Origin IGS: gttaaattcatgttaaatgttttcttcgggcaaaggtatacaattctataatcaacggaacgtatatcgttcttttttttgagtggcctttccatattcgatgactcggacaggacaatgatggatacataccagacattgtgtgcaatttctgccccagtgcggctttttatcgaccagtgcaatattcgcggtaagacactgtgaaacacaaagggagaagccttatcatccacgtcgaatctggaaaaaatcaccta .........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9 taggtgattttttccagattcgacgtggatgataaggcttctccctttgtgtttcacagtgtcttaccgcgaatattgcactggtcgataaaaagccgcactggggcagaaattgcacacaatgtctggtatgtatccatcattgtcctgtccgagtcatcgaatatggaaaggccactcaaaaaaaagaacgatatacgttccgttgattatagaattgtatacctttgcccgaagaaaacatttaacatgaatttaac Mask Tandem Repeat Region ================================================ gttaaattcatgttaaatgttttcttcgggcaaaggtatacaattctataatcaacggaacgtatatcgttcttttttttgagtggcctttccatattcgatgactcggacaggacaatgatggatacataccagacattgtgtgcaatttctgccccagtgcggctttttatcgaccagtgcaatattcgcggtaagacactgtgaaacacaaagggagaagccttatcatccacgtcgaatctggaaaaaatcaccta Find is-nt database================================================ Query_seq: TF1033:TF1034|TF1033:TF1034:endothelin converting enzyme, endopeptidase:conserved hypothetical protein:->->:1094943..1095202 260 gttaaattcatgttaaatgttttcttcgggcaaaggtatacaattctataatcaacggaacgtatatcgttcttttttttgagtggcctttccatattcgatgactcggacaggacaatgatggatacataccagacattgtgtgcaatttctgccccagtgcggctttttatcgaccagtgcaatattcgcggtaagacactgtgaaacacaaagggagaagccttatcatccacgtcgaatctggaaaaaatcaccta Intra-Species Hit: Count: 0 Inter-species Hit: Count: 0 Find is-aa database================================================ Query_seq: TF1033:TF1034|TF1033:TF1034:endothelin converting enzyme, endopeptidase:conserved hypothetical protein:->->:1094943..1095202 260 gttaaattcatgttaaatgttttcttcgggcaaaggtatacaattctataatcaacggaacgtatatcgttcttttttttgagtggcctttccatattcgatgactcggacaggacaatgatggatacataccagacattgtgtgcaatttctgccccagtgcggctttttatcgaccagtgcaatattcgcggtaagacactgtgaaacacaaagggagaagccttatcatccacgtcgaatctggaaaaaatcaccta Intra-Species Hit: Count: 0 Inter-species Hit: Count: 0 Find nr database================================================ Query_seq: TF1033:TF1034|TF1033:TF1034:endothelin converting enzyme, endopeptidase:conserved hypothetical protein:->->:1094943..1095202 260 gttaaattcatgttaaatgttttcttcgggcaaaggtatacaattctataatcaacggaacgtatatcgttcttttttttgagtggcctttccatattcgatgactcggacaggacaatgatggatacataccagacattgtgtgcaatttctgccccagtgcggctttttatcgaccagtgcaatattcgcggtaagacactgtgaaacacaaagggagaagccttatcatccacgtcgaatctggaaaaaatcaccta Intra-Species Hit: Count: 0 Inter-species Hit: Count: 14 Min: 61 Max: 225 Len: 165 Subject: UniRef90_A0UW66 Cluster: 4Fe-4S ferredoxin, iron-sulfur binding; n=1; Clostridium cellulolyticum H10|Rep: 4Fe-4S ferredoxin, iron-sulfur binding - Clostridium cellulolyticum H10 HSP 1 e-value: 1.0E-10 bit: 67.4 Len: 165 Query Start:61 Query End:225 Subject Strand: null Subject Start: 196 Subject End: 249 ............................................................ G F S L C V S Q C L T A N I A L V D K K P H W G R N C T Q C L V C I H H C P V R V I E Y G K A T Q K K E R Y T ................................... ............................................................ G C G I C E K V C T S K S I K - V D K R P K W G K E C T Q C L A C I N F C P T K A T Q F G K G T E K K G R Y T ................................... Subject: UniRef90_Q1FKB9 Cluster: 4Fe-4S ferredoxin, iron-sulfur binding; n=1; Clostridium phytofermentans ISDg|Rep: 4Fe-4S ferredoxin, iron-sulfur binding - Clostridium phytofermentans ISDg HSP 1 e-value: 2.0E-10 bit: 67.0 Len: 150 Query Start:64 Query End:213 Subject Strand: null Subject Start: 195 Subject End: 244 ............................................................... C V S Q C L T A N I A L V D K K P H W G R N C T Q C L V C I H H C P V R V I E Y G K A T Q K K E R Y ............................................... ............................................................... C V R S C P L N N I Q L E D K K P V W G K D C T H C M A C I C G C P I K A I E Y