CDS GC%: 43.5% tRNA GC%: 53.9% rRNA GC%: 54.1%
| IGS# | Up stream Locus | Up stream Product | Down Stream Locus | Down Stream Product | Gene Dir type | Start | End | IGS Len | GC% | IS NT | IS AA | NR | PT-Pair | Intra Spp. IGS | Inter Spp. IGS | Conserved Inter-spp IGS Start | Conserved Inter-spp IGS End | Blast Result | Conserved IGS Seq |
| 1 | PI2178 | 1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate synthase, GcpE | PI0001 | possible Ton-B receptor | ->-> | 1 | 539 | 539 | 30.8% | 0 | 0 | 0 | +: 2/2/3 | -: 0/3/0 | 59 | 0 | 0 | 0 | Result | |
| 2 | PI0001 | possible Ton-B receptor | PI0002 | conserved hypothetical protein | ->-> | 2973 | 3111 | 139 | 28.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 3 | PI0002 | conserved hypothetical protein | PI0003 | pseudouridylate synthase | ->-> | 3931 | 4409 | 479 | 28.6% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 4 | PI0003 | pseudouridylate synthase | PI0004 | hypothetical protein | ->-> | 6105 | 6338 | 234 | 29.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 5 | PI0004 | hypothetical protein | PI0007 | hypothetical protein | ->-> | 6450 | 6556 | 107 | 29.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 6 | PI0008 | exoribonuclease II (ribonuclease II) | PI0009 | NAD-dependent epimerase/dehydratase family protein | ->-> | 9622 | 9792 | 171 | 32.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 7 | PI0010 | conserved hypothetical protein | PI0011 | conserved hypothetical protein | ->-> | 11740 | 12281 | 542 | 32.7% | 0 | 0 | 0 | +: 2/3/2 | -: 0/1/0 | 56 | 0 | 0 | 0 | Result | |
| 8 | PI0011 | conserved hypothetical protein | PI0012 | conserved hypothetical protein | ->-> | 13389 | 13545 | 157 | 30.6% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 9 | PI0013 | auxin-regulated protein | PI0014 | hypothetical protein | ->-> | 17167 | 17395 | 229 | 27.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 10 | PI0014 | hypothetical protein | PI0015 | possible transport protein | ->-> | 17978 | 18551 | 574 | 28.6% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 11 | PI0015 | possible transport protein | PI0016 | magnesium chelatase, subunit ChlI | ->-> | 20211 | 20330 | 120 | 24.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 13 | PI0018 | hypothetical protein | PI0019 | conserved hypothetical protein | ->-> | 23750 | 23881 | 132 | 28% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 14 | PI0019 | conserved hypothetical protein | PI0020 | conserved hypothetical protein | ->-> | 24515 | 24664 | 150 | 34% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 15 | PI0022 | hypothetical protein | PI0023 | internalin-related protein | ->-> | 25952 | 26063 | 112 | 25% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 16 | PI0023 | internalin-related protein | PI0024 | hypothetical protein | ->-> | 28131 | 28517 | 387 | 38.2% | 0 | 0 | 0 | +: 1/2/2 | -: 0/2/0 | 52 | 0 | 0 | 0 | Result | |
| 17 | PI0024 | hypothetical protein | PI0025 | two component system sensor histidine kinase | ->-> | 28620 | 28821 | 202 | 39.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 18 | PI0030 | transcriptional regulator, AsnC family | PI0031 | peptidylprolyl isomerase | ->-> | 35111 | 35261 | 151 | 29.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 20 | PI0034 | FKBP-type peptidyl-prolyl cis-trans isomerase | PI0035 | NAD-dependent protein deacetylase, SIR2 family | ->-> | 37894 | 38012 | 119 | 18.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 21 | PI0036 | glutathione peroxidase | PI0037 | hypothetical protein | ->-> | 39350 | 39493 | 144 | 36.1% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 22 | PI0041 | hypothetical protein | PI0043 | thiamine phosphate pyrophosphorylase | ->-> | 42084 | 42433 | 350 | 32.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 24 | PI0047 | phosphomethylpyrimidine kinase | PI0048 | conserved hypothetical protein | ->-> | 46842 | 47258 | 417 | 37.6% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 25 | PI0048 | conserved hypothetical protein | PI0049 | outer membrane receptor protein (iron transport) | ->-> | 48555 | 48744 | 190 | 34.2% | 0 | 0 | 0 | +: 0/2/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
| 26 | PI0049 | outer membrane receptor protein (iron transport) | PI0050 | conserved hypothetical protein | ->-> | 51151 | 51678 | 528 | 30.5% | 0 | 0 | 0 | +: 2/1/1 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 27 | PI0051 | hypothetical protein | PI0054 | hypothetical protein | ->-> | 53449 | 54718 | 1270 | 32% | 0 | 0 | 0 | +: 1/6/5 | -: 2/4/0 | 46 | 0 | 0 | 0 | Result | |
| 28 | PI0056 | conserved hypothetical protein; possible DNA uptake protein | PI0057 | conserved hypothetical protein | ->-> | 55968 | 56098 | 131 | 42.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 29 | PI0058 | conserved hypothetical protein | PI0059 | peptide chain release factor RF-2 | ->-> | 57105 | 57271 | 167 | 37.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 31 | PI0060 | long-chain-fatty-acid--CoA ligase (acyl-CoA synthetase) | PI0061 | hypothetical protein | ->-> | 60227 | 60639 | 413 | 30.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 32 | PI0061 | hypothetical protein | PI0062 | endopeptidase | ->-> | 60751 | 61102 | 352 | 37.8% | 0 | 0 | 0 | +: 0/3/0 | -: 0/1/0 | 2 | 0 | 0 | 0 | Result | |
| 33 | PI0062 | endopeptidase | PI0063 | transcriptional regulator, GntR family | ->-> | 63083 | 63320 | 238 | 29% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 34 | PI0066 | ABC transport system, ATP-binding component | PI0067 | hypothetical protein | ->-> | 66150 | 66412 | 263 | 28.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 35 | PI0068 | arginine repressor | PI0069 | hypothetical protein | ->-> | 67080 | 67211 | 132 | 40.2% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 36 | PI0069 | hypothetical protein | PI0070 | conserved hypothetical protein | ->-> | 67440 | 67792 | 353 | 28% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 37 | PI0073 | dihydropteroate synthase | PI0074 | Na+/phosphate symporter (sodium-dependent inorganic phosphate (Pi) transporter) | ->-> | 71846 | 71992 | 147 | 36.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 38 | PI0074 | Na+/phosphate symporter (sodium-dependent inorganic phosphate (Pi) transporter) | PI0075 | uridine kinase | ->-> | 73700 | 73887 | 188 | 28.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 39 | PI0075 | uridine kinase | PI0076 | conserved hypothetical protein | ->-> | 75451 | 75784 | 334 | 30.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 40 | PI0076 | conserved hypothetical protein | PI0077 | hypothetical protein | ->-> | 76253 | 76383 | 131 | 38.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 41 | PI0077 | hypothetical protein | PI0078 | hypothetical protein | ->-> | 77680 | 77907 | 228 | 36% | 0 | 0 | 0 | +: 0/1/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 42 | PI0078 | hypothetical protein | PI0079 | hypothetical protein | ->-> | 78391 | 78704 | 314 | 25.