Origin IGS:
ttttcttctttttatatggttaatacatgattataaattccaccgcagaccaccgtagattttccgcccatacacaggtccccagaccatggttgcatcgaaatcgtctctccacggatcggatgaggcaacgatcgggtgcggttgcgtgaagtcaaacaggttttccacccccacatacaacggacagcttcttaaaccgcttcgtgatctgcgcgccgacgagcgtataagcatcgtaggttttctcccacaatgggttttttgcatcgggaatcggtaacgtgccgggcccgttgaactgcgccgtcgcatcgaactgccaccggtaaacgggcgtccgatatccgagcgtaatcagtcgctaccgtacgcgactgcaacagatgcaacgtcgcacccgccgctttgtcagcaccctcaaaaagcaccgtacctttcacggtaaattgggccatatatcccactactcgtgatcagcgcacagaaagtacatatatgcctgaaaaacatatcaaattattatttcaatgatgt
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
acatcattgaaataataatttgatatgtttttcaggcatatatgtactttctgtgcgctgatcacgagtagtgggatatatggcccaatttaccgtgaaaggtacggtgctttttgagggtgctgacaaagcggcgggtgcgacgttgcatctgttgcagtcgcgtacggtagcgactgattacgctcggatatcggacgcccgtttaccggtggcagttcgatgcgacggcgcagttcaacgggcccggcacgttaccgattcccgatgcaaaaaacccattgtgggagaaaacctacgatgcttatacgctcgtcggcgcgcagatcacgaagcggtttaagaagctgtccgttgtatgtgggggtggaaaacctgtttgacttcacgcaaccgcacccgatcgttgcctcatccgatccgtggagagacgatttcgatgcaaccatggtctggggacctgtgtatgggcggaaaatctacggtggtctgcggtggaatttataatcatgtattaaccatataaaaagaagaaaa

Mask Tandem Repeat Region ================================================
ttttcttctttttatatggttaatacatgattataaattccaccgcagaccaccgtagattttccgcccatacacaggtccccagaccatggttgcatcgaaatcgtctctccacggatcggatgaggcaacgatcgggtgcggttgcgtgaagtcaaacaggttttccacccccacatacaacggacagcttcttaaaccgcttcgtgatctgcgcgccgacgagcgtataagcatcgtaggttttctcccacaatgggttttttgcatcgggaatcggtaacgtgccgggcccgttgaactgcgccgtcgcatcgaactgccaccggtaaacgggcgtccgatatccgagcgtaatcagtcgctaccgtacgcgactgcaacagatgcaacgtcgcacccgccgctttgtcagcaccctcaaaaagcaccgtacctttcacggtaaattgggccatatatcccactactcgtgatcagcgcacagaaagtacatatatgcctgaaaaacatatcaaattattatttcaatgatgt

Find is-nt database================================================
Query_seq: TF1993:TF1994|TF1993:TF1994:hypothetical protein:acyl-CoA synthetase:->->:2144583..2145119 537
ttttcttctttttatatggttaatacatgattataaattccaccgcagaccaccgtagattttccgcccatacacaggtccccagaccatggttgcatcgaaatcgtctctccacggatcggatgaggcaacgatcgggtgcggttgcgtgaagtcaaacaggttttccacccccacatacaacggacagcttcttaaaccgcttcgtgatctgcgcgccgacgagcgtataagcatcgtaggttttctcccacaatgggttttttgcatcgggaatcggtaacgtgccgggcccgttgaactgcgccgtcgcatcgaactgccaccggtaaacgggcgtccgatatccgagcgtaatcagtcgctaccgtacgcgactgcaacagatgcaacgtcgcacccgccgctttgtcagcaccctcaaaaagcaccgtacctttcacggtaaattgggccatatatcccactactcgtgatcagcgcacagaaagtacatatatgcctgaaaaacatatcaaattattatttcaatgatgt
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: TF1993:TF1994|TF1993:TF1994:hypothetical protein:acyl-CoA synthetase:->->:2144583..2145119 537
ttttcttctttttatatggttaatacatgattataaattccaccgcagaccaccgtagattttccgcccatacacaggtccccagaccatggttgcatcgaaatcgtctctccacggatcggatgaggcaacgatcgggtgcggttgcgtgaagtcaaacaggttttccacccccacatacaacggacagcttcttaaaccgcttcgtgatctgcgcgccgacgagcgtataagcatcgtaggttttctcccacaatgggttttttgcatcgggaatcggtaacgtgccgggcccgttgaactgcgccgtcgcatcgaactgccaccggtaaacgggcgtccgatatccgagcgtaatcagtcgctaccgtacgcgactgcaacagatgcaacgtcgcacccgccgctttgtcagcaccctcaaaaagcaccgtacctttcacggtaaattgggccatatatcccactactcgtgatcagcgcacagaaagtacatatatgcctgaaaaacatatcaaattattatttcaatgatgt
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: TF1993:TF1994|TF1993:TF1994:hypothetical protein:acyl-CoA synthetase:->->:2144583..2145119 537
ttttcttctttttatatggttaatacatgattataaattccaccgcagaccaccgtagattttccgcccatacacaggtccccagaccatggttgcatcgaaatcgtctctccacggatcggatgaggcaacgatcgggtgcggttgcgtgaagtcaaacaggttttccacccccacatacaacggacagcttcttaaaccgcttcgtgatctgcgcgccgacgagcgtataagcatcgtaggttttctcccacaatgggttttttgcatcgggaatcggtaacgtgccgggcccgttgaactgcgccgtcgcatcgaactgccaccggtaaacgggcgtccgatatccgagcgtaatcagtcgctaccgtacgcgactgcaacagatgcaacgtcgcacccgccgctttgtcagcaccctcaaaaagcaccgtacctttcacggtaaattgggccatatatcccactactcgtgatcagcgcacagaaagtacatatatgcctgaaaaacatatcaaattattatttcaatgatgt
Intra-Species Hit: Count: 0

Inter-species Hit: Count: 8	Min: 34	Max: 361	Len: 328
Subject: UniRef90_Q8A8S4 Cluster: Hypothetical protein; n=1; Bacteroides thetaiotaomicron|Rep: Hypothetical protein - Bacteroides thetaiotaomicron
HSP  1	e-value: 1.0E-21	bit: 66.6	Len: 150	Query Start:34	Query End:183	Subject Strand: null	Subject Start: 314	Subject End: 363
