Origin IGS:
taaatcggaattactttgtacttcccgacagatttgcacgtactccggatgcgaccttctcggaaatcagacatccaactgtcctgtgcggtcaaaaagcatgaacatacgaatcaaagaaaaaaatgtaatcaacagtgtctttttcatcatgattgtgttgtgtgataaaaagttaataaattgcaatacttcctggattgtaatca
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
tgattacaatccaggaagtattgcaatttattaactttttatcacacaacacaatcatgatgaaaaagacactgttgattacatttttttctttgattcgtatgttcatgctttttgaccgcacaggacagttggatgtctgatttccgagaaggtcgcatccggagtacgtgcaaatctgtcgggaagtacaaagtaattccgattta

Mask Tandem Repeat Region ================================================
taaatcggaattactttgtacttcccgacagatttgcacgtactccggatgcgaccttctcggaaatcagacatccaactgtcctgtgcggtcaaaaagcatgaacatacgaatcaaagaaaaaaatgtaatcaacagtgtctttttcatcatgattgtgttgtgtgataaaaagttaataaattgcaatacttcctggattgtaatca

Find is-nt database================================================
Query_seq: TF3033:TF3034|TF3033:TF3034:S1 RNA binding domain protein, S1 ribosomal protein:conserved hypothetical protein:->->:3259044..3259252 209
taaatcggaattactttgtacttcccgacagatttgcacgtactccggatgcgaccttctcggaaatcagacatccaactgtcctgtgcggtcaaaaagcatgaacatacgaatcaaagaaaaaaatgtaatcaacagtgtctttttcatcatgattgtgttgtgtgataaaaagttaataaattgcaatacttcctggattgtaatca
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: TF3033:TF3034|TF3033:TF3034:S1 RNA binding domain protein, S1 ribosomal protein:conserved hypothetical protein:->->:3259044..3259252 209
taaatcggaattactttgtacttcccgacagatttgcacgtactccggatgcgaccttctcggaaatcagacatccaactgtcctgtgcggtcaaaaagcatgaacatacgaatcaaagaaaaaaatgtaatcaacagtgtctttttcatcatgattgtgttgtgtgataaaaagttaataaattgcaatacttcctggattgtaatca
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: TF3033:TF3034|TF3033:TF3034:S1 RNA binding domain protein, S1 ribosomal protein:conserved hypothetical protein:->->:3259044..3259252 209
taaatcggaattactttgtacttcccgacagatttgcacgtactccggatgcgaccttctcggaaatcagacatccaactgtcctgtgcggtcaaaaagcatgaacatacgaatcaaagaaaaaaatgtaatcaacagtgtctttttcatcatgattgtgttgtgtgataaaaagttaataaattgcaatacttcctggattgtaatca
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

taaatcggaattactttgtacttcccgacagatttgcacgtactccggatgcgaccttctcggaaatcagacatccaactgtcctgtgcggtcaaaaagcatgaacatacgaatcaaagaaaaaaatgtaatcaacagtgtctttttcatcatgattgtgttgtgtgataaaaagttaataaattgcaatacttcctggattgtaatca
Predict ORF larger than 30AA ================================================
Protein_Len: 54	Strand: +	Start: 4	End: 165
... M  G  I  T  L  Y  F  P  T  D  L  H  V  L  R  M  R  P  S  R  K  S  D  I  Q  L  S  C  A  V  K  K  H  E  H  T  N  Q  R  K  K  C  N  Q  Q  C  L  F  H  H  D  C  V  V ............................................
Protein_Len: 59	Strand: +	Start: 32	End: 208
............................... M  C  T  Y  S  G  C  D  L  L  G  N  Q  T  S  N  C  P  V  R  S  K  S  M  N  I  R  I  K  E  K  N  V  I  N  S  V  F  F  I  M  I  V  L  C  D  K  K  L  I  N  C  N  T  S  W  I  V  I .
Protein_Len: 46	Strand: -	Start: 70	End: 207
..................................................................... V  D  L  Q  G  T  R  D  F  L  M  F  M  R  I  L  S  F  F  T  I  L  L  T  K  K  M  M  I  T  N  H  S  L  F  N  I  F  Q  L  V  E  Q  I  T  M ..
Protein_Len: 31	Strand: -	Start: 3	End: 95
.. I  P  I  V  K  Y  K  G  V  S  K  C  T  S  R  I  R  G  E  R  F  D  S  M  W  S  D  Q  A  T  M ..................................................................................................................

