Origin IGS:
agatttcgattgtcgtgcaaaagtaaatactttattgccgacgtacaatttttttttcggattattcagccggattttcggcgggacatcattggtcgcggggcttttcggcttctttcgtatggggcgtgtgccggttctcctgtaaaaaaggcctttacgccggtcctcatcgttggaaaccggtgcaaaggccttggagtataagtgtggataagattggctgttttccgtcctcttgttta
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
taaacaagaggacggaaaacagccaatcttatccacacttatactccaaggcctttgcaccggtttccaacgatgaggaccggcgtaaaggccttttttacaggagaaccggcacacgccccatacgaaagaagccgaaaagccccgcgaccaatgatgtcccgccgaaaatccggctgaataatccgaaaaaaaaattgtacgtcggcaataaagtatttacttttgcacgacaatcgaaatct

Mask Tandem Repeat Region ================================================
agatttcgattgtcgtgcaaaagtaaatactttattgccgacgtacaatttttttttcggattattcagccggattttcggcgggacatcattggtcgcggggcttttcggcttctttcgtatggggcgtgtgccggttctcctgtaaaaaaggcctttacgccggtcctcatcgttggaaaccggtgcaaaggccttggagtataagtgtggataagattggctgttttccgtcctcttgttta

Find is-nt database================================================
Query_seq: TF2759:TF2760|TF2759:TF2760:xylose repressor, ROK family:MarR  family transcriptional regulator:->->:2944914..2945158 245
agatttcgattgtcgtgcaaaagtaaatactttattgccgacgtacaatttttttttcggattattcagccggattttcggcgggacatcattggtcgcggggcttttcggcttctttcgtatggggcgtgtgccggttctcctgtaaaaaaggcctttacgccggtcctcatcgttggaaaccggtgcaaaggccttggagtataagtgtggataagattggctgttttccgtcctcttgttta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: TF2759:TF2760|TF2759:TF2760:xylose repressor, ROK family:MarR  family transcriptional regulator:->->:2944914..2945158 245
agatttcgattgtcgtgcaaaagtaaatactttattgccgacgtacaatttttttttcggattattcagccggattttcggcgggacatcattggtcgcggggcttttcggcttctttcgtatggggcgtgtgccggttctcctgtaaaaaaggcctttacgccggtcctcatcgttggaaaccggtgcaaaggccttggagtataagtgtggataagattggctgttttccgtcctcttgttta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: TF2759:TF2760|TF2759:TF2760:xylose repressor, ROK family:MarR  family transcriptional regulator:->->:2944914..2945158 245
agatttcgattgtcgtgcaaaagtaaatactttattgccgacgtacaatttttttttcggattattcagccggattttcggcgggacatcattggtcgcggggcttttcggcttctttcgtatggggcgtgtgccggttctcctgtaaaaaaggcctttacgccggtcctcatcgttggaaaccggtgcaaaggccttggagtataagtgtggataagattggctgttttccgtcctcttgttta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

agatttcgattgtcgtgcaaaagtaaatactttattgccgacgtacaatttttttttcggattattcagccggattttcggcgggacatcattggtcgcggggcttttcggcttctttcgtatggggcgtgtgccggttctcctgtaaaaaaggcctttacgccggtcctcatcgttggaaaccggtgcaaaggccttggagtataagtgtggataagattggctgttttccgtcctcttgttta
Predict ORF larger than 30AA ================================================
Protein_Len: 37	Strand: +	Start: 35	End: 145
.................................. M  P  T  Y  N  F  F  F  G  L  F  S  R  I  F  G  G  T  S  L  V  A  G  L  F  G  F  F  R  M  G  R  V  P  V  L  L ....................................................................................................
Protein_Len: 60	Strand: +	Start: 10	End: 204
......... M  S  C  K  S  K  Y  F  I  A  D  V  Q  F  F  F  R  I  I  Q  P  D  F  R  R  D  I  I  G  R  G  A  F  R  L  L  S  Y  G  A  C  A  G  S  P  V  K  K  A  F  T  P  V  L  I  V  G  N  R  C .........................................
Protein_Len: 60	Strand: +	Start: 27	End: 245
.......................... M  L  Y  C  R  R  T  I  F  F  S  D  Y  S  A  G  F  S  A  G  H  H  W  S  R  G  F  S  A  S  F  V  W  G  V  C  R  F  S  C  K  K  G  L  Y  A  G  P  H  R  W  K  P  V  Q  R  P  W  S  I 
Protein_Len: 49	Strand: -	Start: 69	End: 215
.................................................................... G  S  K  R  R  S  M  M  P  R  P  A  K  R  S  R  E  Y  P  A  H  A  P  E  G  T  F  F  A  K  V  G  T  R  M  T  P  F  R  H  L  P  R  P  T  Y  T  H  M ..............................
Protein_Len: 41	Strand: -	Start: 1	End: 123
 S  K  S  Q  R  A  F  T  F  V  K  N  G  V  Y  L  K  K  K  P  N  N  L  R  I  K  P  P  V  D  N  T  A  P  S  K  P  K  K  R  M ..........................................................................................................................