................................. L  Y  V  G  V  E  N  L  F  D  F  T  Q  P  H  P  I  V  A  S  S  D  P  W  R  D  D  F  D  A  T  M  V  W  G  P  V  Y  G  R  K  I  Y  G  G  L  R  W  N  L ..................................................................................................................................................................................................................................................................................................................................................................
................................. V  Y  I  G  G  E  N  L  T  N  F  K  Q  K  N  P  I  I  D  A  A  N  P  W  G  G  N  F  D  S  T  M  I  W  G  P  V  H  G  A  K  A  Y  I  G  I  R  F  N  L ..................................................................................................................................................................................................................................................................................................................................................................
HSP  2	e-value: 1.0E-21	bit: 59.3	Len: 192	Query Start:170	Query End:361	Subject Strand: null	Subject Start: 252	Subject End: 318
......................................................................................................................................................................... L  I  T  L  G  Y  R  T  P  V  Y  R  W  Q  F  D  A  T  A  Q  F  N  G  P  G  T  L  P  I  P  D  -  -  A  K  N  P  L  -  W  E  K  T  Y  D  A  Y  T  L  V  G  A  Q  I  T  K  R  F  K  K  L  S  V  V  C  G  G ................................................................................................................................................................................
......................................................................................................................................................................... L  L  T  A  S  Y  Q  T  P  L  G  I  W  Q  F  D  A  T  L  Q  L  N  G  G  G  R  M  P  S  P  Y  E  L  A  D  G  Q  L  S  W  E  R  R  Y  G  S  F  E  Q  L  S  A  Q  I  T  R  Y  F  R  R  W  S  V  Y  I  G  G ................................................................................................................................................................................

Subject: UniRef90_Q64UQ2 Cluster: Putative TonB-dependent outer membrane receptor protein; n=2; Bacteroides fragilis|Rep: Putative TonB-dependent outer membrane receptor protein - Bacteroides fragilis
HSP  1	e-value: 2.0E-21	bit: 68.9	Len: 150	Query Start:34	Query End:183	Subject Strand: null	Subject Start: 686	Subject End: 735
................................. L  Y  V  G  V  E  N  L  F  D  F  T  Q  P  H  P  I  V  A  S  S  D  P  W  R  D  D  F  D  A  T  M  V  W  G  P  V  Y  G  R  K  I  Y  G  G  L  R  W  N  L ..................................................................................................................................................................................................................................................................................................................................................................
................................. I  Y  I  G  G  E  N  L  T  N  F  K  Q  K  N  P  I  I  D  A  A  D  P  W  G  D  R  F  D  S  T  M  I  W  G  P  V  H  G  A  K  G  Y  I  G  V  R  F  N  L ..................................................................................................................................................................................................................................................................................................................................................................
HSP  2	e-value: 2.0E-21	bit: 56.2	Len: 192	Query Start:170	Query End:361	Subject Strand: null	Subject Start: 624	Subject End: 690
......................................................................................................................................................................... L  I  T  L  G  Y  R  T  P  V  Y  R  W  Q  F  D  A  T  A  Q  F  N  G  P  G  T  L  P  I  P  D  A  -  -  -  K  N  P  L  W  E  K  T  Y  D  A  Y  T  L  V  G  A  Q  I  T  K  R  F  K  K  L  S  V  V  C  G  G ................................................................................................................................................................................
