Origin IGS:
tgaggatacacgtcggggtgaagtgttcggaaagttccgaaccgttttccgtgtactttttcgccgtttcatccgtcaggctgattgttcgatcgcacaggcaacggggggatacaaaagaaaggatgcccttcaccatacggaagaagcatcctttactacattattcaaagggggtgatcgatca
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
tgatcgatcaccccctttgaataatgtagtaaaggatgcttcttccgtatggtgaagggcatcctttcttttgtatccccccgttgcctgtgcgatcgaacaatcagcctgacggatgaaacggcgaaaaagtacacggaaaacggttcggaactttccgaacacttcaccccgacgtgtatcctca

Mask Tandem Repeat Region ================================================
tgaggatacacgtcggggtgaagtgttcggaaagttccgaaccgttttccgtgtactttttcgccgtttcatccgtcaggctgattgttcgatcgcacaggcaacggggggatacaaaagaaaggatgcccttcaccatacggaagaagcatcctttactacattattcaaagggggtgatcgatca

Find is-nt database================================================
Query_seq: TF1730:TF1733|TF1730:TF1733:diaminopimelate decarboxylase:conserved hypothetical protein:->->:1855968..1856154 187
tgaggatacacgtcggggtgaagtgttcggaaagttccgaaccgttttccgtgtactttttcgccgtttcatccgtcaggctgattgttcgatcgcacaggcaacggggggatacaaaagaaaggatgcccttcaccatacggaagaagcatcctttactacattattcaaagggggtgatcgatca
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: TF1730:TF1733|TF1730:TF1733:diaminopimelate decarboxylase:conserved hypothetical protein:->->:1855968..1856154 187
tgaggatacacgtcggggtgaagtgttcggaaagttccgaaccgttttccgtgtactttttcgccgtttcatccgtcaggctgattgttcgatcgcacaggcaacggggggatacaaaagaaaggatgcccttcaccatacggaagaagcatcctttactacattattcaaagggggtgatcgatca
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: TF1730:TF1733|TF1730:TF1733:diaminopimelate decarboxylase:conserved hypothetical protein:->->:1855968..1856154 187
tgaggatacacgtcggggtgaagtgttcggaaagttccgaaccgttttccgtgtactttttcgccgtttcatccgtcaggctgattgttcgatcgcacaggcaacggggggatacaaaagaaaggatgcccttcaccatacggaagaagcatcctttactacattattcaaagggggtgatcgatca
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

tgaggatacacgtcggggtgaagtgttcggaaagttccgaaccgttttccgtgtactttttcgccgtttcatccgtcaggctgattgttcgatcgcacaggcaacggggggatacaaaagaaaggatgcccttcaccatacggaagaagcatcctttactacattattcaaagggggtgatcgatca
Predict ORF larger than 30AA ================================================
Protein_Len: 31	Strand: +	Start: 85	End: 177
.................................................................................... M  F  D  R  T  G  N  G  G  I  Q  K  K  G  C  P  S  P  Y  G  R  S  I  L  Y  Y  I  I  Q  R  G ..........
Protein_Len: 60	Strand: +	Start: 6	End: 185
..... M  H  V  G  V  K  C  S  E  S  S  E  P  F  S  V  Y  F  F  A  V  S  S  V  R  L  I  V  R  S  H  R  Q  R  G  D  T  K  E  R  M  P  F  T  I  R  K  K  H  P  L  L  H  Y  S  K  G  V  I  D ..
Protein_Len: 55	Strand: +	Start: 23	End: 187
...................... M  F  G  K  F  R  T  V  F  R  V  L  F  R  R  F  I  R  Q  A  D  C  S  I  A  Q  A  T  G  G  Y  K  R  K  D  A  L  H  H  T  E  E  A  S  F  T  T  L  F  K  G  G  D  R  S 
Protein_Len: 46	Strand: -	Start: 2	End: 139
. L  I  C  T  P  T  F  H  E  S  L  E  S  G  N  E  T  Y  K  K  A  T  E  D  T  L  S  I  T  R  D  C  L  C  R  P  S  V  F  S  L  I  G  K  V  M ................................................