agatttcgattgtcgtgcaaaagtaaatactttattgccgacgtacaatttttttttcggattattcagccggattttcggcgggacatcattggtcgcggggcttttcggcttctttcgtatggggcgtgtgccggttctcctgtaaaaaaggcctttacgccggtcctcatcgttggaaaccggtgcaaaggccttggagtataagtgtggataagattggctgttttccgtcctcttgttta
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

agatttcgattgtcgtgcaaaagtaaatactttattgccgacgtacaatttttttttcggattattcagccggattttcggcgggacatcattggtcgcggggcttttcggcttctttcgtatggggcgtgtgccggttctcctgtaaaaaaggcctttacgccggtcctcatcgttggaaaccggtgcaaaggccttggagtataagtgtggataagattggctgttttccgtcctcttgttta
Predict TransTerm conf > 70================================================
TransTerm Strand: -	Conf: 100	HP_score: -14.6	Tail_Score: -5.00616	Start: 153	End: 196	Full_Region: acacttatactccaa ggcctttgcaccggtttcca acga tgaggaccggcgtaaaggcc ttttttacaggagaa
........................................................................................................................................................ggcctttgcaccggtttccaacgatgaggaccggcgtaaaggcc.................................................

Find igs database================================================
Query_seq: TF2759:TF2760|TF2759:TF2760:xylose repressor, ROK family:MarR  family transcriptional regulator:->->:2944914..2945158 245
agatttcgattgtcgtgcaaaagtaaatactttattgccgacgtacaatttttttttcggattattcagccggattttcggcgggacatcattggtcgcggggcttttcggcttctttcgtatggggcgtgtgccggttctcctgtaaaaaaggcctttacgccggtcctcatcgttggaaaccggtgcaaaggccttggagtataagtgtggataagattggctgttttccgtcctcttgttta
Intra-Species Hit: Count: 1	Min: 1	Max: 245	Len: 245
Subject: tfor_TF2759_TF2760|xylose repressor, ROK family:MarR family transcriptional regulator|POSITIVE:POSITIVE|[2944914,2945158]|245
HSP  1	e-value: 1.0E-120	bit: 432.0	Len: 245	Query Start:1	Query End:245	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 245
agatttcgattgtcgtgcaaaagtaaatactttattgccgacgtacaannnnnnnnncggattattcagccggattttcggcgggacatcattggtcgcggggcttttcggcttctttcgtatggggcgtgtgccggttctcctgtaaaaaaggcctttacgccggtcctcatcgttggaaaccggtgcaaaggccttggagtataagtgtggataagattggctgttttccgtcctcttgttta
agatttcgattgtcgtgcaaaagtaaatactttattgccgacgtacaatttttttttcggattattcagccggattttcggcgggacatcattggtcgcggggcttttcggcttctttcgtatggggcgtgtgccggttctcctgtaaaaaaggcctttacgccggtcctcatcgttggaaaccggtgcaaaggccttggagtataagtgtggataagattggctgttttccgtcctcttgttta