......................................................................................................................................................................... L  V  T  A  S  Y  Q  T  P  L  G  L  W  Q  F  D  A  T  W  Q  M  N  G  G  G  R  M  P  N  P  Y  T  L  A  D  G  T  S  S  W  D  A  R  Y  K  G  F  S  Q  L  S  A  Q  V  T  R  Y  F  R  R  W  S  I  Y  I  G  G ................................................................................................................................................................................

Subject: UniRef90_A2U429 Cluster: Putative TonB-dependent outer membrane receptor protein; n=1; Polaribacter dokdonensis MED152|Rep: Putative TonB-dependent outer membrane receptor protein - Polaribacter dokdonensis MED152
HSP  1	e-value: 3.0E-11	bit: 58.2	Len: 150	Query Start:34	Query End:183	Subject Strand: null	Subject Start: 697	Subject End: 746
................................. L  Y  V  G  V  E  N  L  F  D  F  T  Q  P  H  P  I  V  A  S  S  D  P  W  R  D  D  F  D  A  T  M  V  W  G  P  V  Y  G  R  K  I  Y  G  G  L  R  W  N  L ..................................................................................................................................................................................................................................................................................................................................................................
................................. V  Y  L  G  A  E  N  L  T  N  V  Q  Q  N  N  P  V  L  A  S  D  D  P  F  G  A  H  F  D  T  T  I  V  Y  A  P  I  F  G  R  S  V  Y  T  G  L  R  F  N  I ..................................................................................................................................................................................................................................................................................................................................................................
HSP  2	e-value: 3.0E-11	bit: 32.3	Len: 138	Query Start:191	Query End:328	Subject Strand: null	Subject Start: 646	Subject End: 693
.............................................................................................................................................................................................. R  W  Q  F  D  A  T  A  Q  F  N  G  P  G  T  L  P  I  P  D  A  K  N  P  L  W  E  K  T  -  -  Y  D  A  Y  T  L  V  G  A  Q  I  T  K  R  F  K  K .................................................................................................................................................................................................................
.............................................................................................................................................................................................. Q  W  K  F  D  V  T  F  N  N  I  G  K  Q  R  L  P  N  T  S  T  K  P  A  Q  Y  Q  L  S  D  M  V  D  A  Y  Q  L  L  N  A  Q  I  T  K  V  F  S  K .................................................................................................................................................................................................................

Subject: UniRef90_A4AU96 Cluster: Putative TonB-dependent outer membrane receptor protein; n=1; Flavobacteriales bacterium HTCC2170|Rep: Putative TonB-dependent outer membrane receptor protein - Flavobacteriales bacterium HTCC2170
HSP  1	e-value: 4.0E-10	bit: 57.8	Len: 150	Query Start:34	Query End:183	Subject Strand: null	Subject Start: 686	Subject End: 735
................................. L  Y  V  G  V  E  N  L  F  D  F  T  Q  P  H  P  I  V  A  S  S  D  P  W  R  D  D  F  D  A  T  M  V  W  G  P  V  Y  G  R  K  I  Y  G  G  L  R  W  N  L ..................................................................................................................................................................................................................................................................................................................................................................
................................. V  Y  I  G  G  E  N  L  S  N  F  T  Q  K  N  P  V  L  S  A  N  D  P  F  G  A  N  F  D  T  S  I  V  Y  A  P  I  M  G  R  M  F  Y  G  G  F  R  Y  K  L ..................................................................................................................................................................................................................................................................................................................................................................
HSP  2	e-value: 4.0E-10	bit: 28.9	Len: 165	Query Start:164	Query End:328	Subject Strand: null	Subject Start: 635	Subject End: 691
................................................................................................................................................................... R  W  Q  F  D  A  T  A  Q  F  N  G  P  G  T  L  P  -  -  I  P  D  A  K  N  P  L  W  E  K  T  Y  D  A  Y  T  L  V  G  A  Q  I  T  K  R  F  K  K  L  S  V  V  C  G  G  G  K .................................................................................................................................................................................................................
................................................................................................................................................................... Q  W  R  F  D  Y  T  L  H  A  L  G  E  Q  R  L  P  N  T  L  A  N  P  E  E  Y  R  L  A  E  Y  S  D  P  Y  S  L  M  N  A  Q  I  T  K  V  F  N  E  S  F  E  V  Y  I  G  G  E .................................................................................................................................................................................................................

