Origin IGS:
taatgaaacaagcgggctgtgagagcatacgatattcgtgtgatgataaaacatttctgaaagtaggaagaaaaccgtttcgttttcttcctactcgattgaaatttattgctgtccattaaaattttttgaacaataaaaattaggactgaattcctcgcttggaatccagcccttttagtgatctttgtttctgccaaaataaaccatagtagcgatgaacaaagatacacattttaccggacagtaatataaaataatatgatta
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
taatcatattattttatattactgtccggtaaaatgtgtatctttgttcatcgctactatggtttattttggcagaaacaaagatcactaaaagggctggattccaagcgaggaattcagtcctaatttttattgttcaaaaaattttaatggacagcaataaatttcaatcgagtaggaagaaaacgaaacggttttcttcctactttcagaaatgttttatcatcacacgaatatcgtatgctctcacagcccgcttgtttcatta

Mask Tandem Repeat Region ================================================
taatgaaacaagcgggctgtgagagcatacgatattcgtgtgatgataaaacatttctgaaagtaggaagaaaaccgtttcgttttcttcctactcgattgaaatttattgctgtccattaaaattttttgaacaataaaaattaggactgaattcctcgcttggaatccagcccttttagtgatctttgtttctgccaaaataaaccatagtagcgatgaacaaagatacacattttaccggacagtaatataaaataatatgatta

Find is-nt database================================================
Query_seq: TF2302:TF2303|TF2302:TF2303:conserved hypothetical protein; possible outer membrane protein:conserved hypothetical protein:->->:2458124..2458391 268
taatgaaacaagcgggctgtgagagcatacgatattcgtgtgatgataaaacatttctgaaagtaggaagaaaaccgtttcgttttcttcctactcgattgaaatttattgctgtccattaaaattttttgaacaataaaaattaggactgaattcctcgcttggaatccagcccttttagtgatctttgtttctgccaaaataaaccatagtagcgatgaacaaagatacacattttaccggacagtaatataaaataatatgatta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: TF2302:TF2303|TF2302:TF2303:conserved hypothetical protein; possible outer membrane protein:conserved hypothetical protein:->->:2458124..2458391 268
taatgaaacaagcgggctgtgagagcatacgatattcgtgtgatgataaaacatttctgaaagtaggaagaaaaccgtttcgttttcttcctactcgattgaaatttattgctgtccattaaaattttttgaacaataaaaattaggactgaattcctcgcttggaatccagcccttttagtgatctttgtttctgccaaaataaaccatagtagcgatgaacaaagatacacattttaccggacagtaatataaaataatatgatta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: TF2302:TF2303|TF2302:TF2303:conserved hypothetical protein; possible outer membrane protein:conserved hypothetical protein:->->:2458124..2458391 268
taatgaaacaagcgggctgtgagagcatacgatattcgtgtgatgataaaacatttctgaaagtaggaagaaaaccgtttcgttttcttcctactcgattgaaatttattgctgtccattaaaattttttgaacaataaaaattaggactgaattcctcgcttggaatccagcccttttagtgatctttgtttctgccaaaataaaccatagtagcgatgaacaaagatacacattttaccggacagtaatataaaataatatgatta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

taatgaaacaagcgggctgtgagagcatacgatattcgtgtgatgataaaacatttctgaaagtaggaagaaaaccgtttcgttttcttcctactcgattgaaatttattgctgtccattaaaattttttgaacaataaaaattaggactgaattcctcgcttggaatccagcccttttagtgatctttgtttctgccaaaataaaccatagtagcgatgaacaaagatacacattttaccggacagtaatataaaataatatgatta
Predict ORF larger than 30AA ================================================
Protein_Len: 39	Strand: +	Start: 3	End: 119
.. M  K  Q  A  G  C  E  S  I  R  Y  S  C  D  D  K  T  F  L  K  V  G  R  K  P  F  R  F  L  P  T  R  L  K  F  I  A  V  H .....................................................................................................................................................
Protein_Len: 39	Strand: +	Start: 136	End: 252
....................................................................................................................................... M  K  I  R  T  E  F  L  A  W  N  P  A  L  L  V  I  F  V  S  A  K  I  N  H  S  S  D  E  Q  R  Y  T  F  Y  R  T  V  I ................
Protein_Len: 36	Strand: -	Start: 146	End: 253
................................................................................................................................................. S  Q  I  G  R  K  S  D  L  G  K  L  S  R  Q  K  Q  W  F  L  G  Y  Y  R  H  V  F  I  C  M  K  G  S  L  L  M ...............
Protein_Len: 60	Strand: -	Start: 3	End: 233
.. K  Q  F  Y  S  S  F  R  K  T  K  K  R  S  S  Q  F  K  N  S  D  M  L  I  K  Q  V  I  F  I  L  V  S  N  R  A  Q  F  G  A  R  K  T  I  K  T  E  A  L  I  F  W  L  L  S  S  C  L  Y  M ...................................
Protein_Len: 36	Strand: -	Start: 2	End: 109
. I  F  C  A  P  Q  S  L  M  R  Y  E  H  S  S  L  V  N  R  F  T  P  L  F  G  N  R  K  R  G  V  R  N  F  N  M ...............................................................................................................................................................

