Origin IGS:
tttctcctaacaattatcggttgcaaacataaattattttttgagcaaatcctccttgctttgttttttattaacgtattcgacgtcgttttggctttttttgggatggttggggctgttatacatacaatacta
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
tagtattgtatgtataacagccccaaccatcccaaaaaaagccaaaacgacgtcgaatacgttaataaaaaacaaagcaaggaggatttgctcaaaaaataatttatgtttgcaaccgataattgttaggagaaa

Mask Tandem Repeat Region ================================================
tttctcctaacaattatcggttgcaaacataaattattttttgagcaaatcctccttgctttgttttttattaacgtattcgacgtcgttttggctttttttgggatggttggggctgttatacatacaatacta

Find is-nt database================================================
Query_seq: TF2543:TF2544|TF2543:TF2544:RNA polymerase sigma-70 factor, ECF subfamily:cytidine deaminase:->->:2728327..2728461 135
tttctcctaacaattatcggttgcaaacataaattattttttgagcaaatcctccttgctttgttttttattaacgtattcgacgtcgttttggctttttttgggatggttggggctgttatacatacaatacta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: TF2543:TF2544|TF2543:TF2544:RNA polymerase sigma-70 factor, ECF subfamily:cytidine deaminase:->->:2728327..2728461 135
tttctcctaacaattatcggttgcaaacataaattattttttgagcaaatcctccttgctttgttttttattaacgtattcgacgtcgttttggctttttttgggatggttggggctgttatacatacaatacta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: TF2543:TF2544|TF2543:TF2544:RNA polymerase sigma-70 factor, ECF subfamily:cytidine deaminase:->->:2728327..2728461 135
tttctcctaacaattatcggttgcaaacataaattattttttgagcaaatcctccttgctttgttttttattaacgtattcgacgtcgttttggctttttttgggatggttggggctgttatacatacaatacta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

tttctcctaacaattatcggttgcaaacataaattattttttgagcaaatcctccttgctttgttttttattaacgtattcgacgtcgttttggctttttttgggatggttggggctgttatacatacaatacta
Predict ORF larger than 30AA ================================================
Protein_Len: 35	Strand: +	Start: 29	End: 133
............................ M  N  Y  F  L  S  K  S  S  L  L  C  F  L  L  T  Y  S  T  S  F  W  L  F  L  G  W  L  G  L  L  Y  I  Q  Y ..
Protein_Len: 41	Strand: +	Start: 13	End: 135
............ M  I  G  C  K  H  K  L  F  F  E  Q  I  L  L  A  L  F  F  I  N  V  F  D  V  V  L  A  F  F  G  M  V  G  A  V  I  H  T  I  L 
Protein_Len: 30	Strand: -	Start: 37	End: 126
.................................... K  K  L  L  D  E  K  S  Q  K  K  N  V  Y  E  V  D  N  Q  S  K  K  P  H  N  P  S  N  Y  M .........
Protein_Len: 43	Strand: -	Start: 3	End: 131
.. R  R  V  I  I  P  Q  L  C  L  N  N  K  S  C  I  R  R  A  K  N  K  I  L  T  N  S  T  T  K  A  K  K  P  I  T  P  A  T  I  C  V  M ....

tttctcctaacaattatcggttgcaaacataaattattttttgagcaaatcctccttgctttgttttttattaacgtattcgacgtcgttttggctttttttgggatggttggggctgttatacatacaatacta
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

tttctcctaacaattatcggttgcaaacataaattattttttgagcaaatcctccttgctttgttttttattaacgtattcgacgtcgttttggctttttttgggatggttggggctgttatacatacaatacta
Predict TransTerm conf > 70================================================

Find igs database================================================
Query_seq: TF2543:TF2544|TF2543:TF2544:RNA polymerase sigma-70 factor, ECF subfamily:cytidine deaminase:->->:2728327..2728461 135
tttctcctaacaattatcggttgcaaacataaattattttttgagcaaatcctccttgctttgttttttattaacgtattcgacgtcgttttggctttttttgggatggttggggctgttatacatacaatacta
Intra-Species Hit: Count: 1	Min: 1	Max: 135	Len: 135
Subject: tfor_TF2543_TF2544|RNA polymerase sigma-70 factor, ECF subfamily:cytidine deaminase|POSITIVE:POSITIVE|[2728327,2728461]|135
HSP  1	e-value: 1.0E-58	bit: 226.0	Len: 135	Query Start:1	Query End:135	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 135
tttctcctaacaattatcggttgcaaacataaattattttttgagcaaatcctccttgctttgttttttattaacgtattcgacgtcgttttggcnnnnnnngggatggttggggctgttatacatacaatacta
tttctcctaacaattatcggttgcaaacataaattattttttgagcaaatcctccttgctttgttttttattaacgtattcgacgtcgttttggctttttttgggatggttggggctgttatacatacaatacta

