Origin IGS:
tagtttagtagtattgaaacgagatatcatatgataataaaagatatacaaggatgtgtagaaagtcagacgtttgactgcaagagcattcaaatagccccgaaggtattggctattcccatcgttgcatttgcaaaaatcatttcttaacttctgataatatgcacttataagaaccagagaaaat
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
attttctctggttcttataagtgcatattatcagaagttaagaaatgatttttgcaaatgcaacgatgggaatagccaataccttcggggctatttgaatgctcttgcagtcaaacgtctgactttctacacatccttgtatatcttttattatcatatgatatctcgtttcaatactactaaacta

Mask Tandem Repeat Region ================================================
tagtttagtagtattgaaacgagatatcatatgataataaaagatatacaaggatgtgtagaaagtcagacgtttgactgcaagagcattcaaatagccccgaaggtattggctattcccatcgttgcatttgcaaaaatcatttcttaacttctgataatatgcacttataagaaccagagaaaat

Find is-nt database================================================
Query_seq: TF2956:TF2958|TF2956:TF2958:conserved hypothetical protein:type I restriction-modification system R subunit:->->:3166526..3166712 187
tagtttagtagtattgaaacgagatatcatatgataataaaagatatacaaggatgtgtagaaagtcagacgtttgactgcaagagcattcaaatagccccgaaggtattggctattcccatcgttgcatttgcaaaaatcatttcttaacttctgataatatgcacttataagaaccagagaaaat
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: TF2956:TF2958|TF2956:TF2958:conserved hypothetical protein:type I restriction-modification system R subunit:->->:3166526..3166712 187
tagtttagtagtattgaaacgagatatcatatgataataaaagatatacaaggatgtgtagaaagtcagacgtttgactgcaagagcattcaaatagccccgaaggtattggctattcccatcgttgcatttgcaaaaatcatttcttaacttctgataatatgcacttataagaaccagagaaaat
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: TF2956:TF2958|TF2956:TF2958:conserved hypothetical protein:type I restriction-modification system R subunit:->->:3166526..3166712 187
tagtttagtagtattgaaacgagatatcatatgataataaaagatatacaaggatgtgtagaaagtcagacgtttgactgcaagagcattcaaatagccccgaaggtattggctattcccatcgttgcatttgcaaaaatcatttcttaacttctgataatatgcacttataagaaccagagaaaat
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

tagtttagtagtattgaaacgagatatcatatgataataaaagatatacaaggatgtgtagaaagtcagacgtttgactgcaagagcattcaaatagccccgaaggtattggctattcccatcgttgcatttgcaaaaatcatttcttaacttctgataatatgcacttataagaaccagagaaaat
Predict ORF larger than 30AA ================================================
Protein_Len: 45	Strand: +	Start: 13	End: 147
............ M  E  T  R  Y  H  M  I  I  K  D  I  Q  G  C  V  E  S  Q  T  F  D  C  K  S  I  Q  I  A  P  K  V  L  A  I  P  I  V  A  F  A  K  I  I  S ........................................
Protein_Len: 31	Strand: +	Start: 78	End: 170
............................................................................. M  Q  E  H  S  N  S  P  E  G  I  G  Y  S  H  R  C  I  C  K  N  H  F  L  T  S  D  N  M  H  L .................
Protein_Len: 34	Strand: -	Start: 8	End: 109
....... Y  Y  Q  F  S  I  D  Y  S  L  L  L  Y  V  L  I  H  L  F  D  S  T  Q  S  C  S  C  E  F  L  G  S  P  M ..............................................................................
Protein_Len: 60	Strand: -	Start: 1	End: 180
 L  K  T  T  N  F  R  S  I  M  H  Y  Y  F  I  Y  L  S  T  Y  F  T  L  R  K  V  A  L  A  N  L  Y  G  R  L  Y  Q  S  N  G  D  N  C  K  C  F  D  N  R  L  K  Q  Y  Y  A  S  I  L  V  M .......

tagtttagtagtattgaaacgagatatcatatgataataaaagatatacaaggatgtgtagaaagtcagacgtttgactgcaagagcattcaaatagccccgaaggtattggctattcccatcgttgcatttgcaaaaatcatttcttaacttctgataatatgcacttataagaaccagagaaaat
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================
PromScan Matrix: RpoD-17	Strand: -	Score: 82	Start: 34	End: 63
.................................TTCTACACATCCTTGTATATCTTTTATTAT............................................................................................................................