Subject: UniRef90_A4BYB6 Cluster: Putative TonB-dependent outer membrane receptor protein; n=1; Polaribacter irgensii 23-P|Rep: Putative TonB-dependent outer membrane receptor protein - Polaribacter irgensii 23-P
HSP  1	e-value: 3.0E-8	bit: 53.1	Len: 150	Query Start:34	Query End:183	Subject Strand: null	Subject Start: 708	Subject End: 757
................................. L  Y  V  G  V  E  N  L  F  D  F  T  Q  P  H  P  I  V  A  S  S  D  P  W  R  D  D  F  D  A  T  M  V  W  G  P  V  Y  G  R  K  I  Y  G  G  L  R  W  N  L ..................................................................................................................................................................................................................................................................................................................................................................
................................. I  Y  F  G  G  E  N  I  T  N  V  Q  Q  E  N  P  I  L  A  S  E  A  P  F  G  P  N  F  D  T  T  I  V  Y  A  P  I  F  G  R  A  I  Y  A  G  L  R  F  K  I ..................................................................................................................................................................................................................................................................................................................................................................
HSP  2	e-value: 3.0E-8	bit: 27.3	Len: 171	Query Start:158	Query End:328	Subject Strand: null	Subject Start: 657	Subject End: 715
............................................................................................................................................................. R  W  Q  F  D  A  T  A  Q  F  N  G  P  G  T  L  P  I  P  D  -  A  K  N  P  L  W  E  K  T  Y  D  -  -  -  A  Y  T  L  V  G  A  Q  I  T  K  R  F  K  K  L  S  V  V  C  G  G  G  K  P  V .................................................................................................................................................................................................................
............................................................................................................................................................. Q  W  K  I  D  L  T  -  -  F  N  N  I  G  R  Q  R  L  P  N  T  A  S  N  P  I  A  Y  Q  L  A  T  H  S  K  S  Y  S  L  L  N  S  Q  I  T  K  V  F  S  N  T  F  E  I  Y  F  G  G  E  N  I .................................................................................................................................................................................................................

Subject: UniRef90_Q1XVN6 Cluster: TonB-dependent receptor precursor; n=1; Flavobacterium johnsoniae UW101|Rep: TonB-dependent receptor precursor - Flavobacterium johnsoniae UW101
HSP  1	e-value: 6.0E-8	bit: 46.2	Len: 150	Query Start:34	Query End:183	Subject Strand: null	Subject Start: 618	Subject End: 667
................................. L  Y  V  G  V  E  N  L  F  D  F  T  Q  P  H  P  I  V  A  S  S  D  P  W  R  D  D  F  D  A  T  M  V  W  G  P  V  Y  G  R  K  I  Y  G  G  L  R  W  N  L ..................................................................................................................................................................................................................................................................................................................................................................
................................. V  Y  A  G  G  E  N  I  G  N  Y  K  Q  Q  K  A  I  L  G  A  N  D  P  F  G  P  N  F  D  A  S  V  A  Y  A  P  I  F  G  Q  M  Y  Y  A  G  L  R  F  K  I ..................................................................................................................................................................................................................................................................................................................................................................
HSP  2	e-value: 6.0E-8	bit: 33.1	Len: 171	Query Start:158	Query End:328	Subject Strand: null	Subject Start: 567	Subject End: 625
............................................................................................................................................................. R  W  Q  F  D  A  T  A  Q  F  N  G  P  G  T  L  P  I  P  D  A  K  N  P  L  W  E  K  T  Y  D  -  -  -  A  Y  T  L  V  G  A  Q  I  T  K  R  F  K  K  L  S  V  V  C  G  G  G  K  P  V .................................................................................................................................................................................................................
............................................................................................................................................................. Q  W  K  F  D  Y  T  F  N  W  S  G  K  Q  Q  L  P  Y  T  -  A  S  N  P  A  E  D  Q  F  P  D  F  S  P  S  Y  A  V  M  N  A  Q  V  T  R  V  F  S  P  V  F  E  V  Y  A  G  G  E  N  I .................................................................................................................................................................................................................

Subject: UniRef90_A1ZRF1 Cluster: Putative TonB-dependent outer membrane receptor protein; n=1; Microscilla marina ATCC 23134|Rep: Putative TonB-dependent outer membrane receptor protein - Microscilla marina ATCC 23134
HSP  1	e-value: 1.0E-7	bit: 58.2	Len: 144	Query Start:40	Query End:183	Subject Strand: null	Subject Start: 693	Subject End: 740
....................................... L  Y  V  G  V  E  N  L  F  D  F  T  Q  P  H  P  I  V  A  S  S  D  P  W  R  D  D  F  D  A  T  M  V  W  G  P  V  Y  G  R  K  I  Y  G  G  L  R  W ..................................................................................................................................................................................................................................................................................................................................................................
....................................... L  Y  V  G  S  E  N  L  T  N  F  R  Q  D  T  P  I  I  D  P  S  N  P  F  G  S  Q  F  D  A  G  L  V  W  A  P  V  L  G  R  M  V  Y  A  G  L  R  F ..................................................................................................................................................................................................................................................................................................................................................................