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UUUCUCCUAACAAUUAUCGGUUGCAAACAUAAAUUAUUUUUUGAGCAAAUCCUCCUUGCUUUGUUUUUUAUUAACGUAUUCGACGUCGUUUUGGCUUUUUUUGGGAUGGUUGGGGCUGUUAUACAUACAAUACUA
....(((((((.....(((..(((....(((((..((.....((((((.......)))))).))..)))))....)))..)))...(((((..(......)..)))))))))))).................... (-21.30)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UAGUAUUGUAUGUAUAACAGCCCCAACCAUCCCAAAAAAAGCCAAAACGACGUCGAAUACGUUAAUAAAAAACAAAGCAAGGAGGAUUUGCUCAAAAAAUAAUUUAUGUUUGCAACCGAUAAUUGUUAGGAGAAA
...(((((..((((.((((.............................(((((.....)))))............((((((.....))))))..............))))))))..))))).............. (-15.30)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
399	127	81	92	38	tfor:TF2343|5end_ribosome_recycling_factor_2506862..2507092_POSITIVE
370	118	73	231	179	tfor:TF0506|5end_ATP-dependent_RNA_helicase,_DEAD/DEAH_box_helicase_531031..531261_POSITIVE
360	119	74	229	196	tfor:TF3036|5end_glucose/galactose_transporter_3261667..3261897_POSITIVE
347	121	81	56	10	tfor:TF1499|5end_3-oxyacyl-[acyl-carrier_protein]_synthase_1598394..1598624_POSITIVE
344	116	75	89	46	tfor:TF2704|5end_ribonuclease_HII_2876242..2876472_POSITIVE
343	116	85	177	146	tfor:TF1347|5end_conserved_hypothetical_protein_1426171..1426401_POSITIVE
343	118	75	200	144	tfor:TF0044|5end_conserved_hypothetical_protein_48334..48564_POSITIVE
342	113	71	221	180	tfor:TF2572|5end_50S_ribosomal_protein_L30_2743081..2743311_POSITIVE
337	118	77	148	112	tfor:TF2788|5end_hypothetical_protein_2972201..2972431_POSITIVE
336	87	43	106	65	tfor:TF2520|5end_conserved_hypothetical_protein_2698917..2699147_POSITIVE
334	117	72	214	168	tfor:TF2220|5end_CTn_integrase-recombinase_protein_2392424..2392654_POSITIVE
331	118	75	207	142	tfor:TF0541|5end_conserved_hypothetical_protein_568473..568703_POSITIVE
329	116	71	192	149	tfor:TF1804|5end_hypothetical_protein_1947101..1947331_POSITIVE
322	117	74	194	131	tfor:TF1406|5end_transposase_1481758..1481988_POSITIVE
321	116	75	192	152	tfor:TF2849|5end_histidinol-phosphate_transaminase_3037288..3037518_POSITIVE
318	116	73	217	166	tfor:TF1515|5end_hypothetical_protein_1625307..1625537_POSITIVE
312	129	84	62	7	tfor:TF2804|5end_conserved_hypothetical_protein_2993494..2993724_POSITIVE
312	115	75	183	129	tfor:TF2434|5end_conserved_hypothetical_protein_2613969..2614199_POSITIVE
312	123	81	193	140	tfor:TF2037|5end_conserved_hypothetical_protein;_possible_anaerobic_ribonucleoside-triphosphate_reductase_2196754..2196984_POSITIVE
312	119	71	57	12	tfor:TF1734|5end_conserved_hypothetical_protein_1856556..1856786_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
347	121	81	72	26	tfor:TF1498|3end_GTP-binding_protein_1598490..1598640_POSITIVE
344	116	75	84	41	tfor:TF2703|3end_conserved_hypothetical_protein_2876317..2876467_POSITIVE
343	107	76	71	34	tfor:TF1997|3end_ROK_family_transcriptional_regulator_2152686..2152836_POSITIVE
343	116	85	140	109	tfor:TF1346|3end_hypothetical_protein_1426214..1426364_POSITIVE
337	118	77	125	89	tfor:TF2787|3end_30S_ribosomal_protein_S1_2972258..2972408_POSITIVE
336	87	43	106	65	tfor:TF2519|3end_membrane_protein,_metallopeptidase_M23/M37_family_2698997..2699147_POSITIVE
331	118	75	150	85	tfor:TF0540|3end_conserved_hypothetical_protein;_possible_surface_protein_568496..568646_POSITIVE
329	116	71	131	88	tfor:TF1803|3end_conserved_hypothetical_protein_1947120..1947270_POSITIVE
318	112	75	151	105	tfor:TF1066|3end_hypothetical_protein_1136858..1137008_POSITIVE
303	120	75	76	28	tfor:TF1173|3end_ABC_transporter,_permease_component_1256651..1256801_POSITIVE
300	116	75	132	92	tfor:TF1608|3end_sulfate_transporter_1728463..1728613_POSITIVE
292	120	72	95	40	tfor:TF0821|3end_hypothetical_protein_880195..880345_POSITIVE
290	119	82	48	12	tfor:TF1465|3end_modulator_of_DNA_gyrase_1555544..1555694_POSITIVE
289	121	81	46	8	tfor:TF1758|3end_conserved_hypothetical_protein_1895544..1895694_POSITIVE
287	126	91	130	95	tfor:TF2297|3end_hypothetical_protein_2449673..2449823_POSITIVE
284	115	72	108	59	tfor:TF0370|3end_hypothetical_protein_386317..386467_POSITIVE
283	130	84	96	45	tfor:TF2651|3end_hypothetical_protein_2822014..2822164_POSITIVE
283	118	75	83	39	tfor:TF0952|3end_conserved_hypothetical_protein_998009..998159_POSITIVE
282	100	51	97	50	tfor:TF0624|3end_Xaa-Pro_dipeptidase_(aminopeptidase_P)_661015..661165_POSITIVE
282	118	79	138	103	tfor:TF0469|3end_hypothetical_protein_487228..487378_POSITIVE