G K N S K S K V R Y ............................................... Subject: UniRef90_Q8AAN8 Cluster: Hypothetical protein; n=1; Bacteroides thetaiotaomicron|Rep: Hypothetical protein - Bacteroides thetaiotaomicron HSP 1 e-value: 6.0E-9 bit: 62.0 Len: 162 Query Start:64 Query End:225 Subject Strand: null Subject Start: 196 Subject End: 249 ............................................................... G F S L C V S Q C L T A N I A L V D K K P H W G R N C T Q C L V C I H H C P V R V I E Y G K A T Q K K E R Y ................................... ............................................................... G C K R C E K S C P V G N I T M K E R R P V W G K N C T A C L A C Y H V C P Q H A V Q Y G K K T K G K G H Y ................................... Subject: UniRef90_A0V1U2 Cluster: 4Fe-4S ferredoxin, iron-sulfur binding; n=1; Clostridium cellulolyticum H10|Rep: 4Fe-4S ferredoxin, iron-sulfur binding - Clostridium cellulolyticum H10 HSP 1 e-value: 8.0E-9 bit: 61.6 Len: 162 Query Start:64 Query End:225 Subject Strand: null Subject Start: 191 Subject End: 244 ............................................................... G F S L C V S Q C L T A N I A L V D K K P H W G R N C T Q C L V C I H H C P V R V I E Y G K A T Q K K E R Y ................................... ............................................................... G C G I C K K V C H L N N I E M I N K R P H W G N E C S T C L A C F H W C P K K A V K G G K M L N K R G R Y ................................... Subject: UniRef90_Q184V9 Cluster: Putative flavodoxin; n=2; Clostridium difficile|Rep: Putative flavodoxin - Clostridium difficile (strain 630) HSP 1 e-value: 1.0E-8 bit: 61.2 Len: 162 Query Start:64 Query End:225 Subject Strand: null Subject Start: 193 Subject End: 246 ............................................................... G F S L C V S Q C L T A N I A L V D K K P H W G R N C T Q C L V C I H H C P V R V I E Y G K A T Q K K E R Y ................................... ............................................................... G C G K C V E L C P L N N I N L K N K K P V W K N N C T H C M A C I C G C P T E A I E Y K N K T Q N R E R Y ................................... Subject: UniRef90_Q2WK06 Cluster: Hypothetical protein; n=1; Clostridium beijerincki NCIMB 8052|Rep: Hypothetical protein - Clostridium beijerincki NCIMB 8052 HSP 1 e-value: 4.0E-8 bit: 59.3 Len: 162 Query Start:64 Query End:225 Subject Strand: null Subject Start: 189 Subject End: 242 ............................................................... G F S L C V S Q C L T A N I A L V D K K P H W G R N C T Q C L V C I H H C P V R V I E Y G K A T Q K K E R Y ................................... ............................................................... G C G I C S N V C P A E N I E I I E A K P S W E H R C E Q C L A C I H L C P Q T A I E F K K D S I N K E R Y ................................... Subject: UniRef90_Q64VN8 Cluster: Hypothetical protein; n=2; Bacteroides fragilis|Rep: Hypothetical protein - Bacteroides fragilis HSP 1 e-value: 2.0E-7 bit: 57.0 Len: 162 Query Start:64 Query End:225 Subject Strand: null Subject Start: 196 Subject End: 249 ............................................................... G F S L C V S Q C L T A N I A L V D K K P H W G R N C T Q C L V C I H H C P V R V I E Y G K A T Q K K E R Y ................................... ............................................................... G C K R C E R I C P V G N V V M I G W R P V W G M D C T S C L A C Y H V C P K H A V Q Y G R R T K R K G Q Y ................................... Subject: UniRef90_A3CUF6 Cluster: 4Fe-4S ferredoxin, iron-sulfur binding domain protein; n=1; Methanoculleus marisnigri JR1|Rep: 4Fe-4S ferredoxin, iron-sulfur binding domain protein - Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1) HSP 1 e-value: 2.0E-7 bit: 57.0 Len: 153 Query Start:64 Query End:216 Subject Strand: null Subject Start: 199 Subject End: 249 ............................................................... L C V S Q C L T A N I A L V D K K P H W G R N C T Q C L V C I H H C P V R V I E Y G K A T Q K K E R Y ............................................ ............................................................... I C A S I C P A E N I E M V D G R P V W N H R C E L C C G C I H L C P A G A I Q A G K A T E G R Q R Y ............................................ Subject: UniRef90_Q0W7Z7 Cluster: 2(4Fe-4S) ferredoxin-domain protein; n=1; uncultured methanogenic archaeon RC-I|Rep: 2(4Fe-4S) ferredoxin-domain protein - Uncultured methanogenic archaeon RC-I HSP 1 e-value: 6.0E-7 bit: 55.5 Len: 150 Query Start:64 Query End:213 Subject Strand: null Subject Start: 84 Subject End: 133 ............................................................... C V S Q C L T A N I A L V D K K P H W G R N C T Q C L V C I H H C P V R V I E Y G K A T Q K K E R Y ............................................... ............................................................... C V K V C P V N N V T L T D R K V T W G P N C I H C L A C F H W C P A R A V E I G G K S A D I A R Y ............................................... Subject: UniRef90_Q0TNL6 Cluster: Iron-sulfur cluster-binding protein; n=3; Clostridium perfringens|Rep: Iron-sulfur cluster-binding protein - Clostridium perfringens (strain ATCC 13124 / NCTC 8237 / Type A) HSP 1 e-value: 8.0E-7 bit: 55.1 Len: 153 Query Start:64 Query End:216 Subject Strand: null Subject Start: 196 Subject End: 246 ............................................................... L C V S Q C L T A N I A L V D K K P H W G R N C T Q C L V C I H H C P V R V I E Y G K A T Q K K E R Y ............................................ ............................................................... I C A K I C P N K N I E I I D E G P K W K G N C C D C M G C V N N C P H K C I N I G N K T K K K N R Y ............................................ Subject: UniRef90_Q2WP37 Cluster: Hypothetical protein; n=1; Clostridium beijerincki NCIMB 8052|Rep: Hypothetical protein - Clostridium beijerincki NCIMB 8052 HSP 1 e-value: 8.0E-7 bit: 55.1 Len: 165 Query Start:61 Query End:225 Subject Strand: null Subject Start: 189 Subject End: 243 ............................................................ G F S L C V S Q C L T A N I A L V D K K P H W G R N C T Q C L V C I H H C P V R V I E Y G K A T Q K K E R Y T ................................... ............................................................ G C R T C E A V C P V S N I V M K N K K P S F K H N C E Q C M A C V Q W C P K Q A I N Y K N K T Q S R G R Y T ................................... Subject: UniRef90_Q2DT94 Cluster: Hypothetical protein; n=1; Geobacter uraniumreducens Rf4|Rep: Hypothetical protein - Geobacter uraniumreducens Rf4 HSP 1 e-value: 2.0E-6 bit: 53.9 Len: 153 Query Start:64 Query End:216 Subject Strand: null Subject Start: 196 Subject End: 246 ............................................................... L C V S Q C L T A N I A L V D K K P H W G R N C T Q C L V C I H H C P V R V I E Y G K A T Q K K E R Y ............................................ ............................................................... I C E R A C P V K N I T L E A G R P L W H G S C E Q C L A C I Q W C P E E C I Q Y G K K T K N Y E R Y ............................................ Subject: UniRef90_Q188R5 Cluster: Putative iron-sulfur protein; n=3; Clostridium difficile|Rep: Putative iron-sulfur protein - Clostridium difficile (strain 630) HSP 1 e-value: 3.0E-6 bit: 53.1 Len: 141 Query Start:85 Query End:225 Subject Strand: null Subject Start: 191 Subject End: 237 .................................................................................... G F S L C V S Q C L T A N I A L V D K K P H W G R N C T Q C L V C I H H C P V R V I E Y G K A ................................... .................................................................................... G C G T C K R V C P V E N I S I V D K K P K