taatgaaacaagcgggctgtgagagcatacgatattcgtgtgatgataaaacatttctgaaagtaggaagaaaaccgtttcgttttcttcctactcgattgaaatttattgctgtccattaaaattttttgaacaataaaaattaggactgaattcctcgcttggaatccagcccttttagtgatctttgtttctgccaaaataaaccatagtagcgatgaacaaagatacacattttaccggacagtaatataaaataatatgatta
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

taatgaaacaagcgggctgtgagagcatacgatattcgtgtgatgataaaacatttctgaaagtaggaagaaaaccgtttcgttttcttcctactcgattgaaatttattgctgtccattaaaattttttgaacaataaaaattaggactgaattcctcgcttggaatccagcccttttagtgatctttgtttctgccaaaataaaccatagtagcgatgaacaaagatacacattttaccggacagtaatataaaataatatgatta
Predict TransTerm conf > 70================================================
TransTerm Strand: +	Conf: 57	HP_score: -2.8	Tail_Score: -4.29508	Start: 54	End: 104	Full_Region: TGTGATGATAAAACA TTTCTGAAAGTAGGAAGAAAAC CGTTTC GTTTTCTTCCTACTCGATTGAAA TTTATTGCTGTCCAT
.....................................................TTTCTGAAAGTAGGAAGAAAACCGTTTCGTTTTCTTCCTACTCGATTGAAA....................................................................................................................................................................
TransTerm Strand: -	Conf: 52	HP_score: -2.8	Tail_Score: -3.84183	Start: 54	End: 104	Full_Region: atggacagcaataaa tttcaatcgagtaggaagaaaac gaaacg gttttcttcctactttcagaaa tgttttatcatcaca
.....................................................tttcaatcgagtaggaagaaaacgaaacggttttcttcctactttcagaaa....................................................................................................................................................................
TransTerm Strand: +	Conf: 95	HP_score: -14.7	Tail_Score: -2.56314	Start: 63	End: 94	Full_Region: AAAACATTTCTGAAA GTAGGAAGAAAAC CGTTTC GTTTTCTTCCTAC TCGATTGAAATTTAT
..............................................................GTAGGAAGAAAACCGTTTCGTTTTCTTCCTAC..............................................................................................................................................................................
TransTerm Strand: -	Conf: 100	HP_score: -14.7	Tail_Score: -3.58731	Start: 63	End: 94	Full_Region: ataaatttcaatcga gtaggaagaaaac gaaacg gttttcttcctac tttcagaaatgtttt
..............................................................gtaggaagaaaacgaaacggttttcttcctac..............................................................................................................................................................................
TransTerm Strand: +	Conf: 51	HP_score: -4.2	Tail_Score: -3.2327	Start: 70	End: 87	Full_Region: TTCTGAAAGTAGGAA GAAAAC CGTTTC GTTTTC TTCCTACTCGATTGA
.....................................................................GAAAACCGTTTCGTTTTC.....................................................................................................................................................................................
TransTerm Strand: -	Conf: 84	HP_score: -4.7	Tail_Score: -5.29445	Start: 143	End: 178	Full_Region: aaacaaagatcacta aaagggctggattcc aagcga ggaattcagtcctaa tttttattgttcaaa
..............................................................................................................................................aaagggctggattccaagcgaggaattcagtcctaa..........................................................................................
TransTerm Strand: -	Conf: 74	HP_score: -8.2	Tail_Score: -3.76582	Start: 144	End: 177	Full_Region: aacaaagatcactaa aagggctggattcc aagcga ggaattcagtccta atttttattgttcaa
...............................................................................................................................................aagggctggattccaagcgaggaattcagtccta...........................................................................................
TransTerm Strand: +	Conf: 76	HP_score: -6.4	Tail_Score: -4.37067	Start: 146	End: 175	Full_Region: GAACAATAAAAATTA GGACTGAATTCC TCGCTT GGAATCCAGCCC TTTTAGTGATCTTTG
.................................................................................................................................................GGACTGAATTCCTCGCTTGGAATCCAGCCC.............................................................................................
TransTerm Strand: -	Conf: 82	HP_score: -10.8	Tail_Score: -3.44752	Start: 146	End: 175	Full_Region: caaagatcactaaaa gggctggattcc aagcga ggaattcagtcc taatttttattgttc
.................................................................................................................................................gggctggattccaagcgaggaattcagtcc.............................................................................................