taaatcggaattactttgtacttcccgacagatttgcacgtactccggatgcgaccttctcggaaatcagacatccaactgtcctgtgcggtcaaaaagcatgaacatacgaatcaaagaaaaaaatgtaatcaacagtgtctttttcatcatgattgtgttgtgtgataaaaagttaataaattgcaatacttcctggattgtaatca
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

taaatcggaattactttgtacttcccgacagatttgcacgtactccggatgcgaccttctcggaaatcagacatccaactgtcctgtgcggtcaaaaagcatgaacatacgaatcaaagaaaaaaatgtaatcaacagtgtctttttcatcatgattgtgttgtgtgataaaaagttaataaattgcaatacttcctggattgtaatca
Predict TransTerm conf > 70================================================
TransTerm Strand: -	Conf: 41	HP_score: -2.4	Tail_Score: -2.90496	Start: 70	End: 83	Full_Region: tttttgaccgcacag gaca gttgga tgtc tgatttccgagaagg
.....................................................................gacagttggatgtc..............................................................................................................................

Find igs database================================================
Query_seq: TF3033:TF3034|TF3033:TF3034:S1 RNA binding domain protein, S1 ribosomal protein:conserved hypothetical protein:->->:3259044..3259252 209
taaatcggaattactttgtacttcccgacagatttgcacgtactccggatgcgaccttctcggaaatcagacatccaactgtcctgtgcggtcaaaaagcatgaacatacgaatcaaagaaaaaaatgtaatcaacagtgtctttttcatcatgattgtgttgtgtgataaaaagttaataaattgcaatacttcctggattgtaatca
Intra-Species Hit: Count: 1	Min: 1	Max: 209	Len: 209
Subject: tfor_TF3033_TF3034|S1 RNA binding domain protein, S1 ribosomal protein:conserved hypothetical protein|POSITIVE:POSITIVE|[3259044,3259252]|209
HSP  1	e-value: 1.0E-102	bit: 373.0	Len: 209	Query Start:1	Query End:209	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 209
taaatcggaattactttgtacttcccgacagatttgcacgtactccggatgcgaccttctcggaaatcagacatccaactgtcctgtgcggtcaaaaagcatgaacatacgaatcaaagnnnnnnntgtaatcaacagtgtctttttcatcatgattgtgttgtgtgataaaaagttaataaattgcaatacttcctggattgtaatca
taaatcggaattactttgtacttcccgacagatttgcacgtactccggatgcgaccttctcggaaatcagacatccaactgtcctgtgcggtcaaaaagcatgaacatacgaatcaaagaaaaaaatgtaatcaacagtgtctttttcatcatgattgtgttgtgtgataaaaagttaataaattgcaatacttcctggattgtaatca