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

tagtttagtagtattgaaacgagatatcatatgataataaaagatatacaaggatgtgtagaaagtcagacgtttgactgcaagagcattcaaatagccccgaaggtattggctattcccatcgttgcatttgcaaaaatcatttcttaacttctgataatatgcacttataagaaccagagaaaat
Predict TransTerm conf > 70================================================

Find igs database================================================
Query_seq: TF2956:TF2958|TF2956:TF2958:conserved hypothetical protein:type I restriction-modification system R subunit:->->:3166526..3166712 187
tagtttagtagtattgaaacgagatatcatatgataataaaagatatacaaggatgtgtagaaagtcagacgtttgactgcaagagcattcaaatagccccgaaggtattggctattcccatcgttgcatttgcaaaaatcatttcttaacttctgataatatgcacttataagaaccagagaaaat
Intra-Species Hit: Count: 1	Min: 1	Max: 187	Len: 187
Subject: tfor_TF2956_TF2958|conserved hypothetical protein:type I restriction-modification system R subunit|POSITIVE:POSITIVE|[3166526,3166712]|187
HSP  1	e-value: 1.0E-102	bit: 371.0	Len: 187	Query Start:1	Query End:187	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 187
tagtttagtagtattgaaacgagatatcatatgataataaaagatatacaaggatgtgtagaaagtcagacgtttgactgcaagagcattcaaatagccccgaaggtattggctattcccatcgttgcatttgcaaaaatcatttcttaacttctgataatatgcacttataagaaccagagaaaat
tagtttagtagtattgaaacgagatatcatatgataataaaagatatacaaggatgtgtagaaagtcagacgtttgactgcaagagcattcaaatagccccgaaggtattggctattcccatcgttgcatttgcaaaaatcatttcttaacttctgataatatgcacttataagaaccagagaaaat