Find igs database================================================
Query_seq: TF2302:TF2303|TF2302:TF2303:conserved hypothetical protein; possible outer membrane protein:conserved hypothetical protein:->->:2458124..2458391 268
taatgaaacaagcgggctgtgagagcatacgatattcgtgtgatgataaaacatttctgaaagtaggaagaaaaccgtttcgttttcttcctactcgattgaaatttattgctgtccattaaaattttttgaacaataaaaattaggactgaattcctcgcttggaatccagcccttttagtgatctttgtttctgccaaaataaaccatagtagcgatgaacaaagatacacattttaccggacagtaatataaaataatatgatta
Intra-Species Hit: Count: 1	Min: 1	Max: 268	Len: 268
Subject: tfor_TF2302_TF2303|conserved hypothetical protein; possible outer membrane protein:conserved hypothetical protein|POSITIVE:POSITIVE|[2458124,2458391]|268
HSP  1	e-value: 1.0E-150	bit: 531.0	Len: 268	Query Start:1	Query End:268	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 268
taatgaaacaagcgggctgtgagagcatacgatattcgtgtgatgataaaacatttctgaaagtaggaagaaaaccgtttcgttttcttcctactcgattgaaatttattgctgtccattaaaattttttgaacaataaaaattaggactgaattcctcgcttggaatccagcccttttagtgatctttgtttctgccaaaataaaccatagtagcgatgaacaaagatacacattttaccggacagtaatataaaataatatgatta
taatgaaacaagcgggctgtgagagcatacgatattcgtgtgatgataaaacatttctgaaagtaggaagaaaaccgtttcgttttcttcctactcgattgaaatttattgctgtccattaaaattttttgaacaataaaaattaggactgaattcctcgcttggaatccagcccttttagtgatctttgtttctgccaaaataaaccatagtagcgatgaacaaagatacacattttaccggacagtaatataaaataatatgatta