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 43 | PI0081 | hypothetical protein | PI0082 | conserved hypothetical protein (possible phosphoglycerol transferase) | ->-> | 80761 | 80914 | 154 | 29.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 44 | PI0082 | conserved hypothetical protein (possible phosphoglycerol transferase) | PI0083 | tyrosyl-tRNA synthetase | ->-> | 82772 | 82963 | 192 | 32.3% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 45 | PI0083 | tyrosyl-tRNA synthetase | PI0084 | conserved hypothetical protein | ->-> | 84176 | 84334 | 159 | 35.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 46 | PI0088 | S-adenosylmethionine synthetase | PI0089 | hypothetical protein | ->-> | 88093 | 88301 | 209 | 28.7% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 47 | PI0089 | hypothetical protein | PI0090 | amidophosphoribosyltransferase | ->-> | 88416 | 88518 | 103 | 36.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 48 | PI0095 | hypothetical protein | PI0096 | glycerol-3-phosphate cytidylyltransferase | ->-> | 91911 | 92024 | 114 | 28.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 49 | PI0099 | hypothetical protein | PI0100 | LPS biosynthesis protein (lipopolysaccharide biosynthesis protein) | ->-> | 95838 | 95982 | 145 | 32.4% | 0 | 0 | 0 | +: 1/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 50 | PI0101 | lauroyl/myristoyl acyltransferase | PI0102 | hypothetical protein | ->-> | 97814 | 97995 | 182 | 30.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 51 | PI0102 | hypothetical protein | PI0103 | conserved hypothetical protein; possible permease | ->-> | 98125 | 98275 | 151 | 41.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 52 | PI0104 | hypothetical protein | PI0105 | possible sulfatase | ->-> | 99407 | 99542 | 136 | 33.1% | 0 | 0 | 0 | +: 1/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 53 | PI0107 | 2-methylthioadenine synthetase | PI0108 | L-lactate permease | ->-> | 104713 | 105031 | 319 | 37.9% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 54 | PI0108 | L-lactate permease | PI0109 | hypothetical protein | ->-> | 106529 | 106856 | 328 | 33.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 55 | PI0110 | ABC transport system, ATP-binding protein | PI0112 | hypothetical protein | ->-> | 107981 | 108152 | 172 | 35.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 56 | PI0113 | arginyl-tRNA synthetase | PI0116 | conserved hypothetical protein | ->-> | 110143 | 110352 | 210 | 33.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 57 | PI0119 | hypothetical protein | PI0120 | glutamate racemase | ->-> | 111784 | 111917 | 134 | 33.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 58 | PI0121 | outer membrane protein, ompH family | PI0122 | outer membrane protein, ompH family | ->-> | 113269 | 113458 | 190 | 43.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 59 | PI0125 | undecaprenyl pyrophosphate synthase | PI0126 | conserved hypothetical protein | ->-> | 117951 | 118064 | 114 | 35.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 60 | PI0126 | conserved hypothetical protein | PI0127 | conserved hypothetical protein | ->-> | 118650 | 118822 | 173 | 40.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 61 | PI0127 | conserved hypothetical protein | PI0128 | dipeptidase, pathogenicity island-encoded protein D | ->-> | 120218 | 120671 | 454 | 35.5% | 0 | 0 | 3 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 62 | PI0129 | hypothetical protein | PI0130 | hypothetical protein | ->-> | 122002 | 122171 | 170 | 31.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 63 | PI0130 | hypothetical protein | PI0131 | conserved hypothetical protein (possible outer membrane lipoprotein) | ->-> | 122328 | 122629 | 302 | 27.8% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 66 | PI0136 | surface antigen BspA | PI0137 | lectin-like adhesin precursor | ->-> | 128145 | 129004 | 860 | 28.5% | 0 | 0 | 0 | +: 1/1/1 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 67 | PI0138 | hypothetical protein | PI0140 | conserved hypothetical protein | ->-> | 131426 | 131782 | 357 | 40.9% | 0 | 0 | 0 | +: 0/3/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 68 | PI0141 | glutamine amidotransferase involved in pyridoxine biosynthesis | PI0142 | DNA-binding protein | ->-> | 133369 | 133978 | 610 | 34.9% | 0 | 0 | 0 | +: 0/2/0 | -: 0/4/0 | 50 | 0 | 0 | 0 | Result | |
| 69 | PI0142 | DNA-binding protein | PI0144 | conserved hypothetical protein | ->-> | 134252 | 135559 | 1308 | 40.6% | 0 | 0 | 250 | +: 2/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 71 | PI0145 | secDF export membrane protein | PI0146 | transcription elongation factor | ->-> | 139785 | 140477 | 693 | 33.9% | 0 | 0 | 0 | +: 0/4/0 | -: 1/4/2 | 56 | 0 | 0 | 0 | Result | |
| 72 | PI0147 | HIT family protein | PI0148 | mannose-1-phosphate guanylyltransferase | ->-> | 141369 | 141562 | 194 | 41.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 73 | PI0148 | mannose-1-phosphate guanylyltransferase | PI0149 | conserved hypothetical protein | ->-> | 142655 | 142874 | 220 | 26.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 74 | PI0149 | conserved hypothetical protein | PI0150 | hypothetical protein | ->-> | 143298 | 143650 | 353 | 25.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 78 | PI0155 | conserved hypothetical protein | PI0156 | conserved hypothetical protein | ->-> | 148748 | 148855 | 108 | 30.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 79 | PI0156 | conserved hypothetical protein | PI0158 | hypothetical protein | ->-> | 150974 | 151181 | 208 | 41.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 80 | PI0159 | hypothetical protein | PI0160 | conserved hypothetical protein | ->-> | 152181 | 152749 | 569 | 29% | 0 | 0 | 0 | +: 0/3/0 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
| 81 | PI0160 | conserved hypothetical protein | PI0161 | possible TonB receptor | ->-> | 153329 | 153503 | 175 | 40% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 83 | PI0162 | ADP-ribosylglycohydrolase (ADP-ribosyl-[dinitrogen reductase] hydrolase) | PI0163 | conserved hypothetical protein | ->-> | 157062 | 157255 | 194 | 35.6% | 0 | 0 | 0 | +: 1/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 84 | PI0163 | conserved hypothetical protein | PI0164 | conserved hypothetical protein | ->-> | 158471 | 158617 | 147 | 40.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 85 | PI0164 | conserved hypothetical protein | PI0165 | AAA family ATPase | ->-> | 159356 | 159741 | 386 | 29.5% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 86 | PI0165 | AAA family ATPase | PI0166 | hypothetical protein | ->-> | 161107 | 161225 | 119 | 29.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 89 | PI0173 | hypothetical protein | PI0174 | succinyl-CoA synthetase alpha subunit | ->-> | 165619 | 166260 | 642 | 31.5% | 0 | 0 | 2 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 90 | PI0176 | hypothetical protein | PI0177 | 2-oxoglutarate synthase, subunit korB | ->-> | 168502 | 168638 | 137 | 32.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 91 | PI0178 | 2-oxoglutarate synthase, subunit korA | PI0179 | hypothetical protein | ->-> | 171488 | 171896 | 409 | 35.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 92 | PI0181 | conserved hypothetical protein | PI0182 | hypothetical protein | ->-> | 174001 | 174232 | 232 | 28.9% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 93 | PI0182 | hypothetical protein | PI0183 | hypothetical protein | ->-> | 174338 | 174486 | 149 | 31.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 94 | PI0184 | possible fibronectin type III domain protein | PI0185 | conserved hypothetical protein | ->-> | 176577 | 177131 | 555 | 34.1% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 97 | PI0191 | O-methyltransferase | PI0192 | conserved hypothetical protein | ->-> | 181846 | 182270 | 425 | 34.6% | 0 | 0 | 0 | +: 0/3/0 | -: 0/3/0 | 7 | 0 | 0 | 0 | Result | |