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
AGAUUUCGAUUGUCGUGCAAAAGUAAAUACUUUAUUGCCGACGUACAAUUUUUUUUUCGGAUUAUUCAGCCGGAUUUUCGGCGGGACAUCAUUGGUCGCGGGGCUUUUCGGCUUCUUUCGUAUGGGGCGUGUGCCGGUUCUCCUGUAAAAAAGGCCUUUACGCCGGUCCUCAUCGUUGGAAACCGGUGCAAAGGCCUUGGAGUAUAAGUGUGGAUAAGAUUGGCUGUUUUCCGUCCUCUUGUUUA
...........((((.((((((((....))))..))))))))...............((((.....((((((.(((((..((((((....(((((.((((.(.(((..(((......)))...))).).)))))))))..))))))....(((((((((.(((((((..(((....)))..))))))).))))))))).................)))))))))))...))))............ (-76.50)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UAAACAAGAGGACGGAAAACAGCCAAUCUUAUCCACACUUAUACUCCAAGGCCUUUGCACCGGUUUCCAACGAUGAGGACCGGCGUAAAGGCCUUUUUUACAGGAGAACCGGCACACGCCCCAUACGAAAGAAGCCGAAAAGCCCCGCGACCAAUGAUGUCCCGCCGAAAAUCCGGCUGAAUAAUCCGAAAAAAAAAUUGUACGUCGGCAAUAAAGUAUUUACUUUUGCACGACAAUCGAAAUCU
.......((...((((...(((((...................(((((((((((((((.((((((..((....))..)))))).))))))))))).......))))...((((...(((......(....)..((......))...)))..((....))....)))).......))))).....))))...............((((((((..((((....)))))))).))))..))....... (-71.61)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
487	120	71	55	7	tfor:TF2951|5end_O-succinylbenzoic_acid--CoA_ligase_3158496..3158726_POSITIVE
486	110	68	54	18	tfor:TF0431|5end_hypothetical_protein_452178..452408_POSITIVE
486	110	68	39	3	tfor:TF0430|5end_hypothetical_protein_452163..452393_POSITIVE
462	130	81	212	156	tfor:TF2159|5end_conserved_hypothetical_protein_2334446..2334676_POSITIVE
455	144	101	220	172	tfor:TF1801|5end_conserved_hypothetical_protein;_possible_TPR-repeat-containing_protein_1944213..1944443_POSITIVE
444	127	83	57	11	tfor:TF1559|5end_glycosyltransferase_1665879..1666109_POSITIVE
441	147	101	214	170	tfor:TF1812|5end_tryptophan_synthase,_beta_chain_1952696..1952926_POSITIVE
441	127	81	79	31	tfor:TF0888|5end_transfer_region-related_protein,_TraN_938392..938622_POSITIVE
425	120	72	184	132	tfor:TF2023|5end_possible_Fe-S_oxidoreductase_2180631..2180861_POSITIVE
425	130	81	74	16	tfor:TF0374|5end_glycerophosphoryl_diester_phosphodiesterase_392527..392757_POSITIVE
422	136	92	207	157	tfor:TF1070|5end_hydrolase_1139704..1139934_POSITIVE
417	140	93	75	23	tfor:TF2208|5end_conserved_hypothetical_protein_2382349..2382579_POSITIVE
416	142	102	158	117	tfor:TF2788|5end_hypothetical_protein_2972201..2972431_POSITIVE
416	147	108	41	9	tfor:TF1811|5end_hypothetical_protein_1952523..1952753_POSITIVE
413	100	58	154	113	tfor:TF1919|5end_hypothetical_protein_2070037..2070267_POSITIVE
413	100	58	114	73	tfor:TF1917|5end_hypothetical_protein_2069997..2070227_POSITIVE
413	130	82	212	147	tfor:TF1492|5end_ribonuclease_H-related_protein_1592017..1592247_POSITIVE
412	137	93	226	180	tfor:TF2248|5end_transfer_region-related_protein,_TraB_2422551..2422781_POSITIVE
412	137	94	52	5	tfor:TF1897|5end_conserved_hypothetical_protein;_possible_aminopeptidase_2049259..2049489_POSITIVE
410	134	96	166	126	tfor:TF0775|5end_ABC_transporter,_permease_component_823664..823894_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
444	127	83	57	11	tfor:TF1558|3end_possible_heme_biosynthesis_protein_1665959..1666109_POSITIVE
430	195	152	144	93	tfor:TF0271|3end_oxidase/dehydrogenase_298530..298680_POSITIVE
425	120	72	143	91	tfor:TF2022|3end_conserved_hypothetical_protein_2180670..2180820_POSITIVE
425	130	81	63	5	tfor:TF0373|3end_conserved_hypothetical_protein,_yngK-related_392596..392746_POSITIVE
420	120	71	139	83	tfor:TF2738|3end_30S_ribosomal_protein_S16_2920084..2920234_POSITIVE
420	199	152	56	2	tfor:TF0705|3end_hypothetical_protein_750789..750939_POSITIVE
416	142	102	135	94	tfor:TF2787|3end_30S_ribosomal_protein_S1_2972258..2972408_POSITIVE
413	100	58	142	101	tfor:TF1918|3end_hypothetical_protein_2070105..2070255_POSITIVE
401	130	82	143	97	tfor:TF1612|3end_conserved_hypothetical_protein_1729866..1730016_POSITIVE
395	197	151	103	54	tfor:TF2012|3end_conserved_hypothetical_protein_2168720..2168870_POSITIVE
395	209	161	68	6	tfor:TF1298|3end_possible_membrane_protein_1381197..1381347_POSITIVE
395	131	96	149	112	tfor:TF0774|3end_membrane-fusion_protein;_36_kDa_antigen_823730..823880_POSITIVE
395	110	62	134	88	tfor:TF0708|3end_possible_alkaline_phosphatase_753836..753986_POSITIVE
391	109	68	149	105	tfor:TF1923|3end_conserved_hypothetical_protein;_possible_phosphoserine_phosphatase_2072929..2073079_POSITIVE
391	139	91	69	20	tfor:TF0300|3end_hypothetical_protein_325541..325691_POSITIVE
389	180	136	148	93	tfor:TF2953|3end_possible_TonB-dependent_outer_membrane_receptor_3161501..3161651_POSITIVE
387	120	72	136	81	tfor:TF2468|3end_hypothetical_protein_2646582..2646732_POSITIVE
387	139	92	67	5	tfor:TF1002|3end_replicative_DNA_helicase_1058232..1058382_POSITIVE
386	137	91	147	82	tfor:TF2774|3end_2-amino-4-hydroxy-6-hydroxymethyldihydropteridine_pyrophosphokinase_2959719..2959869_POSITIVE
385	146	103	40	1	tfor:TF2263|3end_transfer_region-related_protein,_TraN_2432964..2433114_POSITIVE