tgaggatacacgtcggggtgaagtgttcggaaagttccgaaccgttttccgtgtactttttcgccgtttcatccgtcaggctgattgttcgatcgcacaggcaacggggggatacaaaagaaaggatgcccttcaccatacggaagaagcatcctttactacattattcaaagggggtgatcgatca
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

tgaggatacacgtcggggtgaagtgttcggaaagttccgaaccgttttccgtgtactttttcgccgtttcatccgtcaggctgattgttcgatcgcacaggcaacggggggatacaaaagaaaggatgcccttcaccatacggaagaagcatcctttactacattattcaaagggggtgatcgatca
Predict TransTerm conf > 70================================================
TransTerm Strand: -	Conf: 73	HP_score: -6.4	Tail_Score: -4.52589	Start: 120	End: 134	Full_Region: cttcttccgtatggt gaaggg cat cctttc ttttgtatccccccg
.......................................................................................................................gaagggcatcctttc.....................................................
TransTerm Strand: -	Conf: 72	HP_score: -4.1	Tail_Score: -4.83243	Start: 124	End: 154	Full_Region: gaataatgtagtaaa ggatgcttcttc cgtatggt gaagggcatcc tttcttttgtatccc
...........................................................................................................................ggatgcttcttccgtatggtgaagggcatcc.................................

Find igs database================================================
Query_seq: TF1730:TF1733|TF1730:TF1733:diaminopimelate decarboxylase:conserved hypothetical protein:->->:1855968..1856154 187
tgaggatacacgtcggggtgaagtgttcggaaagttccgaaccgttttccgtgtactttttcgccgtttcatccgtcaggctgattgttcgatcgcacaggcaacggggggatacaaaagaaaggatgcccttcaccatacggaagaagcatcctttactacattattcaaagggggtgatcgatca
Intra-Species Hit: Count: 1	Min: 1	Max: 187	Len: 187
Subject: tfor_TF1730_TF1733|diaminopimelate decarboxylase:conserved hypothetical protein|POSITIVE:POSITIVE|[1855968,1856154]|187
HSP  1	e-value: 1.0E-102	bit: 371.0	Len: 187	Query Start:1	Query End:187	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 187
tgaggatacacgtcggggtgaagtgttcggaaagttccgaaccgttttccgtgtactttttcgccgtttcatccgtcaggctgattgttcgatcgcacaggcaacggggggatacaaaagaaaggatgcccttcaccatacggaagaagcatcctttactacattattcaaagggggtgatcgatca
tgaggatacacgtcggggtgaagtgttcggaaagttccgaaccgttttccgtgtactttttcgccgtttcatccgtcaggctgattgttcgatcgcacaggcaacggggggatacaaaagaaaggatgcccttcaccatacggaagaagcatcctttactacattattcaaagggggtgatcgatca

