Origin IGS:
tgtccctgtcgtttattttatctaccgaaacacaaaaatatgaaacatggtaagatttgccaaatcccggtacggcaaatcggtttgcccatattggcatgtcctgccgctctttgcaggacgaaacacgatacagtcaaatgcgaaataccgtattttttctaccttcgttgtagcaaatcgccctttgcctcgttatagggatgaacagtcaaacga
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
tcgtttgactgttcatccctataacgaggcaaagggcgatttgctacaacgaaggtagaaaaaatacggtatttcgcatttgactgtatcgtgtttcgtcctgcaaagagcggcaggacatgccaatatgggcaaaccgatttgccgtaccgggatttggcaaatcttaccatgtttcatatttttgtgtttcggtagataaaataaacgacagggaca

Mask Tandem Repeat Region ================================================
tgtccctgtcgtttattttatctaccgaaacacaaaaatatgaaacatggtaagatttgccaaatcccggtacggcaaatcggtttgcccatattggcatgtcctgccgctctttgcaggacgaaacacgatacagtcaaatgcgaaataccgtattttttctaccttcgttgtagcaaatcgccctttgcctcgttatagggatgaacagtcaaacga

Find is-nt database================================================
Query_seq: TF1887:TF1888|TF1887:TF1888:hypothetical protein:RNA polymerase ECF-type sigma factor:->->:2040861..2041079 219
tgtccctgtcgtttattttatctaccgaaacacaaaaatatgaaacatggtaagatttgccaaatcccggtacggcaaatcggtttgcccatattggcatgtcctgccgctctttgcaggacgaaacacgatacagtcaaatgcgaaataccgtattttttctaccttcgttgtagcaaatcgccctttgcctcgttatagggatgaacagtcaaacga
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: TF1887:TF1888|TF1887:TF1888:hypothetical protein:RNA polymerase ECF-type sigma factor:->->:2040861..2041079 219
tgtccctgtcgtttattttatctaccgaaacacaaaaatatgaaacatggtaagatttgccaaatcccggtacggcaaatcggtttgcccatattggcatgtcctgccgctctttgcaggacgaaacacgatacagtcaaatgcgaaataccgtattttttctaccttcgttgtagcaaatcgccctttgcctcgttatagggatgaacagtcaaacga
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: TF1887:TF1888|TF1887:TF1888:hypothetical protein:RNA polymerase ECF-type sigma factor:->->:2040861..2041079 219
tgtccctgtcgtttattttatctaccgaaacacaaaaatatgaaacatggtaagatttgccaaatcccggtacggcaaatcggtttgcccatattggcatgtcctgccgctctttgcaggacgaaacacgatacagtcaaatgcgaaataccgtattttttctaccttcgttgtagcaaatcgccctttgcctcgttatagggatgaacagtcaaacga
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

tgtccctgtcgtttattttatctaccgaaacacaaaaatatgaaacatggtaagatttgccaaatcccggtacggcaaatcggtttgcccatattggcatgtcctgccgctctttgcaggacgaaacacgatacagtcaaatgcgaaataccgtattttttctaccttcgttgtagcaaatcgccctttgcctcgttatagggatgaacagtcaaacga
Predict ORF larger than 30AA ================================================
Protein_Len: 39	Strand: +	Start: 57	End: 173
........................................................ M  P  N  P  G  T  A  N  R  F  A  H  I  G  M  S  C  R  S  L  Q  D  E  T  R  Y  S  Q  M  R  N  T  V  F  F  L  P  S  L ..............................................
Protein_Len: 53	Strand: +	Start: 40	End: 198
....................................... M  K  H  G  K  I  C  Q  I  P  V  R  Q  I  G  L  P  I  L  A  C  P  A  A  L  C  R  T  K  H  D  T  V  K  C  E  I  P  Y  F  F  Y  L  R  C  S  K  S  P  F  A  S  L .....................
Protein_Len: 57	Strand: +	Start: 47	End: 217
.............................................. M  V  R  F  A  K  S  R  Y  G  K  S  V  C  P  Y  W  H  V  L  P  L  F  A  G  R  N  T  I  Q  S  N  A  K  Y  R  I  F  S  T  F  V  V  A  N  R  P  L  P  R  Y  R  D  E  Q  S  N ..
Protein_Len: 44	Strand: -	Start: 25	End: 156
........................ R  F  V  F  I  H  F  M  T  L  N  A  L  D  R  Y  P  L  D  T  Q  G  Y  Q  C  T  R  G  S  K  A  P  R  F  V  I  C  D  F  A  F  Y  R  M ...............................................................
Protein_Len: 43	Strand: -	Start: 21	End: 149
.................... R  G  F  C  L  F  I  F  C  P  L  I  Q  W  I  G  T  R  C  I  P  K  G  M  N  A  H  G  A  A  R  Q  L  V  F  C  S  V  T  L  H  S  M ......................................................................
Protein_Len: 45	Strand: -	Start: 2	End: 136
. D  R  D  N  I  K  D  V  S  V  C  F  Y  S  V  H  Y  S  K  G  F  G  P  V  A  F  R  N  A  W  I  P  M  D  Q  R  E  K  C  S  S  V  R  Y  M ...................................................................................