| 98 | PI0193 | conserved hypothetical protein | PI0194 | 2-amino-3-ketobutyrate coenzyme A ligase (glycine C-acetyltransferase) | ->-> | 185756 | 185943 | 188 | 31.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 99 | PI0194 | 2-amino-3-ketobutyrate coenzyme A ligase (glycine C-acetyltransferase) | PI0195 | epimerase/reductase | ->-> | 187018 | 187311 | 294 | 28.9% | 0 | 0 | 1 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 100 | PI0195 | epimerase/reductase | PI0196 | hypothetical protein | ->-> | 188263 | 188574 | 312 | 37.2% | 0 | 0 | 0 | +: 0/3/0 | -: 0/3/0 | 35 | 0 | 0 | 0 | Result | |
| 101 | PI0197 | acetate kinase | PI0199 | phosphate acetyltransferase | ->-> | 189888 | 190029 | 142 | 28.9% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 102 | PI0198 | hypothetical protein | PI0200 | hypothetical protein | ->-> | 191117 | 191684 | 568 | 31.5% | 0 | 0 | 1 | +: 1/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 103 | PI0203 | conserved hypothetical protein | PI0204 | dGTP triphosphohydrolase (deoxyguanosinetriphosphate triphosphohydrolase) | ->-> | 196125 | 196258 | 134 | 40.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 104 | PI0204 | dGTP triphosphohydrolase (deoxyguanosinetriphosphate triphosphohydrolase) | PI0205 | deoxyuridine 5'-triphosphate nucleotidohydrolase | ->-> | 197606 | 197720 | 115 | 25.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 105 | PI0210 | hypothetical protein | PI0211 | hypothetical protein | ->-> | 203859 | 204206 | 348 | 37.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 52 | 0 | 0 | 0 | Result | |
| 106 | PI0211 | hypothetical protein | PI0212 | surface protein/internalin-related protein | ->-> | 204339 | 204556 | 218 | 29.4% | 0 | 0 | 0 | +: 1/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 107 | PI0212 | surface protein/internalin-related protein | PI0213 | conserved hypothetical protein | ->-> | 207083 | 207204 | 122 | 44.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 108 | PI0214 | hypothetical protein | PI0215 | hypothetical protein | ->-> | 208711 | 208962 | 252 | 28.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 111 | PI0224 | conserved hypothetical protein | PI0225 | conserved hypothetical protein | ->-> | 222040 | 222177 | 138 | 37.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 1 | 32 | 138 | Result | atattacaatgtatttaataacaccaacagcggtgcacggacaaaagtaaatcaaagaaacagtgtatgttaggggtttgagataactgcgtacttgtggcttcgat |
| 112 | PI0227 | ABC transporter, ATP-binding/permease protein | PI0228 | outer membrane cobalamin receptor protein | ->-> | 225693 | 225891 | 199 | 37.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 113 | PI0230 | hypothetical protein | PI0231 | transcriptional regulator | ->-> | 228967 | 229592 | 626 | 39% | 0 | 0 | 1 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 114 | PI0233 | membrane protein, possible exporter | PI0234 | integrase | ->-> | 233832 | 234612 | 781 | 37.1% | 1 | 14 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 115 | PI0235 | hypothetical protein | PI0237 | predicted two-component system sensor histidine kinase | ->-> | 236014 | 236118 | 105 | 32.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 116 | PI0238 | two-component system response regulator | PI0239 | conserved hypothetical protein | ->-> | 237887 | 238114 | 228 | 39% | 0 | 0 | 0 | +: 0/0/0 | -: 2/1/0 | 1 | 0 | 0 | 0 | Result | |
| 117 | PI0239 | conserved hypothetical protein | PI0240 | conserved hypothetical protein | ->-> | 238496 | 238601 | 106 | 27.4% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 118 | PI0240 | conserved hypothetical protein | PI0241 | possible tetracycline resistance element /mobilization regulatory protein | ->-> | 239403 | 239766 | 364 | 36% | 0 | 0 | 0 | +: 0/3/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 119 | PI0242 | hypothetical protein | PI0243 | hypothetical protein | ->-> | 240288 | 240645 | 358 | 43.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 1 | 134 | 257 | Result | gcccacaagcaggtgaaaggtgcggtgaagactcctatgacgacaaagaggagcagtttgacaatatagtaaacaatccactgcccatttgtcccagccatcatcttataggaatgtacttttc |
| 120 | PI0244 | possible mobilization protein C | PI0245 | possible mobilization protein | ->-> | 242860 | 243085 | 226 | 30.1% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 121 | PI0246 | conserved hypothetical protein | PI0247 | conjugative transposon protein, TraA | ->-> | 244660 | 245512 | 853 | 46.5% | 0 | 0 | 0 | +: 0/3/0 | -: 0/2/0 | 2 | 1 | 149 | 395 | Result | gccctctgcaagagcaagagttctgagttaccgaatttatttcgagtaacgcaggacatatcttgctatttgctccggcgcaaataaatccgtccgtgaaggacggaagtcgagtccctcaaaaaagaacgctttatgcctcgaaggcttcggcttaccgcttgggtgcaaagttactaagcgttgtgcctaaagcacttacctcttacggagccacaaatacgcaaatcgaagccacaagtacgca |
| 122 | PI0253 | conjugative transposon protein, TraD | PI0256 | conjugative transposon protein, TraE | ->-> | 249034 | 249183 | 150 | 41.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 123 | PI0258 | conjugative transposon protein, TraG | PI0259 | conserved protein found in conjugation, TraI | ->-> | 252346 | 252494 | 149 | 30.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 125 | PI0263 | conjugative transposon protein, TraM | PI0264 | transfer region-related protein, TraN | ->-> | 256473 | 256633 | 161 | 46.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 126 | PI0268 | lysozyme-related protein | PI0269 | conserved hypothetical protein | ->-> | 259851 | 259974 | 124 | 33.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 127 | PI0271 | hypothetical protein | PI0272 | conserved hypothetical protein | ->-> | 262452 | 262760 | 309 | 37.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 2 | 1 | 168 | 309 | Result | ttggctttttgttacttttgagccgtcccaactcactgtcaaaagtaacgaggtacttttcttcgggtttctttgctactttctttgtccgctcgaagctcacgaaagaaagtagcggtcggcagatttgccgaccgcttta |
