Origin IGS:
cttttctcgttgttctttttttaaatccggggcagagattgtggcacggaaagggagaaactgttcgttttttctctctcaaagtcgtgcttatctttgcttttcggggtgcaaagatacaaaaaaactacattctcgattatatttattatttttgcgccgactgttgataaagcatcaataacaagagcaa
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
ttgctcttgttattgatgctttatcaacagtcggcgcaaaaataataaatataatcgagaatgtagtttttttgtatctttgcaccccgaaaagcaaagataagcacgactttgagagagaaaaaacgaacagtttctccctttccgtgccacaatctctgccccggatttaaaaaaagaacaacgagaaaag

Mask Tandem Repeat Region ================================================
cttttctcgttgttctttttttaaatccggggcagagattgtggcacggaaagggagaaactgttcgttttttctctctcaaagtcgtgcttatctttgcttttcggggtgcaaagatacaaaaaaactacattctcgattatatttattatttttgcgccgactgttgataaagcatcaataacaagagcaa

Find is-nt database================================================
Query_seq: TF2655:TF2656|TF2655:TF2656:DNA topoisomerase I:valyl-tRNA synthetase:->->:2827023..2827215 193
cttttctcgttgttctttttttaaatccggggcagagattgtggcacggaaagggagaaactgttcgttttttctctctcaaagtcgtgcttatctttgcttttcggggtgcaaagatacaaaaaaactacattctcgattatatttattatttttgcgccgactgttgataaagcatcaataacaagagcaa
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: TF2655:TF2656|TF2655:TF2656:DNA topoisomerase I:valyl-tRNA synthetase:->->:2827023..2827215 193
cttttctcgttgttctttttttaaatccggggcagagattgtggcacggaaagggagaaactgttcgttttttctctctcaaagtcgtgcttatctttgcttttcggggtgcaaagatacaaaaaaactacattctcgattatatttattatttttgcgccgactgttgataaagcatcaataacaagagcaa
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: TF2655:TF2656|TF2655:TF2656:DNA topoisomerase I:valyl-tRNA synthetase:->->:2827023..2827215 193
cttttctcgttgttctttttttaaatccggggcagagattgtggcacggaaagggagaaactgttcgttttttctctctcaaagtcgtgcttatctttgcttttcggggtgcaaagatacaaaaaaactacattctcgattatatttattatttttgcgccgactgttgataaagcatcaataacaagagcaa
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

cttttctcgttgttctttttttaaatccggggcagagattgtggcacggaaagggagaaactgttcgttttttctctctcaaagtcgtgcttatctttgcttttcggggtgcaaagatacaaaaaaactacattctcgattatatttattatttttgcgccgactgttgataaagcatcaataacaagagcaa
Predict ORF larger than 30AA ================================================
Protein_Len: 43	Strand: +	Start: 39	End: 167
...................................... M  W  H  G  K  G  E  T  V  R  F  F  S  L  K  V  V  L  I  F  A  F  R  G  A  K  I  Q  K  N  Y  I  L  D  Y  I  Y  Y  F  C  A  D  C ..........................
Protein_Len: 48	Strand: +	Start: 38	End: 181
..................................... M  V  A  R  K  G  R  N  C  S  F  F  L  S  Q  S  R  A  Y  L  C  F  S  G  C  K  D  T  K  K  L  H  S  R  L  Y  L  L  F  L  R  R  L  L  I  K  H  Q ............
Protein_Len: 56	Strand: +	Start: 25	End: 192
........................ M  R  G  R  D  C  G  T  E  R  E  K  L  F  V  F  S  L  S  K  S  C  L  S  L  L  F  G  V  Q  R  Y  K  K  T  T  F  S  I  I  F  I  I  F  A  P  T  V  D  K  A  S  I  T  R  A .
Protein_Len: 53	Strand: -	Start: 24	End: 182
....................... I  R  P  L  S  Q  P  V  S  L  S  F  S  N  T  K  E  R  E  F  D  H  K  D  K  S  K  P  T  C  L  Y  L  F  V  V  N  E  I  I  N  I  I  K  A  G  V  T  S  L  A  D  M ...........
Protein_Len: 39	Strand: -	Start: 2	End: 118
. K  R  T  T  R  K  K  F  G  P  C  L  N  H  C  P  F  P  S  V  T  R  K  K  E  R  L  T  T  S  I  K  A  K  R  P  A  F  M ...........................................................................