tgtccctgtcgtttattttatctaccgaaacacaaaaatatgaaacatggtaagatttgccaaatcccggtacggcaaatcggtttgcccatattggcatgtcctgccgctctttgcaggacgaaacacgatacagtcaaatgcgaaataccgtattttttctaccttcgttgtagcaaatcgccctttgcctcgttatagggatgaacagtcaaacga
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================
PromScan Matrix: RpoD-17	Strand: -	Score: 81	Start: 35	End: 64
..................................TTTGGCAAATCTTACCATGTTTCATATTTT...........................................................................................................................................................

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

tgtccctgtcgtttattttatctaccgaaacacaaaaatatgaaacatggtaagatttgccaaatcccggtacggcaaatcggtttgcccatattggcatgtcctgccgctctttgcaggacgaaacacgatacagtcaaatgcgaaataccgtattttttctaccttcgttgtagcaaatcgccctttgcctcgttatagggatgaacagtcaaacga
Predict TransTerm conf > 70================================================

Find igs database================================================
Query_seq: TF1887:TF1888|TF1887:TF1888:hypothetical protein:RNA polymerase ECF-type sigma factor:->->:2040861..2041079 219
tgtccctgtcgtttattttatctaccgaaacacaaaaatatgaaacatggtaagatttgccaaatcccggtacggcaaatcggtttgcccatattggcatgtcctgccgctctttgcaggacgaaacacgatacagtcaaatgcgaaataccgtattttttctaccttcgttgtagcaaatcgccctttgcctcgttatagggatgaacagtcaaacga
Intra-Species Hit: Count: 1	Min: 1	Max: 219	Len: 219
Subject: tfor_TF1887_TF1888|hypothetical protein:RNA polymerase ECF-type sigma factor|POSITIVE:POSITIVE|[2040861,2041079]|219
HSP  1	e-value: 1.0E-121	bit: 434.0	Len: 219	Query Start:1	Query End:219	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 219
tgtccctgtcgtttattttatctaccgaaacacaaaaatatgaaacatggtaagatttgccaaatcccggtacggcaaatcggtttgcccatattggcatgtcctgccgctctttgcaggacgaaacacgatacagtcaaatgcgaaataccgtattttttctaccttcgttgtagcaaatcgccctttgcctcgttatagggatgaacagtcaaacga
tgtccctgtcgtttattttatctaccgaaacacaaaaatatgaaacatggtaagatttgccaaatcccggtacggcaaatcggtttgcccatattggcatgtcctgccgctctttgcaggacgaaacacgatacagtcaaatgcgaaataccgtattttttctaccttcgttgtagcaaatcgccctttgcctcgttatagggatgaacagtcaaacga