W G N E C E R C L A C F H W C P K E A I N V K K S ................................... Subject: UniRef90_Q2WTV7 Cluster: Hypothetical protein; n=1; Clostridium beijerincki NCIMB 8052|Rep: Hypothetical protein - Clostridium beijerincki NCIMB 8052 HSP 1 e-value: 4.0E-6 bit: 52.8 Len: 156 Query Start:64 Query End:219 Subject Strand: null Subject Start: 190 Subject End: 241 ............................................................... S L C V S Q C L T A N I A L V D K K P H W G R N C T Q C L V C I H H C P V R V I E Y G K A T Q K K E R Y ......................................... ............................................................... N M C K K V C P V D N I V I E N N R P K W L G K C T D C M A C I N I C P K E A I N I G K S T I K K N R Y ......................................... gttaaattcatgttaaatgttttcttcgggcaaaggtatacaattctataatcaacggaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnttatcatccacgtcgaatctggaaaaaatcaccta Predict ORF larger than 30AA ================================================ Protein_Len: 32 Strand: + Start: 6 End: 101 ..... M H V K C F L R A K V Y N S I I N G T Y I V L F F E W P F H I R ............................................................................................................................................................... Protein_Len: 47 Strand: + Start: 64 End: 204 ............................................................... M S F F F L S G L S I F D D S D R T M M D T Y Q T L C A I S A P V R L F I D Q C N I R G K T L ........................................................ Protein_Len: 45 Strand: + Start: 125 End: 259 ............................................................................................................................ M H T R H C V Q F L P Q C G F L S T S A I F A V R H C E T Q R E K P Y H P R R I W K K S P . Protein_Len: 44 Strand: - Start: 55 End: 186 ...................................................... R F T Y R E K K Q T A K G Y E I V R V P C H H I C V L C Q T C N R G W H P K K D V L A M .......................................................................... Protein_Len: 50 Strand: - Start: 11 End: 160 .......... T L H K R R A F T Y L E I I L P V Y I T R K K S H G K W I R H S P C S L S P Y M G S M T H L K Q G M .................................................................................................... Protein_Len: 60 Strand: - Start: 3 End: 257 .. K L P R E M N S S E S L V I I S V Y W V N H A I E A G T R S K I S W H L I R P L V S H F V F P S A K D D V D F R S F I M ... gttaaattcatgttaaatgttttcttcgggcaaaggtatacaattctataatcaacggaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnttatcatccacgtcgaatctggaaaaaatcaccta Predict Promoter with matrix: RpoD-15 score > 80================================================ Predict Promoter with matrix: RpoD-16 score > 80================================================ Predict Promoter with matrix: RpoD-17 score > 80================================================ Predict Promoter with matrix: RpoD-18 score > 80================================================ Predict Promoter with matrix: RpoD-19 score > 80================================================ Predict Promoter with matrix: RpoN score > 80================================================ gttaaattcatgttaaatgttttcttcgggcaaaggtatacaattctataatcaacggaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnttatcatccacgtcgaatctggaaaaaatcaccta Predict TransTerm conf > 70================================================ TransTerm Strand: - Conf: 40 HP_score: -2.2 Tail_Score: -2.67017 Start: 57 End: 73 Full_Region: ggccactcaaaaaaa agaacg atata cgttcc gttgattatagaatt ........................................................agaacgatatacgttcc........................................................................................................................................................................................... TransTerm Strand: + Conf: 100 HP_score: -5.7 Tail_Score: -5.81412 