Subject: UniRef90_Q1W0H5 Cluster: Putative TonB-dependent outer membrane receptor protein; n=1; Psychroflexus torquis ATCC 700755|Rep: Putative TonB-dependent outer membrane receptor protein - Psychroflexus torquis ATCC 700755
HSP  1	e-value: 3.0E-7	bit: 52.0	Len: 150	Query Start:34	Query End:183	Subject Strand: null	Subject Start: 695	Subject End: 744
................................. L  Y  V  G  V  E  N  L  F  D  F  T  Q  P  H  P  I  V  A  S  S  D  P  W  R  D  D  F  D  A  T  M  V  W  G  P  V  Y  G  R  K  I  Y  G  G  L  R  W  N  L ..................................................................................................................................................................................................................................................................................................................................................................
................................. I  Y  L  G  G  E  N  V  T  N  V  R  Q  P  N  P  I  L  S  A  D  N  P  F  G  S  N  F  D  S  N  F  V  Y  G  P  I  F  G  S  L  Y  Y  A  G  L  R  Y  K  I ..................................................................................................................................................................................................................................................................................................................................................................
HSP  2	e-value: 3.0E-7	bit: 25.0	Len: 159	Query Start:170	Query End:328	Subject Strand: null	Subject Start: 644	Subject End: 699
......................................................................................................................................................................... R  W  Q  F  D  A  T  A  Q  F  N  G  P  G  T  L  P  I  P  D  A  K  N  P  L  W  E  K  T  Y  D  A  Y  T  L  -  -  V  G  A  Q  I  T  K  R  F  K  -  K  L  S  V  V  C  G  G .................................................................................................................................................................................................................
......................................................................................................................................................................... Q  W  K  F  D  A  T  Y  N  W  I  S  A  Q  R  F  P  S  T  D  L  S  T  P  Q  F  Q  L  D  D  F  S  P  T  I  G  T  L  N  L  Q  V  T  K  V  F  S  P  K  F  E  I  Y  L  G  G .................................................................................................................................................................................................................


ttttcttctttttatatggttaatacatgattannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntcgctaccgtacgcgactgcaacagatgcaacgtcgcacccgccgctttgtcagcaccctcaaaaagcaccgtacctttcacggtaaattgggccatatatcccactactcgtgatcagcgcacagaaagtacatatatgcctgaaaaacatatcaaattattatttcaatgatgt
Predict ORF larger than 30AA ================================================
Protein_Len: 41	Strand: +	Start: 27	End: 149
.......................... M  I  I  N  S  T  A  D  H  R  R  F  S  A  H  T  Q  V  P  R  P  W  L  H  R  N  R  L  S  T  D  R  M  R  Q  R  S  G  A  V  A ....................................................................................................................................................................................................................................................................................................................................................................................................
Protein_Len: 60	Strand: +	Start: 59	End: 280
.......................................................... M  F  R  P  Y  T  G  P  Q  T  M  V  A  S  K  S  S  L  H  G  S  D  E  A  T  I  G  C  G  C  V  K  S  N  R  F  S  T  P  T  Y  N  G  Q  L  L  K  P  L  R  D  L  R  A  D  E  R  I  S  I .................................................................................................................................................................................................................................................................
Protein_Len: 48	Strand: +	Start: 302	End: 445
............................................................................................................................................................................................................................................................................................................. M  R  R  R  I  E  L  P  P  V  N  G  R  P  I  S  E  R  N  Q  S  L  P  Y  A  T  A  T  D  A  T  S  H  P  P  L  C  Q  H  P  Q  K  A  P  Y  L  S  R ............................................................................................
Protein_Len: 39	Strand: +	Start: 357	End: 473
.................................................................................................................................................................................................................................................................................................................................................................... M  S  R  Y  R  T  R  L  Q  Q  M  Q  R  R  T  R  R  F  V  S  T  L  K  K  H  R  T  F  H  G  K  L  G  H  I  S  H  Y  S ................................................................
Protein_Len: 41	Strand: +	Start: 409	End: 531
........................................................................................................................................................................................................................................................................................................................................................................................................................ M  S  A  P  S  K  S  T  V  P  F  T  V  N  W  A  I  Y  P  T  T  R  D  Q  R  T  E  S  T  Y  M  P  E  K  H  I  K  L  L  F  Q ......
Protein_Len: 30	Strand: -	Start: 424	End: 513
....................................................................................................................................................................................................................................................................................................................................................................................................................................... F  A  G  Y  R  E  R  Y  I  P  G  Y  I  G  S  S  T  I  L  A  C  F  T  C  I  H  R  F  F  M ........................