cttttctcgttgttctttttttaaatccggggcagagattgtggcacggaaagggagaaactgttcgttttttctctctcaaagtcgtgcttatctttgcttttcggggtgcaaagatacaaaaaaactacattctcgattatatttattatttttgcgccgactgttgataaagcatcaataacaagagcaa
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

cttttctcgttgttctttttttaaatccggggcagagattgtggcacggaaagggagaaactgttcgttttttctctctcaaagtcgtgcttatctttgcttttcggggtgcaaagatacaaaaaaactacattctcgattatatttattatttttgcgccgactgttgataaagcatcaataacaagagcaa
Predict TransTerm conf > 70================================================
TransTerm Strand: +	Conf: 42	HP_score: -2.6	Tail_Score: -2.88861	Start: 54	End: 74	Full_Region: TTGTGGCACGGAAAG GGAGAAAC TGTTC GTTTTTTC TCTCTCAAAGTCGTG
.....................................................GGAGAAACTGTTCGTTTTTTC.......................................................................................................................

Find igs database================================================
Query_seq: TF2655:TF2656|TF2655:TF2656:DNA topoisomerase I:valyl-tRNA synthetase:->->:2827023..2827215 193
cttttctcgttgttctttttttaaatccggggcagagattgtggcacggaaagggagaaactgttcgttttttctctctcaaagtcgtgcttatctttgcttttcggggtgcaaagatacaaaaaaactacattctcgattatatttattatttttgcgccgactgttgataaagcatcaataacaagagcaa
Intra-Species Hit: Count: 1	Min: 1	Max: 193	Len: 193
Subject: tfor_TF2655_TF2656|DNA topoisomerase I:valyl-tRNA synthetase|POSITIVE:POSITIVE|[2827023,2827215]|193
HSP  1	e-value: 2.0E-80	bit: 299.0	Len: 193	Query Start:1	Query End:193	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 193
cttttctcgttgttcnnnnnnnaaatccggggcagagattgtggcacggaaagggagaaactgttcgttttttctctctcaaagtcgtgcttatctttgcttttcggggtgcaaagatacnnnnnnnctacattctcgattatatttattatttttgcgccgactgttgataaagcatcaataacaagagcaa
cttttctcgttgttctttttttaaatccggggcagagattgtggcacggaaagggagaaactgttcgttttttctctctcaaagtcgtgcttatctttgcttttcggggtgcaaagatacaaaaaaactacattctcgattatatttattatttttgcgccgactgttgataaagcatcaataacaagagcaa