Start: 58 End: 72 Full_Region: ATTCTATAATCAACG GAACG TATAT CGTTC TTTTTTTTGAGTGGC .........................................................GAACGTATATCGTTC............................................................................................................................................................................................ TransTerm Strand: + Conf: 72 HP_score: -4.7 Tail_Score: -4.83169 Start: 154 End: 166 Full_Region: TTGTGTGCAATTTCT GCCCC AGT GCGGC TTTTTATCGACCAGT .........................................................................................................................................................GCCCCAGTGCGGC.............................................................................................. Find igs database================================================ Query_seq: TF1033:TF1034|TF1033:TF1034:endothelin converting enzyme, endopeptidase:conserved hypothetical protein:->->:1094943..1095202 260 gttaaattcatgttaaatgttttcttcgggcaaaggtatacaattctataatcaacggaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnttatcatccacgtcgaatctggaaaaaatcaccta Intra-Species Hit: Count: 1 Min: 1 Max: 260 Len: 260 Subject: tfor_TF1033_TF1034|endothelin converting enzyme, endopeptidase:conserved hypothetical protein|POSITIVE:POSITIVE|[1094943,1095202]|260 HSP 1 e-value: 5.0E-26 bit: 119.0 Len: 60 Query Start:1 Query End:60 Subject Strand: POSITIVE Subject Start: 1 Subject End: 60 gttaaattcatgttaaatgttttcttcgggcaaaggtatacaattctataatcaacggaa........................................................................................................................................................................................................ gttaaattcatgttaaatgttttcttcgggcaaaggtatacaattctataatcaacggaa........................................................................................................................................................................................................ HSP 2 e-value: 4.0E-11 bit: 69.9 Len: 35 Query Start:226 Query End:260 Subject Strand: POSITIVE Subject Start: 226 Subject End: 260 .................................................................................................................................................................................................................................ttatcatccacgtcgaatctggaaaaaatcaccta .................................................................................................................................................................................................................................ttatcatccacgtcgaatctggaaaaaatcaccta Inter-species Hit: Count: 0 Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================ GUUAAAUUCAUGUUAAAUGUUUUCUUCGGGCAAAGGUAUACAAUUCUAUAAUCAACGGAACGUAUAUCGUUCUUUUUUUUGAGUGGCCUUUCCAUAUUCGAUGACUCGGACAGGACAAUGAUGGAUACAUACCAGACAUUGUGUGCAAUUUCUGCCCCAGUGCGGCUUUUUAUCGACCAGUGCAAUAUUCGCGGUAAGACACUGUGAAACACAAAGGGAGAAGCCUUAUCAUCCACGUCGAAUCUGGAAAAAAUCACCUA ..........(((...((.(((((....)).))).))..)))..............((((((.....)))))).........((((..((((((.(((((((((((.((.((((((((((.(((.......)))..))))))........)))).)).)))..((((((((.....((..((.....((((((((.....))))))))...))..))))))))))..........)))))))).))))))...))))... (-60.00) Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================ UAGGUGAUUUUUUCCAGAUUCGACGUGGAUGAUAAGGCUUCUCCCUUUGUGUUUCACAGUGUCUUACCGCGAAUAUUGCACUGGUCGAUAAAAAGCCGCACUGGGGCAGAAAUUGCACACAAUGUCUGGUAUGUAUCCAUCAUUGUCCUGUCCGAGUCAUCGAAUAUGGAAAGGCCACUCAAAAAAAAGAACGAUAUACGUUCCGUUGAUUAUAGAAUUGUAUACCUUUGCCCGAAGAAAACAUUUAACAUGAAUUUAAC ((((((.(((((((.....((((((.(((((....(((((.(((((((.((((...((((((..((.......))..))))))...)))).))))..(.(((.((((((.........((((((..(((.......))).)))))).)))))).)))).........))).)))))..((........))........)))))))))))..........(((......)))..))))))).))))))