Protein_Len: 60	Strand: -	Start: 198	End: 467
..................................................................................................................................................................................................... R  A  R  Q  V  A  G  D  C  R  V  A  V  P  L  R  A  D  S  I  R  A  Y  D  T  A  V  T  R  S  Q  L  L  H  L  T  A  G  A  A  K  D  A  G  E  F  L  V  T  G  K  V  T  F  Q  A  M  Y  G  M ......................................................................
Protein_Len: 60	Strand: -	Start: 158	End: 361
............................................................................................................................................................. V  S  L  K  K  F  R  K  T  I  Q  A  G  V  L  T  Y  A  D  Y  T  K  E  W  L  P  N  K  A  D  P  I  P  L  T  G  P  G  N  F  Q  A  T  A  D  F  Q  W  R  Y  V  P  T  R  Y  G  L  T  I  M ................................................................................................................................................................................
Protein_Len: 60	Strand: -	Start: 34	End: 345
................................. E  V  G  V  Y  L  P  C  S  R  L  G  S  R  S  R  R  A  S  S  R  I  L  M  T  P  K  R  G  C  H  T  K  Q  M  P  F  R  Y  R  A  P  G  T  S  S  R  R  R  M  S  S  G  G  T  F  P  R  G  M ................................................................................................................................................................................................
Protein_Len: 34	Strand: -	Start: 23	End: 124
...................... Y  M  I  I  F  E  V  A  S  W  R  L  N  E  A  W  V  C  T  G  L  G  H  N  C  R  F  R  R  E  V  S  R  M .............................................................................................................................................................................................................................................................................................................................................................................................................................
Protein_Len: 55	Strand: -	Start: 15	End: 179
.............. I  T  L  V  H  N  Y  I  G  G  C  V  V  T  S  K  G  G  M  C  L  D  G  S  W  P  Q  M  S  I  T  E  G  R  I  P  H  P  L  S  R  T  R  N  R  S  T  L  C  T  K  W  G  W  M ......................................................................................................................................................................................................................................................................................................................................................................

ttttcttctttttatatggttaatacatgattannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntcgctaccgtacgcgactgcaacagatgcaacgtcgcacccgccgctttgtcagcaccctcaaaaagcaccgtacctttcacggtaaattgggccatatatcccactactcgtgatcagcgcacagaaagtacatatatgcctgaaaaacatatcaaattattatttcaatgatgt
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

ttttcttctttttatatggttaatacatgattannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntcgctaccgtacgcgactgcaacagatgcaacgtcgcacccgccgctttgtcagcaccctcaaaaagcaccgtacctttcacggtaaattgggccatatatcccactactcgtgatcagcgcacagaaagtacatatatgcctgaaaaacatatcaaattattatttcaatgatgt
Predict TransTerm conf > 70================================================
TransTerm Strand: +	Conf: 60	HP_score: -2.1	Tail_Score: -4.3739	Start: 219	End: 243	Full_Region: TTCGTGATCTGCGCG CCGACGAGC GTATAA GCATCGTAGG TTTTCTCCCACAATG
..........................................................................................................................................................................................................................CCGACGAGCGTATAAGCATCGTAGG......................................................................................................................................................................................................................................................................................................
TransTerm Strand: +	Conf: 90	HP_score: -6.8	Tail_Score: -5.08824	Start: 250	End: 260	Full_Region: CATCGTAGGTTTTCT CCCA CAA TGGG TTTTTTGCATCGGGA
.........................................................................................................................................................................................................................................................CCCACAATGGG.....................................................................................................................................................................................................................................................................................

Find igs database================================================
Query_seq: TF1993:TF1994|TF1993:TF1994:hypothetical protein:acyl-CoA synthetase:->->:2144583..2145119 537
ttttcttctttttatatggttaatacatgattannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntcgctaccgtacgcgactgcaacagatgcaacgtcgcacccgccgctttgtcagcaccctcaaaaagcaccgtacctttcacggtaaattgggccatatatcccactactcgtgatcagcgcacagaaagtacatatatgcctgaaaaacatatcaaattattatttcaatgatgt
Intra-Species Hit: Count: 1	Min: 1	Max: 537	Len: 537
Subject: tfor_TF1993_TF1994|hypothetical protein:acyl-CoA synthetase|POSITIVE:POSITIVE|[2144583,2145119]|537
HSP  1	e-value: 6.0E-95	bit: 349.0	Len: 176	Query Start:362	Query End:537	Subject Strand: POSITIVE	Subject Start: 362	Subject End: 537
.........................................................................................................................................................................................................................................................................................................................................................................tcgctaccgtacgcgactgcaacagatgcaacgtcgcacccgccgctttgtcagcaccctcaaaaagcaccgtacctttcacggtaaattgggccatatatcccactactcgtgatcagcgcacagaaagtacatatatgcctgaaaaacatatcaaattattatttcaatgatgt
.........................................................................................................................................................................................................................................................................................................................................................................tcgctaccgtacgcgactgcaacagatgcaacgtcgcacccgccgctttgtcagcaccctcaaaaagcaccgtacctttcacggtaaattgggccatatatcccactactcgtgatcagcgcacagaaagtacatatatgcctgaaaaacatatcaaattattatttcaatgatgt
HSP  2	e-value: 1.0E-9	bit: 65.9	Len: 33	Query Start:1	Query End:33	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 33
ttttcttctttttatatggttaatacatgatta........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................