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UAAAUCGGAAUUACUUUGUACUUCCCGACAGAUUUGCACGUACUCCGGAUGCGACCUUCUCGGAAAUCAGACAUCCAACUGUCCUGUGCGGUCAAAAAGCAUGAACAUACGAAUCAAAGAAAAAAAUGUAAUCAACAGUGUCUUUUUCAUCAUGAUUGUGUUGUGUGAUAAAAAGUUAAUAAAUUGCAAUACUUCCUGGAUUGUAAUCA
......((((.(((...))).)))).(((......((((....((((((........)).)))).....((((......))))..)))).((((...((((..(.(((..(((..(((((......(((.....)))...))))))))...))).)..))))...)))).....))).....((((((((.((....)))))))))).. (-38.80)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UGAUUACAAUCCAGGAAGUAUUGCAAUUUAUUAACUUUUUAUCACACAACACAAUCAUGAUGAAAAAGACACUGUUGAUUACAUUUUUUUCUUUGAUUCGUAUGUUCAUGCUUUUUGACCGCACAGGACAGUUGGAUGUCUGAUUUCCGAGAAGGUCGCAUCCGGAGUACGUGCAAAUCUGUCGGGAAGUACAAAGUAAUUCCGAUUUA
.((((......((((((((((.(((......(((....))).........(((((((....((((((((...(((.....)))))))))))..))))).)).)))..))))))))))...((((.(((((......)))))...(((((.((........)))))))...)))).)))).(((((((..(((...))).)))))))... (-41.30)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
375	90	45	205	165	tfor:TF1586|5end_hypothetical_protein_1690971..1691201_POSITIVE
366	90	44	226	172	tfor:TF0786|5end_pyridoxal_phosphate_biosynthetic_protein_838563..838793_POSITIVE
353	58	14	98	38	tfor:TF0816|5end_hypothetical_protein_874217..874447_POSITIVE
339	60	18	60	25	tfor:TF2337|5end_conserved_hypothetical_protein_2497997..2498227_POSITIVE
338	68	21	74	20	tfor:TF1174|5end_ABC_transporter,_permease_component_1256584..1256814_POSITIVE
337	90	46	221	166	tfor:TF2979|5end_possible_outer_membrane__protein_3190778..3191008_POSITIVE
329	62	23	88	43	tfor:TF0761|5end_conserved_hypothetical_protein_806412..806642_POSITIVE
328	70	21	125	76	tfor:TF2517|5end_hypothetical_protein_2695089..2695319_POSITIVE
324	89	44	216	175	tfor:TF1804|5end_hypothetical_protein_1947101..1947331_POSITIVE
323	69	26	51	3	tfor:TF1508|5end_anti-sigma_factor_1616345..1616575_POSITIVE
323	119	73	60	9	tfor:TF0832|5end_conserved_hypothetical_protein_888466..888696_POSITIVE
322	90	44	61	8	tfor:TF2501|5end_DNA_mismatch_repair_protein_2676280..2676510_POSITIVE
322	59	17	207	165	tfor:TF2490|5end_4-hydroxyphenylacetate-3-hydroxylase/4-hydroxybut_yryl_dehydratase_2665218..2665448_POSITIVE
321	90	43	86	34	tfor:TF1475|5end_glucose-6-phosphate_1-dehydrogenase_1568034..1568264_POSITIVE
321	86	45	206	154	tfor:TF0587|5end_outer_membrane_protein_618319..618549_POSITIVE
320	88	42	196	145	tfor:TF2239|5end_hypothetical_protein_2414537..2414767_POSITIVE
319	110	61	203	151	tfor:TF2444|5end_regulatory_protein_RecX_2620957..2621187_POSITIVE
319	50	14	229	194	tfor:TF0410|5end_8-amino-7-oxononanoate_synthase_427605..427835_POSITIVE
318	89	50	227	188	tfor:TF2602|5end_tRNA-(5-methylaminomethyl-2-thiouridylate)_methyltransferase_2775086..2775316_POSITIVE
312	64	26	66	24	tfor:TF1149|5end_conserved_hypothetical_protein;_possible_branched-chain_amino_acid_aminotransferase_1229218..1229448_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
339	60	18	142	107	tfor:TF2336|3end_conserved_hypothetical_protein_2498159..2498309_POSITIVE
338	68	21	61	7	tfor:TF1173|3end_ABC_transporter,_permease_component_1256651..1256801_POSITIVE
325	61	26	103	60	tfor:TF2547|3end_hypothetical_protein_2730947..2731097_POSITIVE
321	90	43	95	43	tfor:TF1474|3end_6-phosphogluconolactonase_1568123..1568273_POSITIVE
311	53	16	74	41	tfor:TF2659|3end_conserved_hypothetical_protein_2833055..2833205_POSITIVE
310	70	21	76	36	tfor:TF1197|3end_transcriptional_regulator_1281414..1281564_POSITIVE
309	90	46	127	84	tfor:TF0350|3end_hypothetical_protein_371101..371251_POSITIVE
308	89	45	65	21	tfor:TF0300|3end_hypothetical_protein_325541..325691_POSITIVE
306	87	43	61	4	tfor:TF2575|3end_methionine_aminopeptidase_2745985..2746135_POSITIVE
306	86	44	60	23	tfor:TF0382|3end_transcription_termination_factor_405228..405378_POSITIVE
304	70	21	135	87	tfor:TF1184|3end_hypothetical_protein_1269311..1269461_POSITIVE
304	70	21	135	87	tfor:TF1183|3end_hypothetical_protein_1268728..1268878_POSITIVE
303	90	43	151	106	tfor:TF0533|3end_hypothetical_protein_559519..559669_POSITIVE
302	64	22	70	27	tfor:TF0774|3end_membrane-fusion_protein;_36_kDa_antigen_823730..823880_POSITIVE
302	64	21	47	13	tfor:TF0141|3end_exodeoxyribonuclease_VII,_large_subunit_149830..149980_POSITIVE
300	90	43	71	16	tfor:TF2805|3end_zinc_protease_2996665..2996815_POSITIVE
299	89	44	146	106	tfor:TF1524|3end_tryptophanyl-tRNA_synthetase_1632027..1632177_POSITIVE
298	52	25	65	24	tfor:TF0478|3end_conserved_hypothetical_protein_498627..498777_POSITIVE
297	90	43	60	4	tfor:TF0073|3end_possible_dTDP-glucose_4,6-dehydratase,_NAD-dependent_epimerase/dehydratase_family_82051..82201_POSITIVE
296	62	28	142	108	tfor:TF0637|3end_TPR-repeat-containing_protein_675410..675560_POSITIVE