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UAAUGAAACAAGCGGGCUGUGAGAGCAUACGAUAUUCGUGUGAUGAUAAAACAUUUCUGAAAGUAGGAAGAAAACCGUUUCGUUUUCUUCCUACUCGAUUGAAAUUUAUUGCUGUCCAUUAAAAUUUUUUGAACAAUAAAAAUUAGGACUGAAUUCCUCGCUUGGAAUCCAGCCCUUUUAGUGAUCUUUGUUUCUGCCAAAAUAAACCAUAGUAGCGAUGAACAAAGAUACACAUUUUACCGGACAGUAAUAUAAAAUAAUAUGAUUA
..(((((.....((...(((....)))..))...))))).((((.(((....(((((....((((((((((((((......)))))))))))))).....))))).(((((((((((.....(((((((........))))))).((.(((.(((((......))))).))).)).....(((((((((((((((((..............))))....)))))))))).)))........)))))))))))........))).)))) (-72.94)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UAAUCAUAUUAUUUUAUAUUACUGUCCGGUAAAAUGUGUAUCUUUGUUCAUCGCUACUAUGGUUUAUUUUGGCAGAAACAAAGAUCACUAAAAGGGCUGGAUUCCAAGCGAGGAAUUCAGUCCUAAUUUUUAUUGUUCAAAAAAUUUUAAUGGACAGCAAUAAAUUUCAAUCGAGUAGGAAGAAAACGAAACGGUUUUCUUCCUACUUUCAGAAAUGUUUUAUCAUCACACGAAUAUCGUAUGCUCUCACAGCCCGCUUGUUUCAUUA
................((((.(((((((.(((((((((.(((((((((..((((((..(((...)))..)))).))))))))))))))....(((((((((((((......)))))))))))))...................)))))).))))))).))))..........(((((((((((((((......)))))))))))))))...(((((.............(((.....)))..(((.....)))......))))).... (-77.10)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
379	93	51	146	98	tfor:TF2197|5end_conserved_hypothetical_protein_2372402..2372632_POSITIVE
323	117	74	75	29	tfor:TF0239|5end_conserved_hypothetical_protein_268894..269124_POSITIVE
308	197	157	59	25	tfor:TF2151|5end_uridine_kinase_2323033..2323263_POSITIVE
307	46	8	191	137	tfor:TF1142|5end_outer_membrane_cobalamin_receptor_protein_1219207..1219437_POSITIVE
305	252	212	136	99	tfor:TF0005|5end_possible_beta-lactamase_600..830_POSITIVE
300	195	154	147	106	tfor:TF0662|5end_hypothetical_protein_708316..708546_POSITIVE
298	44	11	131	104	tfor:TF1327|5end_L-fucose_permease_1405790..1406020_POSITIVE
296	190	145	156	116	tfor:TF1883|5end_conserved_hypothetical_protein_2035015..2035245_POSITIVE
294	60	13	205	154	tfor:TF0456|5end_conserved_hypothetical_protein_473403..473633_POSITIVE
289	70	21	91	29	tfor:TF0010|5end_conserved_hypothetical_protein_4432..4662_POSITIVE
288	116	75	166	119	tfor:TF1904|5end_two-component_system_response_regulator_2058975..2059205_POSITIVE
286	183	145	145	102	tfor:TF2501|5end_DNA_mismatch_repair_protein_2676280..2676510_POSITIVE
285	194	153	48	14	tfor:TF2901|5end_conserved_hypothetical_protein_3090365..3090595_POSITIVE
285	223	182	145	92	tfor:TF0296|5end_hypothetical_protein_321941..322171_POSITIVE
283	38	1	174	134	tfor:TF0349|5end_hypothetical_protein_370367..370597_POSITIVE
282	60	11	101	55	tfor:TF2582|5end_ABC_transporter,_ATP-binding_protein_2749433..2749663_POSITIVE
282	59	12	121	68	tfor:TF1334|5end_hypothetical_protein_1415996..1416226_POSITIVE
281	96	51	132	86	tfor:TF2218|5end_two-component_system_response_regulator_2390162..2390392_POSITIVE
281	159	113	231	185	tfor:TF1773|5end_hypothetical_protein_1910939..1911169_POSITIVE
280	57	11	195	157	tfor:TF1586|5end_hypothetical_protein_1690971..1691201_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
365	100	62	63	34	tfor:TF2295|3end_hypothetical_protein_2448717..2448867_POSITIVE
323	117	74	58	12	tfor:TF0238|3end_outer_membrane_protein_268957..269107_POSITIVE
308	197	157	56	22	tfor:TF2149|3end_deoxyribose-phosphate_aldolase_2323110..2323260_POSITIVE
305	252	212	103	66	tfor:TF0002|3end_hypothetical_protein_647..797_POSITIVE
298	197	153	141	96	tfor:TF3051|3end_conserved_hypothetical_protein_3278067..3278217_POSITIVE
298	44	11	131	104	tfor:TF1325|3end_L-fucose_isomerase_1405870..1406020_POSITIVE
285	198	151	83	43	tfor:TF2640|3end_hypothetical_protein_2809533..2809683_POSITIVE
282	59	12	59	6	tfor:TF1333|3end_probable_acylaminoacyl_peptidase;_alanyl_dipeptidyl_peptidase_1416014..1416164_POSITIVE
281	96	51	55	9	tfor:TF2217|3end_hypothetical_protein_2390165..2390315_POSITIVE
280	41	11	110	80	tfor:TF0750|3end_conserved_hypothetical_protein_798698..798848_POSITIVE
279	220	174	93	50	tfor:TF1295|3end_conserved_hypothetical_protein_1377256..1377406_POSITIVE
274	102	62	49	4	tfor:TF2740|3end_conserved_hypothetical_protein_2921972..2922122_POSITIVE
272	190	141	74	28	tfor:TF1291|3end_response_regulator_(fimR__protein)_1372647..1372797_POSITIVE
272	198	155	73	28	tfor:TF1014|3end_glucose-6-phosphate_isomerase_1072474..1072624_POSITIVE
271	200	153	49	1	tfor:TF0493|3end_outer_membrane_protein_519260..519410_POSITIVE
267	48	4	86	45	tfor:TF0407|3end_lipoate-protein_ligase_B_(lipoyltransferase)_425844..425994_POSITIVE
266	200	161	150	106	tfor:TF2116|3end_conserved_hypothetical_protein;_possible_hemagglutinin/hemolysin_2289634..2289784_POSITIVE
265	259	215	94	48	tfor:TF0835|3end_conserved_hypothetical_protein_889366..889516_POSITIVE
264	45	8	123	90	tfor:TF2774|3end_2-amino-4-hydroxy-6-hydroxymethyldihydropteridine_pyrophosphokinase_2959719..2959869_POSITIVE
263	182	145	151	116	tfor:TF1882|3end_conserved_hypothetical_protein_2035095..2035245_POSITIVE