............. (-58.00) Find mRNA Target Using Conserved IGS================================================ 5'END mRNA Target Prediction=================================== Score srna_start srna_end target_start tegart_end seq_id 376 167 123 168 127 tfor:TF2357|5end_collagenase_2522561..2522791_POSITIVE 376 209 161 213 166 tfor:TF0813|5end_glycosyl_hydrolase,_secreted_870677..870907_POSITIVE 365 239 191 162 105 tfor:TF1919|5end_hypothetical_protein_2070037..2070267_POSITIVE 365 239 191 122 65 tfor:TF1917|5end_hypothetical_protein_2069997..2070227_POSITIVE 344 194 151 51 10 tfor:TF0821|5end_hypothetical_protein_879879..880109_POSITIVE 335 115 75 165 120 tfor:TF2831|5end_ABC_transporter,_permease_component_3021317..3021547_POSITIVE 331 178 134 199 158 tfor:TF2918|5end_hypothetical_protein_3114084..3114314_POSITIVE 331 130 82 153 107 tfor:TF1924|5end_prenyltransferase,_UbiA_family_2072857..2073087_POSITIVE 331 63 21 89 45 tfor:TF0755|5end_conserved_hypothetical_protein_802763..802993_POSITIVE 328 166 127 65 26 tfor:TF3028|5end_1-deoxy-d-xylulose-5-phosphate_reductoisomerase_3251642..3251872_POSITIVE 326 198 151 189 137 tfor:TF1043|5end_conserved_hypothetical_protein;_possible_hydrolase_1105282..1105512_POSITIVE 320 238 192 196 155 tfor:TF0195|5end_outer_membrane_protein_215631..215861_POSITIVE 319 195 154 50 9 tfor:TF0777|5end_1,4-dihydroxy-2-naphthoate_octaprenyltransferase_826098..826328_POSITIVE 318 194 152 221 172 tfor:TF1933|5end_methionyl-tRNA_synthetase_2079675..2079905_POSITIVE 318 194 154 53 16 tfor:TF0951|5end_D-alanine--D-alanine_ligase_995718..995948_POSITIVE 318 199 154 220 160 tfor:TF0464|5end_precorrin_methylase_480211..480441_POSITIVE 316 200 154 202 159 tfor:TF2562|5end_50S_ribosomal_protein_L29_2739133..2739363_POSITIVE 316 208 162 222 179 tfor:TF0937|5end_ATPase,__AAA+_class_978390..978620_POSITIVE 315 196 152 219 166 tfor:TF1466|5end_DNA_gyrase_modulator_1555469..1555699_POSITIVE 311 109 61 223 167 tfor:TF0684|5end_conserved_hypothetical_protein_728853..729083_POSITIVE 3'END mRNA Target Prediction=================================== Score srna_start srna_end target_start tegart_end seq_id 365 239 191 150 93 tfor:TF1918|3end_hypothetical_protein_2070105..2070255_POSITIVE 355 110 61 144 78 tfor:TF3115|3end_possible_sugar_kinase_3352025..3352175_POSITIVE 354 200 151 60 14 tfor:TF2953|3end_possible_TonB-dependent_outer_membrane_receptor_3161501..3161651_POSITIVE 331 130 82 145 99 tfor:TF1923|3end_conserved_hypothetical_protein;_possible_phosphoserine_phosphatase_2072929..2073079_POSITIVE 326 198 151 122 70 tfor:TF1042|3end_possible_surface_antigen_with_leucine-rich_repeat_1105295..1105445_POSITIVE 320 238 192 141 100 tfor:TF0194|3end_hypothetical_protein_215656..215806_POSITIVE 319 195 154 45 4 tfor:TF0776|3end_ABC_transporter,_permease_component_826173..826323_POSITIVE 315 194 151 119 77 tfor:TF2547|3end_hypothetical_protein_2730947..2731097_POSITIVE 313 196 152 114 76 tfor:TF0145|3end_glutamine_synthetase_154718..154868_POSITIVE 311 166 124 53 20 tfor:TF0037|3end_sialic_acid-specific_9-O-acetylesterase_39991..40141_POSITIVE 311 167 121 43 4 tfor:TF0023|3end_possible_response_element_in_two_component_regulation_20233..20383_POSITIVE 309 196 154 99 46 tfor:TF0877|3end_ISPg2-related_(PGIS2-related)_transposase_931817..931967_POSITIVE 308 184 142 47 1 tfor:TF0582|3end_hemolysin-related_protein,_with_CBS_domains;_possible_gliding-motility_related_protein_613263..613413_POSITIVE 306 178 132 49 3 tfor:TF3151|3end_glyoxalase_family_protein_3386705..3386855_POSITIVE 306 195 159 67 16 tfor:TF0464|3end_precorrin_methylase_482108..482258_POSITIVE 302 195 154 71 25 tfor:TF1656|3end_possible_2-methylthioadenine_synthetase_1772505..1772655_POSITIVE 296 188 156 46 19 tfor:TF0275|3end_outer_membrane_protein_303990..304140_POSITIVE 295 169 121 66 5 tfor:TF0157|3end_conserved_hypothetical_protein_167528..167678_POSITIVE 293 194 154 81 35 tfor:TF1185|3end_hypothetical_protein_1269563..1269713_POSITIVE 293 196 151 45 7 tfor:TF0214|3end_DNA_recombination_and_repair_protein,_RecN_241571..241721_POSITIVE