| 128 | PI0282 | hypothetical protein | PI0283 | Zn-dependent peptidase | ->-> | 266887 | 267693 | 807 | 41.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/3/0 | 2 | 4 | 10 | 584 | Result | tttttgattttatgcagattttagaggtgagggagttgagtttccattttctttttccctgcttctcgcatatccgacattttttttatgcgtctttccgtcgggccggtcgttttcgtttcagtggcgtaaaaaggtagggcttaggacaaacaaggttttacggcgagaatactacctgcaatgaaatggaagtgtggagattgtcgtctaaacggcttgccgccccgaccttttttgtccgtagaagcccggaactacctttgccgctgacaacgaacaaccgatcccgacataatacacgggcataagtggaggatgtgcagacggagaagcggggcgaaaacaaaaaacgcagtcttcggggactgcatcttatcataaaacggaatacacggaaaacaaaaagccgccccaacggacggctctatgaaaataatttggagaaaattcttttttctcacgatatacctttatctttgcaacaggttattcgagttatgcaaagcgttgtatatcactgttgaagataggtcgctaaatcattacctactgcatttcataactcataaggc |
| 131 | PI0294 | conserved hypothetical protein | PI0295 | lysine decarboxylase | ->-> | 276867 | 276985 | 119 | 25.2% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 132 | PI0295 | lysine decarboxylase | PI0296 | hypothetical protein | ->-> | 277559 | 277761 | 203 | 27.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 140 | PI0303 | hypothetical protein | PI0305 | possible aminotransferase | ->-> | 287671 | 287857 | 187 | 21.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 141 | PI0306 | conserved hypothetical protein | PI0307 | RNA polymerase sigma-70 factor, ECF subfamily | ->-> | 289889 | 290181 | 293 | 27% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 142 | PI0310 | outer membrane protein | PI0312 | hypothetical protein | ->-> | 294371 | 294730 | 360 | 26.7% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
| 144 | PI0315 | conserved hypothetical protein | PI0316 | conserved hypothetical protein | ->-> | 298247 | 298518 | 272 | 42.3% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 146 | PI0321 | conserved hypothetical protein | PI0322 | hypothetical protein | ->-> | 303347 | 303647 | 301 | 33.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 150 | PI0327 | hypothetical protein | PI0328 | conserved hypothetical protein | ->-> | 309168 | 309615 | 448 | 41.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 2 | 0 | 0 | 0 | Result | |
| 151 | PI0328 | conserved hypothetical protein | PI0329 | hypothetical protein | ->-> | 310054 | 310205 | 152 | 32.9% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 152 | PI0331 | hypothetical protein | PI0332 | conserved hypothetical protein | ->-> | 312636 | 312739 | 104 | 44.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 154 | PI0338 | hypothetical protein | PI0339 | hypothetical protein | ->-> | 315774 | 315874 | 101 | 48.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 155 | PI0340 | conserved hypothetical protein | PI0341 | conserved hypothetical protein | ->-> | 316796 | 317177 | 382 | 44% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 156 | PI0342 | hypothetical protein | PI0344 | conserved hypothetical protein | ->-> | 318110 | 318317 | 208 | 41.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 157 | PI0344 | conserved hypothetical protein | PI0345 | conserved hypothetical protein | ->-> | 319500 | 319624 | 125 | 50.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 158 | PI0345 | conserved hypothetical protein | PI0346 | hypothetical protein | ->-> | 320870 | 320973 | 104 | 36.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 159 | PI0356 | hypothetical protein | PI0358 | hypothetical protein | ->-> | 327349 | 327700 | 352 | 40.6% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 160 | PI0358 | hypothetical protein | PI0359 | hypothetical protein | ->-> | 328166 | 328478 | 313 | 48.9% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 161 | PI0362 | hypothetical protein | PI0364 | hypothetical protein | ->-> | 333999 | 334141 | 143 | 42.7% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 162 | PI0365 | hypothetical protein | PI0366 | conserved hypothetical protein | ->-> | 336179 | 336904 | 726 | 49% | 0 | 0 | 0 | +: 0/0/0 | -: 1/2/1 | 1 | 0 | 0 | 0 | Result | |
| 163 | PI0368 | hypothetical protein | PI0369 | hypothetical protein | ->-> | 340046 | 340223 | 178 | 39.9% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 2 | 0 | 0 | 0 | Result | |
| 164 | PI0369 | hypothetical protein | PI0370 | conserved hypothetical protein | ->-> | 340470 | 340592 | 123 | 43.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 165 | PI0371 | thymidylate synthase | PI0372 | conserved hypothetical protein; possible ATPase | ->-> | 342034 | 342150 | 117 | 27.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 166 | PI0375 | hypothetical protein | PI0376 | conserved hypothetical protein | ->-> | 346143 | 346556 | 414 | 42.3% | 0 | 0 | 0 | +: 1/1/0 | -: 0/3/0 | 2 | 0 | 0 | 0 | Result | |
| 167 | PI0377 | DNA primase/mobilizable transposon, excision protein | PI0378 | conserved hypothetical protein; possible helicase | ->-> | 347884 | 348165 | 282 | 34.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 3 | 1 | 100 | 282 | Result | tgttttgatactttaatgggttgaatgataattatttatgcttgtctgttttatggttttaccgtttccaaagttttcccctccaaactttttcatctttcttcttaccacatactattttgtgataaatgattgataatcagtattactttgtagtataagacaatactacacattctacta |
| 168 | PI0378 | conserved hypothetical protein; possible helicase | PI0379 | conserved hypothetical protein | ->-> | 349600 | 350011 | 412 | 38.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 1 | 114 | 220 | Result | tgattggagcatattttatatcggattactgtgccaacctattccactatgacgccacaagctgccacttgaatgaaaagtgatggaataagaaatgcccgatatta |
| 169 | PI0380 | conserved hypothetical protein | PI0381 | probable transcriptional regulator, AraC family | ->-> | 350602 | 350711 | 110 | 35.5% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 170 | PI0382 | conserved hypothetical protein | PI0383 | conserved hypothetical protein; possible Zn-dependent hydrolase | ->-> | 352184 | 352292 | 109 | 35.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 171 | PI0384 | probable radical SAM domain protein | PI0385 | hypothetical protein | ->-> | 353882 | 354107 | 226 | 35% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 172 | PI0387 | hypothetical protein | PI0388 | integrase | ->-> | 354873 | 355066 | 194 | 38.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 2 | 1 | 119 | Result | tgaggtaatgattattggaagaatttttctcatacggtttcttcttatctgtttatcaatattttgcgtatcagagaacgctttgataacgggtaattttgcccataaagttaaagcgt |
| 173 | PI0390 | conserved hypothetical protein | PI0391 | conserved hypothetical protein | ->-> | 357816 | 357946 | 131 | 32.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 2 | 4 | 128 | Result | agaaaagcaggcagtaagaaaagtaatttctactgtctgctttttctaatggatttattgccactacctacttcatattctcttttttcagcgtataatggcaatctcaaaaggattctctttca |
| 174 | PI0391 | conserved hypothetical protein | PI0392 | possible transcriptional regulator | ->-> | 358277 | 358483 | 207 | 30.9% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 3 | 76 | 207 | Result | aaaatgtattttaaattgttgaaatcactgcaaaattatacctttgcactacaatacacaagtacatacaaaaatgtatgatacacactatattgttagttttactgaatatcaacaagaaaaaagttcgct |
| 175 | PI0394 | transcriptional regulator, AraC family | PI0395 | Na+-driven multidrug efflux pump | ->-> | 360390 | 360527 | 138 | 37% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 1 | 4 | 138 | Result | tgctattatcaccgttgtttgtctattgtgacgacctgtatccccctgtacctttgcagcagaatttatttacttaagaagatacagattataaggatgaacaacgctgtgaatattttgcaagaaggaagtatg |
