0365|3end_hypothetical_protein_383152..383302_POSITIVE
339	170	124	143	98	tfor:TF0710|3end_two_component_system_histidine_kinase_761385..761535_POSITIVE
335	170	131	136	101	tfor:TF1846|3end_hypothetical_protein_1997015..1997165_POSITIVE
335	170	131	126	91	tfor:TF1845|3end_hypothetical_protein_1997005..1997155_POSITIVE
333	170	124	84	43	tfor:TF1841|3end_hypothetical_protein_1992267..1992417_POSITIVE