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UGAGGAUACACGUCGGGGUGAAGUGUUCGGAAAGUUCCGAACCGUUUUCCGUGUACUUUUUCGCCGUUUCAUCCGUCAGGCUGAUUGUUCGAUCGCACAGGCAACGGGGGGAUACAAAAGAAAGGAUGCCCUUCACCAUACGGAAGAAGCAUCCUUUACUACAUUAUUCAAAGGGGGUGAUCGAUCA
.(((((...(((.(((((....(.(((((((....))))))))...))))))))...)))))......(((.((....)).)))..(.((((((((...(....)....(((((....(((((((((((.((((........))))..))))))))).))....))))).......)))))))).). (-56.20)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UGAUCGAUCACCCCCUUUGAAUAAUGUAGUAAAGGAUGCUUCUUCCGUAUGGUGAAGGGCAUCCUUUCUUUUGUAUCCCCCCGUUGCCUGUGCGAUCGAACAAUCAGCCUGACGGAUGAAACGGCGAAAAAGUACACGGAAAACGGUUCGGAACUUUCCGAACACUUCACCCCGACGUGUAUCCUCA
.((..((((((.........((((...((.((((((((((.(((((.....).)))))))))))))))).)))).......((((.(((((((..(((.....(((.((....)).))).....)))....))))).))..))))(((((((....))))))).............))).))).)). (-47.90)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
466	110	63	54	5	tfor:TF2165|5end_hypothetical_protein_2341654..2341884_POSITIVE
437	108	62	206	145	tfor:TF2820|5end_argininosuccinate_synthetase_3009876..3010106_POSITIVE
427	110	63	84	35	tfor:TF2108|5end_hypothetical_protein_2277385..2277615_POSITIVE
425	115	72	218	160	tfor:TF0962|5end_possible_amidohydrolase_1011593..1011823_POSITIVE
401	88	42	216	159	tfor:TF2682|5end_N_utilization_substance_protein_A_2856308..2856538_POSITIVE
400	110	62	91	56	tfor:TF2010|5end_hypothetical_protein_2163246..2163476_POSITIVE
399	51	11	154	111	tfor:TF1898|5end_RNA_polymerase_ECF-type_sigma_factor_2052115..2052345_POSITIVE
397	110	62	94	40	tfor:TF2296|5end_hypothetical_protein_2448892..2449122_POSITIVE
396	109	63	231	175	tfor:TF1494|5end_cobinamide_kinase/cobinamide_phosphate_guanylyltransferase_1594016..1594246_POSITIVE
390	163	127	223	182	tfor:TF1651|5end_integrase_1761296..1761526_POSITIVE
388	110	61	145	97	tfor:TF1182|5end_hypothetical_protein_1268565..1268795_POSITIVE
383	110	65	203	159	tfor:TF2177|5end_hypothetical_protein_2349281..2349511_POSITIVE
382	104	62	169	126	tfor:TF2315|5end_thioesterase_2473996..2474226_POSITIVE
375	113	74	180	138	tfor:TF1886|5end_auxin-regulated_protein_2038720..2038950_POSITIVE
375	116	74	70	23	tfor:TF0518|5end_glutaminyl-tRNA_synthetase_541770..542000_POSITIVE
374	109	63	69	22	tfor:TF1250|5end_possible_cation_efflux_pump_1332324..1332554_POSITIVE
374	110	62	104	47	tfor:TF0546|5end_conserved_hypothetical_protein_576380..576610_POSITIVE
374	59	11	161	120	tfor:TF0229|5end_beta-galactosidase_254857..255087_POSITIVE
373	110	63	102	57	tfor:TF2747|5end_heat_shock_protein,_HSP90_family_2928279..2928509_POSITIVE
370	109	61	224	167	tfor:TF2782|5end_conserved_hypothetical_protein_2966455..2966685_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
427	110	63	55	6	tfor:TF2107|3end_hypothetical_protein_2277436..2277586_POSITIVE
399	51	11	66	23	tfor:TF1897|3end_conserved_hypothetical_protein;_possible_aminopeptidase_2052107..2052257_POSITIVE
388	110	61	145	97	tfor:TF1186|3end_hypothetical_protein_1269815..1269965_POSITIVE
382	104	62	137	94	tfor:TF2314|3end_conserved_hypothetical_protein_2474044..2474194_POSITIVE
375	113	74	131	89	tfor:TF1885|3end_conserved_hypothetical_protein_2038751..2038901_POSITIVE
374	110	62	97	40	tfor:TF0545|3end_glucose-inhibited_division_protein_B_576453..576603_POSITIVE
369	109	69	87	43	tfor:TF1178|3end_sigma-54_dependent_DNA-binding_response_regulator_1266128..1266278_POSITIVE
369	107	61	87	30	tfor:TF0599|3end_hypothetical_protein_630130..630280_POSITIVE
362	112	73	67	35	tfor:TF2808|3end_bacterial_sugar_transferase_2999909..3000059_POSITIVE
362	57	11	79	36	tfor:TF1173|3end_ABC_transporter,_permease_component_1256651..1256801_POSITIVE
359	55	12	82	33	tfor:TF1738|3end_outer_membrane_protein_1866946..1867096_POSITIVE
352	107	62	119	64	tfor:TF0825|3end_hypothetical_protein_883850..884000_POSITIVE
350	84	41	45	12	tfor:TF0023|3end_possible_response_element_in_two_component_regulation_20233..20383_POSITIVE
349	110	61	91	48	tfor:TF2640|3end_hypothetical_protein_2809533..2809683_POSITIVE
348	109	62	52	9	tfor:TF0822|3end_hypothetical_protein_880764..880914_POSITIVE
347	54	11	102	56	tfor:TF2853|3end_2-C-methyl-D-erythritol_2,4-cyclodiphosphate_synthase_3040725..3040875_POSITIVE
344	48	1	69	24	tfor:TF2652|3end_hypothetical_protein_2822122..2822272_POSITIVE
344	110	64	68	7	tfor:TF2266|3end_transfer_region-related_protein,_TraQ_2434949..2435099_POSITIVE
342	115	73	146	97	tfor:TF0708|3end_possible_alkaline_phosphatase_753836..753986_POSITIVE
341	55	14	110	67	tfor:TF0001|3end_hypothetical_protein_158..308_POSITIVE