| 176 | PI0395 | Na+-driven multidrug efflux pump | PI0396 | possible tetracycline resistance element mobilization regulatory protein, C-terminal fragment | ->-> | 361845 | 362132 | 288 | 38.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 3 | 1 | 288 | Result | tgaacataaaagatatgattatgctaagacttactcaaactgaagactttaagacaataatctctttatgctctacaaaaggacagatacaaaaagcgtcagacaactttattctgaagattattgccctatgtgatgcagaaagagatttagtctcattgtttcggaccctccgttatacacgcttttgcctgcaaccgttgcaaaggggagattcaatggacggagaggggaaaaaatgtatcagaactgctctttgtcattgacacggagcttgaattactgaaa |
| 177 | PI0397 | conserved hypothetical protein | PI0398 | hypothetical protein | ->-> | 362960 | 363517 | 558 | 40.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 2 | 2 | 1 | 558 | Result | tactttggattttaatggtttgtaattctctcttctggaaatagaacgtgctaaacacaattgaaatccattagagagcgttcacgataaaatagccaatcaagacaacgaaaacttctatccaagaacaccgacttcggaggtgttctgccctctgcaagagcaagggttttgagttaccgaaataatttcgggtaacgcaagacataccttgctatttgcactgacgcaaataaattcgttccgaagaacgatatgttattctctcgaaatgtatgttttcaaagccatgaaataccgacttatcgcttactgcaaagttactaagtgttgtgcctaaatcccttacctcatacgaagccacaactatccaaatcgaagccacaagtacgcactaaagtaaatcacgctgattacagcatcaccgagccatatatttgcaccgtcgaatatgtcggtggaggaatgtgtcttcgatgatatcacgattcgatgagcgatataagcgagggggtatatcaaagaacacgtccttgattctttcacttgaacgtggaa |
| 178 | PI0398 | hypothetical protein | PI0399 | conserved hypothetical protein | ->-> | 363602 | 363724 | 123 | 35.8% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 2 | 1 | 123 | Result | tagccctgctggtacaaccccattatcgggcatatcttagatagtggatgtattcatctttgcaggtaaatataccggcaaagaaatgaacagtgaattgtataacaataaaattaagtaagt |
| 179 | PI0399 | conserved hypothetical protein | PI0400 | conserved hypothetical protein | ->-> | 364151 | 364568 | 418 | 42.3% | 0 | 0 | 3 | +: 0/2/0 | -: 0/2/0 | 1 | 1 | 1 | 302 | Result | taaatccctatcttcagatgttttaaatggaactgttcttctgcttgccgtcctttcctacaatgtcgggacaggcaggttgctcggatacggcaagcatcccaagagccgactgttgcggaagatagagtcgggcgacaggaatttctatcgtgaatttgtctctttctgccgatacaagggcaaagtcctcagaggtctcgtcaaacgacgaaaggtggagtttgccctgttttatgtaccctgattaccacatacacctcttgcgacatttttatgctcgcaagaggcgttttcttgcc |
| 180 | PI0401 | conserved hypothetical protein | PI0402 | conserved hypothetical protein | ->-> | 367168 | 368031 | 864 | 42.7% | 0 | 0 | 0 | +: 0/6/0 | -: 1/4/0 | 3 | 3 | 4 | 861 | Result | ttttatatctctaattttggctttttgttacttttgagctgtctcaactcactgtcaaaagtaacgaagtgtttttcattggggtttctttgctcctttctttgtccgcccgatgctcacgaaagagaggagcggtcggcaaatccgccgaccgctttactccgtctgtttatcttgaacagttatccgtcccgtccttacttcggggtgagtggagaaagcccaatttacgttccaattgggttcattctttatacatgaaataggggataaagtgcaaccataacgagggcataagtcagaatgtacactgcgatagccaaagcgatggtaaggagcagccgaatgaggaaattttccacacatatccctgccagctaaagccagacgcttccgccccaaaggagagagcctgagagtgcaagtgccacccaaattgatattttgtatctctgtttcatcttgtctgattttttttgattttatgcggattccagaggagagggagttgagtttccattttctttttacctgcttctcgcatatccgacctttttttatgcgtctttccgtcgggtcggtcgttttcgtttcgaggcaataaaaaggttaggtggctaggacaacaaggtttagggcaagaatactacctgaagaatgaagtgtggagattgttgccctaacggcttgtcgcttgaccttgttgcccgcagtacaacgaaactacctttgccgaagaaaacgatacgaatgattcgatgcgaaaacatataatagaatgtgaggaatagaatgtaaacagaattgtgttaaactacttttattgtagtctgaaacagttctacttacacacctata |
| 181 | PI0402 | conserved hypothetical protein | PI0403 | probable integrase | ->-> | 370084 | 370228 | 145 | 24.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 183 | PI0410 | glutamyl-tRNA synthetase (glutamate--tRNA ligase) | PI0411 | conserved hypothetial protein; possible hydrolase | ->-> | 377551 | 377839 | 289 | 36.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 184 | PI0412 | primosomal protein N', replication factor Y | PI0413 | outer membrane protein | ->-> | 382213 | 382552 | 340 | 37.1% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 55 | 0 | 0 | 0 | Result | |
| 185 | PI0413 | outer membrane protein | PI0414 | hypothetical protein | ->-> | 384080 | 384466 | 387 | 30% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 186 | PI0414 | hypothetical protein | PI0415 | malate dehydrogenase | ->-> | 385271 | 385497 | 227 | 33.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 187 | PI0421 | hypothetical protein | PI0423 | hypothetical protein | ->-> | 387835 | 388240 | 406 | 43.8% | 0 | 0 | 2 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 188 | PI0424 | methylated-DNA--[protein]-cysteine S-methyltransferase | PI0426 | conserved hypothetical protein | ->-> | 389037 | 389484 | 448 | 35.9% | 0 | 0 | 0 | +: 0/4/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 189 | PI0425 | hypothetical protein | PI0427 | conserved hypothetical protein | ->-> | 389783 | 391279 | 1497 | 44% | 0 | 0 | 3 | +: 1/3/3 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 190 | PI0428 | hypothetical protein | PI0429 | hypothetical protein | ->-> | 396382 | 396557 | 176 | 34.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 191 | PI0429 | hypothetical protein | PI0430 | periplasmic protease; MdsD protein | ->-> | 399663 | 399969 | 307 | 24.8% | 0 | 0 | 0 | +: 0/3/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 193 | PI0432 | hypothetical protein | PI0434 | possible beta-lactamase | ->-> | 405098 | 405831 | 734 | 33.4% | 0 | 0 | 0 | +: 0/4/0 | -: 0/2/0 | 2 | 0 | 0 | 0 | Result | |
| 194 | PI0434 | possible beta-lactamase | PI0435 | 30S ribosomal protein S21 | ->-> | 406951 | 407136 | 186 | 37.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 196 | PI0444 | 50S ribosomal protein L7/L12 | PI0446 | DNA-directed RNA polymerase, beta subunit | ->-> | 413451 | 413617 | 167 | 29.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 197 | PI0447 | DNA-directed RNA polymerase, beta' subunit | PI0448 | hypothetical protein | ->-> | 421816 | 421983 | 168 | 31.5% | 0 | 0 | 0 | +: 0/3/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 198 | PI0450 | hypothetical protein | PI0451 | serine proteases, S51 group | ->-> | 424107 | 424482 | 376 | 25.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 199 | PI0451 | serine proteases, S51 group | PI0452 | conserved hypothetical protein; possible surface antigen | ->-> | 425188 | 425432 | 245 | 26.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 200 | PI0453 | conserved hypothetical protein | PI0455 | hypothetical protein | ->-> | 427255 | 427500 | 246 | 25.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 201 | PI0455 | hypothetical protein | PI0456 | 30S ribosomal protein S12 | ->-> | 428563 | 428898 | 336 | 26.5% | 0 | 0 | 0 | +: 0/4/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 202 | PI0456 | 30S ribosomal protein S12 | PI0457 | 30S ribosomal protein S7 | ->-> | 429280 | 429510 | 231 | 33.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 203 | PI0473 | 30S ribosomal protein S14 | PI0474 | 30S ribosomal protein S8 | ->-> | 439074 | 439182 | 109 | 24.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 204 | PI0480 | preprotein translocase, SecY subunit | PI0481 | translation initiation factor IF-1 | ->-> | 443054 | 443253 | 200 | 29.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 205 | PI0482 | 50S ribosomal protein L36 | PI0483 | 30S ribosomal protein S13 | ->-> | 443600 | 443724 | 125 | 23.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 206 | PI0487 | 50S ribosomal protein L17 | PI0488 | conserved hypothetical protein | ->-> | 446764 | 447045 | 282 | 27.7% | 0 | 0 | 0 | +: 1/1/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