ttttcttctttttatatggttaatacatgatta........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UUUUCUUCUUUUUAUAUGGUUAAUACAUGAUUAUAAAUUCCACCGCAGACCACCGUAGAUUUUCCGCCCAUACACAGGUCCCCAGACCAUGGUUGCAUCGAAAUCGUCUCUCCACGGAUCGGAUGAGGCAACGAUCGGGUGCGGUUGCGUGAAGUCAAACAGGUUUUCCACCCCCACAUACAACGGACAGCUUCUUAAACCGCUUCGUGAUCUGCGCGCCGACGAGCGUAUAAGCAUCGUAGGUUUUCUCCCACAAUGGGUUUUUUGCAUCGGGAAUCGGUAACGUGCCGGGCCCGUUGAACUGCGCCGUCGCAUCGAACUGCCACCGGUAAACGGGCGUCCGAUAUCCGAGCGUAAUCAGUCGCUACCGUACGCGACUGCAACAGAUGCAACGUCGCACCCGCCGCUUUGUCAGCACCCUCAAAAAGCACCGUACCUUUCACGGUAAAUUGGGCCAUAUAUCCCACUACUCGUGAUCAGCGCACAGAAAGUACAUAUAUGCCUGAAAAACAUAUCAAAUUAUUAUUUCAAUGAUGU
.........(((.(((((.......(((((..............(((((....((((((((....((((.......((((....))))...(((((.......((((((.((....))..)))))).)))))....))))((((((....(((((......((....))....((.........))...)))))...)))))).....)))))))).(((.((((((......)).)))).))).....(((.....)))...)))))...((((..((((.....))))(((((.((((..((((.(((.(((((.........(((.....)))(((..((.....))..)))...(((((((........))))))).....))))).))).))))......(((.....)))....)))).....(((((.......))))).....))))).....)))).....))))).((((.(((...............)))))))....))))).))).((((((....)))))). (-146.66)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
ACAUCAUUGAAAUAAUAAUUUGAUAUGUUUUUCAGGCAUAUAUGUACUUUCUGUGCGCUGAUCACGAGUAGUGGGAUAUAUGGCCCAAUUUACCGUGAAAGGUACGGUGCUUUUUGAGGGUGCUGACAAAGCGGCGGGUGCGACGUUGCAUCUGUUGCAGUCGCGUACGGUAGCGACUGAUUACGCUCGGAUAUCGGACGCCCGUUUACCGGUGGCAGUUCGAUGCGACGGCGCAGUUCAACGGGCCCGGCACGUUACCGAUUCCCGAUGCAAAAAACCCAUUGUGGGAGAAAACCUACGAUGCUUAUACGCUCGUCGGCGCGCAGAUCACGAAGCGGUUUAAGAAGCUGUCCGUUGUAUGUGGGGGUGGAAAACCUGUUUGACUUCACGCAACCGCACCCGAUCGUUGCCUCAUCCGAUCCGUGGAGAGACGAUUUCGAUGCAACCAUGGUCUGGGGACCUGUGUAUGGGCGGAAAAUCUACGGUGGUCUGCGGUGGAAUUUAUAAUCAUGUAUUAACCAUAUAAAAAGAAGAAAA
............(((((...(((((((..((((..((...(((((((..((((((((((((...(((((..(((((.....(((((....(((((((.....)))))))....(((((.((((.......((((((((((((....)))))))))))).(((((((.((.....(((((....(((.(((....(((....)))....)))))).)))))))))))))).))))..))))).)))))(((.......)))..)))))............(((((((((......))))))))).......)))))))))))))))))..(((..((((((.....)))))).))).)))))))(((((.(((......))).)))))..)).((((((..(.(((((.......((((.(((...((((.....)))).(((((.....((((....))))..))))))))))))......))))).)..))))))))))..))).))))..))))).................... (-177.72)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
533	310	267	68	25	tfor:TF2725|5end_outer_membrane_protein,_TonB_dependent_receptor_2899408..2899638_POSITIVE
512	328	286	53	2	tfor:TF3022|5end_chorismate_synthase_3246136..3246366_POSITIVE
493	350	304	56	13	tfor:TF0462|5end_possible_cobalamin_biosynthesis_precorrin-3_methylase_477600..477830_POSITIVE
489	370	322	61	9	tfor:TF0777|5end_1,4-dihydroxy-2-naphthoate_octaprenyltransferase_826098..826328_POSITIVE
483	340	292	202	147	tfor:TF0098|5end_permease_108103..108333_POSITIVE
481	314	271	110	61	tfor:TF1299|5end_conserved_hypothetical_protein_1380937..1381167_POSITIVE
471	242	201	50	13	tfor:TF1258|5end_hypothetical_protein_1338321..1338551_POSITIVE