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
CUUUUCUCGUUGUUCUUUUUUUAAAUCCGGGGCAGAGAUUGUGGCACGGAAAGGGAGAAACUGUUCGUUUUUUCUCUCUCAAAGUCGUGCUUAUCUUUGCUUUUCGGGGUGCAAAGAUACAAAAAAACUACAUUCUCGAUUAUAUUUAUUAUUUUUGCGCCGACUGUUGAUAAAGCAUCAAUAACAAGAGCAA
.........((((((((.........(((((((((((((...(((((((..(((((((((..........))))))))).....))))))).)))))))))..))))((((((((((((..............................))))))))))))...(((((((.....)))))))..)))))))) (-56.81)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UUGCUCUUGUUAUUGAUGCUUUAUCAACAGUCGGCGCAAAAAUAAUAAAUAUAAUCGAGAAUGUAGUUUUUUUGUAUCUUUGCACCCCGAAAAGCAAAGAUAAGCACGACUUUGAGAGAGAAAAAACGAACAGUUUCUCCCUUUCCGUGCCACAAUCUCUGCCCCGGAUUUAAAAAAAGAACAACGAGAAAAG
....(((((((.((((((...))))))...((((.((....(((.....)))....((((.(((..........(((((((((..........))))))))).(((((.....(((.((((((..........)))))).)))..))))).))).)))).)).))))...............))))))).... (-42.30)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
399	80	32	79	32	tfor:TF2848|5end_cobalamin_biosynthesis_protein_3036368..3036598_POSITIVE
395	48	6	135	87	tfor:TF2789|5end_enoyl-[acyl-carrier-protein]_reductase_2972431..2972661_POSITIVE
369	88	41	149	84	tfor:TF0051|5end_hypothetical_protein_57327..57557_POSITIVE
364	66	26	209	175	tfor:TF1804|5end_hypothetical_protein_1947101..1947331_POSITIVE
346	49	5	162	129	tfor:TF2745|5end_hypothetical_protein_2927562..2927792_POSITIVE
344	65	25	136	102	tfor:TF2122|5end_NAD-specific_glutamate_dehydrogenase_2292734..2292964_POSITIVE
342	64	28	157	120	tfor:TF1619|5end_riboflavin_synthase,_beta_subunit_1733948..1734178_POSITIVE
341	114	74	64	23	tfor:TF1542|5end_transcriptional_regulator_1649105..1649335_POSITIVE
336	67	28	152	106	tfor:TF1919|5end_hypothetical_protein_2070037..2070267_POSITIVE
336	67	28	112	66	tfor:TF1917|5end_hypothetical_protein_2069997..2070227_POSITIVE
332	70	28	188	151	tfor:TF0587|5end_outer_membrane_protein_618319..618549_POSITIVE
328	110	64	162	115	tfor:TF3094|5end_translation_elongation_factor_Ts_3326122..3326352_POSITIVE
325	108	61	115	58	tfor:TF1664|5end_conserved_hypothetical_protein_1778761..1778991_POSITIVE
325	112	73	59	12	tfor:TF0113|5end_4-deoxy-L-threo-5-hexosulose-uronate_ketol-isomerase_123149..123379_POSITIVE
324	68	26	91	41	tfor:TF2846|5end_cobyric_acid_synthase_3034896..3035126_POSITIVE
324	70	26	137	99	tfor:TF0253|5end_conserved_hypothetical_protein_283707..283937_POSITIVE
323	67	27	193	143	tfor:TF1475|5end_glucose-6-phosphate_1-dehydrogenase_1568034..1568264_POSITIVE
323	49	2	226	171	tfor:TF1416|5end_outer_membrane_protein_1497576..1497806_POSITIVE
321	68	26	213	159	tfor:TF0997|5end_conserved_hypothetical_protein_1051475..1051705_POSITIVE
317	68	25	111	59	tfor:TF1464|5end_conserved_hypothetical_protein_1553467..1553697_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
399	80	32	100	53	tfor:TF2846|3end_cobyric_acid_synthase_3036469..3036619_POSITIVE
395	48	6	135	87	tfor:TF2788|3end_hypothetical_protein_2972511..2972661_POSITIVE
369	88	41	88	23	tfor:TF0049|3end_membrane-associated_HD_superfamily_hydrolase_57346..57496_POSITIVE
364	66	26	148	114	tfor:TF1803|3end_conserved_hypothetical_protein_1947120..1947270_POSITIVE
344	65	25	82	48	tfor:TF2120|3end_holliday_junction_endonuclease_2292760..2292910_POSITIVE
336	67	28	140	94	tfor:TF1918|3end_hypothetical_protein_2070105..2070255_POSITIVE
328	110	64	141	94	tfor:TF3093|3end_30S_ribosomal_protein_S2_3326181..3326331_POSITIVE
324	68	26	100	50	tfor:TF2847|3end_hypothetical_protein_3034985..3035135_POSITIVE
324	70	26	109	71	tfor:TF0252|3end_hypothetical_protein_283759..283909_POSITIVE
321	69	25	59	18	tfor:TF0007|3end_3-oxoacyl-[acyl-carrier-protein]_synthase_III_3599..3749_POSITIVE
317	68	25	72	20	tfor:TF1462|3end_erythronate-4-phosphate_dehydrogenase_1553508..1553658_POSITIVE
315	120	71	140	87	tfor:TF2832|3end_possible_proton/sodium:glutamate_symporter_protein_3023939..3024089_POSITIVE
311	111	74	45	7	tfor:TF1173|3end_ABC_transporter,_permease_component_1256651..1256801_POSITIVE
310	116	75	59	19	tfor:TF3151|3end_glyoxalase_family_protein_3386705..3386855_POSITIVE
309	67	28	138	100	tfor:TF0468|3end_hypothetical_protein_487188..487338_POSITIVE
306	79	34	70	36	tfor:TF0860|3end_conserved_hypothetical_protein_913369..913519_POSITIVE
305	57	27	110	73	tfor:TF2272|3end_conserved_hypothetical_protein_2436514..2436664_POSITIVE
305	49	2	149	101	tfor:TF1298|3end_possible_membrane_protein_1381197..1381347_POSITIVE
304	70	27	127	82	tfor:TF2734|3end_conserved_hypothetical_protein_2916738..2916888_POSITIVE
302	67	27	139	97	tfor:TF2103|3end_transposase_2275417..2275567_POSITIVE