| 207 | PI0488 | conserved hypothetical protein | PI0489 | probable cardiolipin synthetase | ->-> | 447598 | 447749 | 152 | 34.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 208 | PI0491 | hypothetical protein | PI0492 | hypothetical protein | ->-> | 451288 | 451840 | 553 | 31.8% | 0 | 0 | 0 | +: 1/2/1 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 209 | PI0492 | hypothetical protein | PI0493 | surface antigen BspA | ->-> | 452519 | 452983 | 465 | 35.1% | 0 | 0 | 0 | +: 0/4/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 210 | PI0495 | conserved hypothetical protein | PI0496 | heat shock protein hsp70 (chaperone protein dnaK) | ->-> | 456449 | 456771 | 323 | 34.4% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 211 | PI0496 | heat shock protein hsp70 (chaperone protein dnaK) | PI0497 | predicted recombinase, tnpA protein | ->-> | 458671 | 458880 | 210 | 26.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 212 | PI0499 | integrase, C-terminal region | PI0500 | mobilizable transposon, tnpC protein | ->-> | 460707 | 460813 | 107 | 32.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 213 | PI0500 | mobilizable transposon, tnpC protein | PI0501 | excisionase | ->-> | 461468 | 461569 | 102 | 31.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 214 | PI0502 | conserved hypothetical protein; possible helicase | PI0503 | mobilizable transposon, excision protein | ->-> | 463150 | 463370 | 221 | 29.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 215 | PI0503 | mobilizable transposon, excision protein | PI0504 | hypothetical protein | ->-> | 464259 | 464598 | 340 | 41.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 216 | PI0508 | possible cell filamentation protein | PI0509 | conserved hypothetical protein | ->-> | 467497 | 467693 | 197 | 33% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 217 | PI0510 | hypothetical protein | PI0511 | hypothetical protein | ->-> | 470360 | 470573 | 214 | 29% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 218 | PI0512 | conserved hypothetical protein | PI0513 | ion transporter | ->-> | 471501 | 471669 | 169 | 42% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 219 | PI0513 | ion transporter | PI0514 | possible cell filamentation protein | ->-> | 472432 | 472547 | 116 | 30.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 220 | PI0514 | possible cell filamentation protein | PI0515 | conserved hypothetical protein | ->-> | 473001 | 473184 | 184 | 23.4% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 221 | PI0515 | conserved hypothetical protein | PI0516 | ferredoxin, 4Fe-4S | ->-> | 475492 | 476003 | 512 | 29.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
| 222 | PI0516 | ferredoxin, 4Fe-4S | PI0517 | apparent PorT homolog | ->-> | 476169 | 476400 | 232 | 24.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 223 | PI0523 | hypothetical protein | PI0524 | meso-diaminopimelate D-dehydrogenase | ->-> | 479905 | 480012 | 108 | 25.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 224 | PI0524 | meso-diaminopimelate D-dehydrogenase | PI0525 | transcriptional regulator, Arac family | ->-> | 480910 | 481471 | 562 | 31.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 225 | PI0529 | hypothetical protein | PI0530 | possible membrane-fusion protein | ->-> | 483802 | 483911 | 110 | 40% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 226 | PI0531 | ABC transporter, ATP-binding protein; possible gliding motility related | PI0532 | ABC transporter, ATP-binding/permease protein | ->-> | 486300 | 486402 | 103 | 34% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 228 | PI0538 | transcriptional regulator | PI0540 | conserved hypothetical protein | ->-> | 492986 | 493094 | 109 | 37.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 229 | PI0539 | hypothetical protein | PI0541 | GTP-binding protein, GTP1/OBG family | ->-> | 493789 | 493899 | 111 | 51.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 230 | PI0541 | GTP-binding protein, GTP1/OBG family | PI0543 | adenylate kinase | ->-> | 495070 | 495212 | 143 | 34.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 232 | PI0546 | hypothetical protein | PI0547 | fructose-bisphosphate aldolase | ->-> | 498299 | 498515 | 217 | 28.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 233 | PI0547 | fructose-bisphosphate aldolase | PI0548 | possible acetylxylan esterase | ->-> | 499527 | 499671 | 145 | 36.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 234 | PI0551 | hypothetical protein | PI0552 | hypothetical protein | ->-> | 502744 | 502855 | 112 | 30.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 235 | PI0553 | recombination protein | PI0554 | hypothetical protein | ->-> | 504444 | 504554 | 111 | 34.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 236 | PI0556 | saccharopine dehydrogenase | PI0557 | conserved hypothetical protein | ->-> | 506221 | 506326 | 106 | 40.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 237 | PI0557 | conserved hypothetical protein | PI0558 | probable transcriptional regulator, TetR family | ->-> | 506945 | 507175 | 231 | 29.4% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 238 | PI0560 | hypothetical protein | PI0561 | hypothetical protein | ->-> | 508971 | 509091 | 121 | 36.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 3 | 0 | 0 | 0 | Result | |
| 239 | PI0562 | conserved hypothetical protein | PI0563 | possible integral membrane protein | ->-> | 510259 | 510387 | 129 | 28.7% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 240 | PI0563 | possible integral membrane protein | PI0565 | hypothetical protein | ->-> | 511240 | 511618 | 379 | 30.1% | 0 | 0 | 0 | +: 1/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 241 | PI0564 | hypothetical protein | PI0566 | enoyl-[acyl-carrier-protein] reductase | ->-> | 511782 | 511971 | 190 | 35.8% | 0 | 0 | 0 | +: 0/3/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 243 | PI0568 | hypothetical protein | PI0569 | phosphoglycerate kinase | ->-> | 513192 | 513436 | 245 | 32.2% | 0 | 0 | 0 | +: 1/3/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 244 | PI0569 | phosphoglycerate kinase | PI0570 | exsB protein; possible aluminum resistance protein | ->-> | 514685 | 514804 | 120 | 24.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 245 | PI0572 | tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase | PI0573 | aminopeptidase C (bleomycin hydrolase) | ->-> | 517650 | 517971 | 322 | 38.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 246 | PI0573 | aminopeptidase C (bleomycin hydrolase) | PI0574 | hypothetical protein | ->-> | 519280 | 519399 | 120 | 37.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 247 | PI0574 | hypothetical protein | PI0575 | hypothetical protein | ->-> | 519505 | 519700 | 196 | 35.2% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 57 | 0 | 0 | 0 | Result | |