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UAGUUUAGUAGUAUUGAAACGAGAUAUCAUAUGAUAAUAAAAGAUAUACAAGGAUGUGUAGAAAGUCAGACGUUUGACUGCAAGAGCAUUCAAAUAGCCCCGAAGGUAUUGGCUAUUCCCAUCGUUGCAUUUGCAAAAAUCAUUUCUUAACUUCUGAUAAUAUGCACUUAUAAGAACCAGAGAAAAU
.......((((...((.(((((..((((....))))...............((((((......((((((....))))))......)))))).(((((((.(....)....)))))))....))))).)).))))........((((((...((((.((((.......)))).))))...)))))).. (-35.10)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
AUUUUCUCUGGUUCUUAUAAGUGCAUAUUAUCAGAAGUUAAGAAAUGAUUUUUGCAAAUGCAACGAUGGGAAUAGCCAAUACCUUCGGGGCUAUUUGAAUGCUCUUGCAGUCAAACGUCUGACUUUCUACACAUCCUUGUAUAUCUUUUAUUAUCAUAUGAUAUCUCGUUUCAAUACUACUAAACUA
......((((((...(((......)))..))))))......(((((((.........((((((.((((.((((((((.....(....)))))))))...(((....)))((((......))))........)))).)))))).........((((....))))..)))))))............... (-36.00)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
400	128	85	222	164	tfor:TF1191|5end_possible_transcriptional_regulator_1273615..1273845_POSITIVE
398	130	86	50	6	tfor:TF2704|5end_ribonuclease_HII_2876242..2876472_POSITIVE
357	119	72	133	82	tfor:TF2218|5end_two-component_system_response_regulator_2390162..2390392_POSITIVE
333	120	79	95	52	tfor:TF0255|5end_conserved_hypothetical_protein_285807..286037_POSITIVE
326	105	61	106	52	tfor:TF2966|5end_hypothetical_protein_3176948..3177178_POSITIVE
316	135	97	49	7	tfor:TF1788|5end_conserved_hypothetical_protein_1927415..1927645_POSITIVE
313	115	71	151	102	tfor:TF2189|5end_conserved_hypothetical_protein_2363455..2363685_POSITIVE
313	127	84	152	110	tfor:TF0754|5end_GDP-4-keto-6-deoxy-D-mannose-3,5-epimerase-4-redu_ctase_(GDP-L-fucose_synthetase)_801631..801861_POSITIVE
308	135	94	85	30	tfor:TF0679|5end_hypothetical_protein_721155..721385_POSITIVE
305	134	94	91	41	tfor:TF2191|5end_hypothetical_protein_2365934..2366164_POSITIVE
305	130	82	210	158	tfor:TF1327|5end_L-fucose_permease_1405790..1406020_POSITIVE
305	134	94	226	176	tfor:TF0823|5end_conserved_hypothetical_protein_880660..880890_POSITIVE
305	134	94	53	3	tfor:TF0822|5end_hypothetical_protein_880487..880717_POSITIVE
299	128	84	181	126	tfor:TF2908|5end_transcriptional_regulator,_AraC_family_3103696..3103926_POSITIVE
298	128	82	212	161	tfor:TF2649|5end_fumarate_reductase/succinate_dehydrogenase,_flavoprotein_subunit_2819002..2819232_POSITIVE
297	145	102	75	34	tfor:TF0331|5end_hypothetical_protein_359074..359304_POSITIVE
296	100	51	177	132	tfor:TF1850|5end_Na+/H+-exchanging_protein_1998542..1998772_POSITIVE
296	124	87	195	165	tfor:TF1808|5end_DNA_processing_protein_subunit_A_1949356..1949586_POSITIVE
296	99	51	166	118	tfor:TF0298|5end_dipeptidase_323127..323357_POSITIVE
295	120	71	198	135	tfor:TF1446|5end_hypothetical_protein_1530649..1530879_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
398	130	86	45	1	tfor:TF2703|3end_conserved_hypothetical_protein_2876317..2876467_POSITIVE
357	119	72	56	5	tfor:TF2217|3end_hypothetical_protein_2390165..2390315_POSITIVE
320	169	124	50	8	tfor:TF0790|3end_conserved_hypothetical_protein_844794..844944_POSITIVE
313	115	71	151	102	tfor:TF2188|3end_conserved_hypothetical_protein_2363535..2363685_POSITIVE
308	120	72	52	3	tfor:TF2965|3end_conserved_hypothetical_protein_3176962..3177112_POSITIVE
299	128	84	86	31	tfor:TF2907|3end_CDP-diacylglycerol-serine-O-phosphatidyltransfera_se_3103681..3103831_POSITIVE
297	145	102	67	26	tfor:TF0330|3end_excinuclease_ABC,_subunit_A_359146..359296_POSITIVE
295	134	105	89	58	tfor:TF0783|3end_periplasmic_TonB_membrane-linking_protein_837465..837615_POSITIVE
292	114	72	122	68	tfor:TF2392|3end_alpha-galactosidase_2565506..2565656_POSITIVE
288	133	97	86	46	tfor:TF2848|3end_cobalamin_biosynthesis_protein_3037389..3037539_POSITIVE
287	128	92	62	20	tfor:TF2342|3end_glutathione_peroxidase_2506639..2506789_POSITIVE
287	87	49	63	23	tfor:TF2171|3end_hypothetical_protein_2345792..2345942_POSITIVE
285	129	82	78	25	tfor:TF0405|3end_conserved_hypothetical_protein_424308..424458_POSITIVE
284	138	97	80	24	tfor:TF1771|3end_prolipoprotein_diacylglyceryl_transferase_1910607..1910757_POSITIVE
276	129	83	125	80	tfor:TF1312|3end_hypothetical_protein_1388781..1388931_POSITIVE
274	123	84	148	112	tfor:TF0752|3end_nucleotide-binding_protein;_MAF-like_protein_801713..801863_POSITIVE
273	128	85	138	90	tfor:TF1182|3end_hypothetical_protein_1268938..1269088_POSITIVE
272	113	73	150	111	tfor:TF3157|3end_sodium/solute_symporter_3393787..3393937_POSITIVE
271	126	81	131	78	tfor:TF0047|3end_hypothetical_protein_54109..54259_POSITIVE
268	106	65	67	23	tfor:TF1588|3end_hypothetical_protein_1702560..1702710_POSITIVE