467	150	103	66	11	tfor:TF2677|5end_aspartate_transaminase_2850809..2851039_POSITIVE
462	330	282	55	6	tfor:TF1460|5end_6-phosphogluconate_dehydrogenase_1549262..1549492_POSITIVE
461	350	302	198	150	tfor:TF0971|5end_conserved_hypothetical_protein_1021355..1021585_POSITIVE
455	350	303	48	4	tfor:TF0361|5end_hypothetical_protein_379458..379688_POSITIVE
450	317	278	65	22	tfor:TF2429|5end_ABC_transporter,_ATP-binding/permease_component,_bacteriocin/lantibiotic_exporter_2610453..2610683_POSITIVE
446	437	392	217	162	tfor:TF2770|5end_conserved_hypothetical_protein_2956308..2956538_POSITIVE
445	370	321	56	1	tfor:TF2354|5end_dihydropteroate_synthase_2518541..2518771_POSITIVE
445	350	303	76	30	tfor:TF2165|5end_hypothetical_protein_2341654..2341884_POSITIVE
445	350	303	229	183	tfor:TF0369|5end_hypothetical_protein_385933..386163_POSITIVE
443	339	294	228	193	tfor:TF1549|5end_conserved_hypothetical_protein_1653993..1654223_POSITIVE
441	330	284	71	12	tfor:TF2573|5end_50S_ribosomal_protein_L15_2743310..2743540_POSITIVE
441	149	102	175	125	tfor:TF1069|5end_glucokinase_regulatory_protein,_sugar_phosphate_isomerase_domain_1138884..1139114_POSITIVE
440	310	261	61	6	tfor:TF2423|5end_papain_family_cysteine_protease_2601608..2601838_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
489	370	322	56	4	tfor:TF0776|3end_ABC_transporter,_permease_component_826173..826323_POSITIVE
480	350	305	58	3	tfor:TF3021|3end_FKBP-type_peptidyl-prolyl_cis-trans_isomerase_3246194..3246344_POSITIVE
455	350	303	48	4	tfor:TF0360|3end_hypothetical_protein_379538..379688_POSITIVE
453	145	106	58	19	tfor:TF1298|3end_possible_membrane_protein_1381197..1381347_POSITIVE
450	317	278	57	14	tfor:TF2428|3end_conserved_hypothetical_protein_2610525..2610675_POSITIVE
445	350	303	50	4	tfor:TF2164|3end_hypothetical_protein_2341708..2341858_POSITIVE
445	350	303	50	4	tfor:TF0368|3end_hypothetical_protein_385834..385984_POSITIVE
443	339	294	142	107	tfor:TF1548|3end_thiophene_and_furan_oxidation_protein_1653987..1654137_POSITIVE
433	328	286	73	19	tfor:TF2006|3end_uracil_permease_2158642..2158792_POSITIVE
433	379	333	149	98	tfor:TF0419|3end_conserved_hypothetical_protein_435794..435944_POSITIVE
430	310	262	146	102	tfor:TF2024|3end_conserved_hypothetical_protein_2181979..2182129_POSITIVE
421	339	294	100	48	tfor:TF2015|3end_N6-adenine-specific_DNA_methylase_2173020..2173170_POSITIVE
420	339	291	108	66	tfor:TF2900|3end_conserved_hypothetical_protein_3090029..3090179_POSITIVE
414	317	280	47	6	tfor:TF2426|3end_conserved_hypothetical_protein;_possible_TonB_receptor_2605931..2606081_POSITIVE
410	220	173	53	3	tfor:TF2874|3end_conserved_hypothetical_protein_3065224..3065374_POSITIVE
409	390	342	51	7	tfor:TF0593|3end_membrane-associated_phospholipid_phosphatase_627051..627201_POSITIVE
408	254	213	91	36	tfor:TF0599|3end_hypothetical_protein_630130..630280_POSITIVE
408	350	304	143	99	tfor:TF0535|3end_surface_antigen_BspA_561701..561851_POSITIVE
406	325	284	145	95	tfor:TF1443|3end_hypothetical_protein_1528203..1528353_POSITIVE
406	344	302	143	100	tfor:TF1186|3end_hypothetical_protein_1269815..1269965_POSITIVE