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UGUCCCUGUCGUUUAUUUUAUCUACCGAAACACAAAAAUAUGAAACAUGGUAAGAUUUGCCAAAUCCCGGUACGGCAAAUCGGUUUGCCCAUAUUGGCAUGUCCUGCCGCUCUUUGCAGGACGAAACACGAUACAGUCAAAUGCGAAAUACCGUAUUUUUUCUACCUUCGUUGUAGCAAAUCGCCCUUUGCCUCGUUAUAGGGAUGAACAGUCAAACGA
.((((((((.............(((((.....((......)).....(((((.....))))).....))))).((((((.((((((((...........((((((((........))))))))..((((((...((..(((((((......)))))))...))....))).))).))))))))...)))))).....)))))))).............. (-58.60)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UCGUUUGACUGUUCAUCCCUAUAACGAGGCAAAGGGCGAUUUGCUACAACGAAGGUAGAAAAAAUACGGUAUUUCGCAUUUGACUGUAUCGUGUUUCGUCCUGCAAAGAGCGGCAGGACAUGCCAAUAUGGGCAAACCGAUUUGCCGUACCGGGAUUUGGCAAAUCUUACCAUGUUUCAUAUUUUUGUGUUUCGGUAGAUAAAAUAAACGACAGGGACA
(((((((..((((.(((((..((....((((((...((.((((((........((((....(((((((((((.(((....)))..))))))))))).(((((((........))))))).))))......)))))).)).)))))).))..)))))..)))).((((.(((......((((....))))....)))))))....)))))))........ (-63.64)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
435	115	73	77	29	tfor:TF0816|5end_hypothetical_protein_874217..874447_POSITIVE
427	108	68	200	156	tfor:TF2770|5end_conserved_hypothetical_protein_2956308..2956538_POSITIVE
404	110	65	179	137	tfor:TF2259|5end_transfer_region-related_protein,_TraK_2429577..2429807_POSITIVE
399	109	66	185	141	tfor:TF2022|5end_conserved_hypothetical_protein_2178524..2178754_POSITIVE
397	209	166	230	195	tfor:TF0543|5end_glycine_cleavage_system_p-protein_572251..572481_POSITIVE
385	130	95	229	191	tfor:TF3065|5end_enolase_3291055..3291285_POSITIVE
383	209	166	229	193	tfor:TF1845|5end_hypothetical_protein_1996620..1996850_POSITIVE
379	130	81	72	13	tfor:TF2014|5end_dipeptidyl_aminopeptidase_IV_2169398..2169628_POSITIVE
377	109	61	211	158	tfor:TF1833|5end_2-isopropylmalate_synthase_1981511..1981741_POSITIVE
376	119	73	82	28	tfor:TF2439|5end_conserved_hypothetical_protein_2616380..2616610_POSITIVE
375	124	81	223	172	tfor:TF2904|5end_ATP-dependent__helicase,_possible_UvrD/REP_helicase_domain_protein_3098903..3099133_POSITIVE
375	209	166	73	38	tfor:TF2817|5end_hypothetical_protein_3007358..3007588_POSITIVE
375	209	166	138	103	tfor:TF1182|5end_hypothetical_protein_1268565..1268795_POSITIVE
370	120	73	75	18	tfor:TF0301|5end_outer_membrane_protein,_TonB_dependent_receptor_325457..325687_POSITIVE
366	109	64	209	149	tfor:TF1194|5end_glycogen_debranching_enzyme_1276627..1276857_POSITIVE
365	110	65	225	190	tfor:TF2307|5end_two-component_system_sensor_histidine_kinase/response_2462618..2462848_POSITIVE
365	120	72	225	167	tfor:TF2157|5end_conserved_hypothetical_protein_2332915..2333145_POSITIVE
364	110	64	40	2	tfor:TF2893|5end_conserved_hypothetical_protein;_possible_phosphoesterase_3080766..3080996_POSITIVE
364	124	87	57	1	tfor:TF0969|5end_oxidoreductase_1019550..1019780_POSITIVE
364	120	73	197	157	tfor:TF0265|5end_conserved_hypothetical_protein,_Rhs_family_293279..293509_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
406	120	71	149	89	tfor:TF1097|3end_hypothetical_protein_1165893..1166043_POSITIVE
404	110	65	144	102	tfor:TF2257|3end_transfer_region-related_protein,_TraJ_2429622..2429772_POSITIVE
390	138	95	87	40	tfor:TF3064|3end_oxidoreductase,_aldo/keto_reductase_family_3290984..3291134_POSITIVE
387	120	73	151	100	tfor:TF1815|3end_conserved_hypothetical_protein_1957442..1957592_POSITIVE
377	109	61	122	69	tfor:TF1832|3end_3-isopropylmalate_dehydratase,_small_subunit_1981502..1981652_POSITIVE
375	209	166	138	103	tfor:TF1186|3end_hypothetical_protein_1269815..1269965_POSITIVE
370	109	61	112	67	tfor:TF1848|3end_conserved_hypothetical_protein_1997944..1998094_POSITIVE
370	120	73	79	22	tfor:TF0300|3end_hypothetical_protein_325541..325691_POSITIVE
354	129	83	111	45	tfor:TF2245|3end_conserved_hypothetical_protein_2421291..2421441_POSITIVE
353	109	68	60	20	tfor:TF2260|3end_transfer_region-related_protein,_TraL_2430592..2430742_POSITIVE
345	119	74	118	74	tfor:TF3021|3end_FKBP-type_peptidyl-prolyl_cis-trans_isomerase_3246194..3246344_POSITIVE
344	109	66	54	11	tfor:TF0214|3end_DNA_recombination_and_repair_protein,_RecN_241571..241721_POSITIVE
341	109	61	105	55	tfor:TF0567|3end_conserved_hypothetical_protein;_possible_periplasmic_solute-binding_protein_600134..600284_POSITIVE
337	110	65	151	96	tfor:TF2548|3end_30S_ribosomal_protein_S12_2731704..2731854_POSITIVE
336	130	82	45	1	tfor:TF1872|3end_ABC_transporter,_ATP-binding/permease_component_2026811..2026961_POSITIVE
336	130	82	45	1	tfor:TF1130|3end_ABC_transporter_ATP-binding_protein/permease_component_1207677..1207827_POSITIVE
336	123	82	107	63	tfor:TF1042|3end_possible_surface_antigen_with_leucine-rich_repeat_1105295..1105445_POSITIVE
336	98	58	60	15	tfor:TF0818|3end_bifunctional_protein:__aspartokinase_I;_homoserine_dehydrogenase_878517..878667_POSITIVE
334	119	73	151	89	tfor:TF2221|3end_CTn_excision_protein_2394229..2394379_POSITIVE
329	110	67	86	37	tfor:TF2000|3end_conserved_hypothetical_protein_2155483..2155633_POSITIVE