| 248 | PI0576 | helicase, UvrD/Rep | PI0577 | conserved hypothetical protein | ->-> | 521785 | 521950 | 166 | 36.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 249 | PI0578 | methyltransferase | PI0579 | hypothetical protein | ->-> | 523314 | 523558 | 245 | 32.7% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 251 | PI0584 | hypothetical protein | PI0585 | conserved hypothetical protein | ->-> | 527717 | 532799 | 5083 | 47.5% | 0 | 0 | 19 | +: 0/6/0 | -: 1/3/2 | 1 | 0 | 0 | 0 | Result | |
| 252 | PI0585 | conserved hypothetical protein | PI0586 | hypothetical protein | ->-> | 533319 | 533896 | 578 | 29.6% | 0 | 0 | 0 | +: 0/2/0 | -: 0/5/0 | 1 | 0 | 0 | 0 | Result | |
| 253 | PI0586 | hypothetical protein | PI0587 | conserved hypothetical protein | ->-> | 534425 | 534555 | 131 | 30.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 254 | PI0588 | hypothetical protein | PI0589 | asparaginyl-tRNA synthetase (asparagine--tRNA ligase) | ->-> | 535486 | 535630 | 145 | 31.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 255 | PI0590 | ribosomal large subunit pseudouridine synthase B | PI0591 | adenylosuccinate lyase | ->-> | 538606 | 538734 | 129 | 24% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 258 | PI0592 | DNA mismatch repair protein | PI0593 | NAD-specific glutamate dehydrogenase | ->-> | 542672 | 543106 | 435 | 27.1% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 259 | PI0594 | possible rare lipoprotein A | PI0595 | conserved hypothetical protein | ->-> | 545218 | 545710 | 493 | 36.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 260 | PI0598 | hypothetical protein | PI0599 | hypothetical protein | ->-> | 547294 | 547515 | 222 | 32% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 261 | PI0601 | hypothetical protein | PI0602 | conserved hypothetical protein | ->-> | 549081 | 549238 | 158 | 27.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 262 | PI0602 | conserved hypothetical protein | PI0603 | 3-dehydroquinate synthase | ->-> | 549692 | 549857 | 166 | 33.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 263 | PI0609 | conserved hypothetical protein | PI0610 | conserved hypothetical protein | ->-> | 557079 | 557542 | 464 | 33.2% | 0 | 0 | 0 | +: 0/4/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 264 | PI0610 | conserved hypothetical protein | PI0611 | hypothetical protein | ->-> | 559292 | 559526 | 235 | 24.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 265 | PI0611 | hypothetical protein | PI0612 | lysyl-tRNA synthetase | ->-> | 559962 | 560600 | 639 | 35.1% | 0 | 0 | 0 | +: 1/1/1 | -: 1/3/0 | 1 | 0 | 0 | 0 | Result | |
| 266 | PI0615 | hydrolase, haloacid dehalogenase-like family | PI0616 | electron transfer flavoprotein, beta-subunit | ->-> | 565447 | 565699 | 253 | 31.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 267 | PI0618 | acyl-CoA dehydrogenase family protein | PI0619 | hypothetical protein | ->-> | 569274 | 569503 | 230 | 30% | 0 | 0 | 0 | +: 0/5/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 268 | PI0619 | hypothetical protein | PI0620 | hypothetical protein | ->-> | 569633 | 569868 | 236 | 29.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 269 | PI0620 | hypothetical protein | PI0621 | conserved hypothetical protein | ->-> | 570691 | 570909 | 219 | 23.7% | 0 | 0 | 0 | +: 0/1/0 | -: 1/3/0 | 1 | 0 | 0 | 0 | Result | |
| 270 | PI0622 | hypothetical protein | PI0623 | hypothetical protein | ->-> | 572148 | 572306 | 159 | 27% | 0 | 0 | 0 | +: 1/2/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 271 | PI0623 | hypothetical protein | PI0625 | possible membrane transport protein | ->-> | 573141 | 573243 | 103 | 30.1% | 0 | 0 | 0 | +: 0/4/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 272 | PI0631 | 50S ribosomal protein L25/general stress protein | PI0632 | NusB family protein (N utilization substance protein B) | ->-> | 578461 | 578615 | 155 | 35.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 274 | PI0638 | hypothetical protein | PI0639 | small heat shock protein | ->-> | 582463 | 582817 | 355 | 29.3% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 275 | PI0639 | small heat shock protein | PI0640 | conserved hypothetical protein | ->-> | 583226 | 583428 | 203 | 33.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 276 | PI0641 | conserved hypothetical protein | PI0642 | thioredoxin family protein | ->-> | 584621 | 584811 | 191 | 29.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 277 | PI0642 | thioredoxin family protein | PI0644 | dnaJ protein | ->-> | 585643 | 585843 | 201 | 26.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 278 | PI0646 | hypothetical protein | PI0647 | potassium uptake protein | ->-> | 587266 | 587644 | 379 | 31.4% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 279 | PI0647 | potassium uptake protein | PI0648 | hypothetical protein | ->-> | 589337 | 589587 | 251 | 30.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 280 | PI0652 | conserved hypothetical protein | PI0653 | hypothetical protein | ->-> | 595853 | 596185 | 333 | 36% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 20 | 0 | 0 | 0 | Result | |
| 281 | PI0653 | hypothetical protein | PI0654 | K+-dependent Na+/Ca+ exchanger related-protein | ->-> | 596297 | 596422 | 126 | 43.7% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 282 | PI0654 | K+-dependent Na+/Ca+ exchanger related-protein | PI0655 | Na+/H+ anitporter | ->-> | 597284 | 597429 | 146 | 41.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 283 | PI0655 | Na+/H+ anitporter | PI0656 | peptidase T (tripeptide aminopeptidase) | ->-> | 599602 | 599972 | 371 | 42.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 284 | PI0656 | peptidase T (tripeptide aminopeptidase) | PI0657 | conserved hypothetical protein | ->-> | 601194 | 601318 | 125 | 20.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 285 | PI0658 | conserved hypothetical protein | PI0659 | hypothetical protein | ->-> | 603104 | 603342 | 239 | 34.7% | 0 | 0 | 0 | +: 0/2/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 286 | PI0659 | hypothetical protein | PI0660 | conserved hypothetical protein | ->-> | 603457 | 603577 | 121 | 34.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 287 | PI0662 | conserved hypothetical protein | PI0663 | possible transcriptional regulator | ->-> | 605274 | 606138 | 865 | 27.6% | 0 | 0 | 0 | +: 1/2/1 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 288 | PI0663 | possible transcriptional regulator | PI0664 | dihydroorotate dehydrogenase, electron transfer subunit | ->-> | 606604 | 607030 | 427 | 28.6% | 0 | 0 | 0 | +: 1/1/1 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 289 | PI0664 | dihydroorotate dehydrogenase, electron transfer subunit | PI0665 | dihydroorotate dehydrogenase | ->-> | 607880 | 608004 | 125 | 29.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 290 | PI0665 | dihydroorotate dehydrogenase | PI0666 | chorismate synthase | ->-> | 608860 | 609145 | 286 | 31.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 292 | PI0673 | hypothetical protein | PI0675 | hypothetical protein | ->-> | 612766 | 613786 | 1021 | 41.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 293 | PI0676 | hypothetical protein | PI0677 | hypothetical protein | ->-> | 614896 | 616652 | 1757 | 41% | 0 | 0 | 24 | +: 0/1/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 294 | PI0680 | hypothetical protein | PI0682 | hypothetical protein | ->-> | 618694 | 619111 | 418 | 33.7% | 0 | 0 | 0 | +: 0/2/0 | -: 0/3/0 | 49 | 0 | 0 | 0 | Result | |
| 295 | PI0681 | hypothetical protein | PI0683 | hypothetical protein | ->-> | 619317 | 619431 | 115 | 46.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 296 | PI0684 | coproporphyrinogen III oxidase | PI0685 | elongation factor G | ->-> | 620568 | 620987 | 420 | 37.1% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 297 | PI0685 | elongation factor G | PI0686 | glycosyl transferase, group 2 family protein | ->-> | 623109 | 623616 | 508 | 38.2% | 0 | 0 | 0 | +: 0/5/0 | -: 0/5/0 | 1 | 0 | 0 | 0 | Result | |
| 298 | PI0689 | hypothetical protein | PI0690 | uracil permease | ->-> | 625938 | 626164 | 227 | 31.3% | 0 | 0 | 0 | +: 0/3/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 299 | PI0690 | uracil permease | PI0692 | iron compound ABC transporter, permease protein | ->-> | 627377 | 627489 | 113 | 31.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 300 | PI0693 | periplasmic iron binding protein, ABC transporter | PI0694 | Na+/dicarboxylate or sulfate symporter | ->-> | 629673 | 629884 | 212 | 31.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 301 | PI0694 | Na+/dicarboxylate or sulfate symporter | PI0695 | xanthine/uracil permease family protein | ->-> | 631238 | 631552 | 315 | 36.2% | 0 | 0 | 0 | +: 0/2/0 | -: 0/3/0 | 35 | 0 | 0 | 0 | Result | |
| 302 | PI0695 | xanthine/uracil permease family protein | PI0696 | NADH pyrophosphatase, MutT family hydrolase (NAD+ diphosphatase) | ->-> | 632762 | 632880 | 119 | 34.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 303 | PI0697 | 5'-nucleotidase family protein | PI0698 | conserved hypothetical protein | ->-> | 635401 | 635511 | 111 | 33.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 304 | PI0699 | conserved hypothetical protein | PI0700 | UDP-glucose 4-epimerase | ->-> | 637225 | 637438 | 214 | 29.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 305 | PI0701 | hypothetical protein | PI0702 | conserved hypothetical protein; possible tetracenomycin C synthesis protein homolog | ->-> | 638598 | 638779 | 182 | 33.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 306 | PI0703 | hypothetical protein | PI0704 | conserved hypothetical protein | ->-> | 640257 | 640386 | 130 | 32.3% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 310 | PI0713 | hypothetical protein | PI0714 | conserved hypothetical protein | ->-> | 650590 | 651484 | 895 | 32.7% | 0 | 0 | 0 | +: 1/2/1 | -: 1/3/1 | 1 | 0 | 0 | 0 | Result | |
| 311 | PI0721 | hypothetical protein | PI0723 | conserved hypothetical protein | ->-> | 655043 | 656182 | 1140 | 42.3% | 0 | 3 | 1 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 312 | PI0723 | conserved hypothetical protein | PI0724 | DNA polymerase III, delta subunit | ->-> | 657440 | 657542 | 103 | 31.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 313 | PI0724 | DNA polymerase III, delta subunit | PI0725 | hypothetical protein | ->-> | 658662 | 658762 | 101 | 30.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 314 | PI0725 | hypothetical protein | PI0726 | hypothetical protein | ->-> | 658994 | 659181 | 188 | 31.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
| 315 | PI0730 | hypothetical protein | PI0731 | conserved hypothetical protein | ->-> | 662227 | 662428 | 202 | 29.2% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 316 | PI0732 | conserved hypothetical protein | PI0733 | membrane protein; predicted exporter | ->-> | 664428 | 664528 | 101 | 49.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 317 | PI0733 | membrane protein; predicted exporter | PI0734 | ABC transporter, ATP-binding / permease | ->-> | 667019 | 667191 | 173 | 43.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 318 | PI0734 | ABC transporter, ATP-binding / permease | PI0735 | ABC transporter, ATP-binding / permease | ->-> | 668821 | 668932 | 112 | 42.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 319 | PI0740 | hypothetical protein | PI0742 | hypothetical protein | ->-> | 672426 | 672533 | 108 | 40.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 320 | PI0743 | hypothetical protein | PI0744 | DNA primase/mobilizable transposon, excision protein | ->-> | 673087 | 674310 | 1224 | 42.6% | 0 | 0 | 65 | +: 0/2/0 | -: 1/0/0 | 3 | 1 | 972 | 1081 | Result | tagtagaatgtgtagtatctccatatactactaactattgttgattatcaatcatttatattaaaatagtatgtagtaagaagaaagatggaaaagtttggaagggaaaa |
| 321 | PI0745 | conserved hypothetical protein | PI0746 | hypothetical protein | ->-> | 675731 | 676110 | 380 | 43.2% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 3 | 1 | 180 | 281 | Result | ggtagcattgcaagacgtcagtttgtacccacaaactgcgcttgctctcctcgtttaattatcgggaggttagaccgtaatcactccgttctcatcggtcag |
| 322 | PI0749 | hypothetical protein | PI0750 | zinc protease | ->-> | 677530 | 677885 | 356 | 34.8% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 1 | 67 | 178 | Result | atcaaaaacgcttgttattcaaagcaaattattatctttgcagatagaataacaagcgttctttgttgatgcagaaatctgcgattgaaagtacttcgctcgtttccaaatc |
| 323 | PI0754 | possible outer membrane receptor | PI0755 | hypothetical protein | ->-> | 686485 | 686830 | 346 | 33.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 324 | PI0755 | hypothetical protein | PI0756 | 50S ribosomal protein L7/L12 | ->-> | 686945 | 687285 | 341 | 31.7% | 0 | 0 | 0 | +: 1/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 325 | PI0756 | 50S ribosomal protein L7/L12 | PI0757 | possible hemagglutinin/protease | ->-> | 689041 | 689343 | 303 | 32% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 326 | PI0758 | hypothetical protein | PI0759 | hypothetical protein | ->-> | 690567 | 693902 | 3336 | 46.1% | 0 | 0 | 5 | +: 0/3/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 327 | PI0759 | hypothetical protein | PI0760 | ATP-dependent RNA helicase, DEAD/DEAH box family | ->-> | 694059 | 694225 | 167 | 34.7% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 328 | PI0760 | ATP-dependent RNA helicase, DEAD/DEAH box family | PI0761 | hypothetical protein | ->-> | 696050 | 696312 | 263 | 38.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 332 | PI0767 | possible TonB-dependent receptor | PI0768 | conserved hypothetical protein; possible acetyltransferase | ->-> | 704086 | 704211 | 126 | 29.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 333 | PI0770 | hypothetical protein | PI0771 | conserved hypothetical protein | ->-> | 706415 | 706663 | 249 | 35.3% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 52 | 0 | 0 | 0 | Result | |
| 334 | PI0771 | conserved hypothetical protein | PI0772 | conserved hypothetical protein | ->-> | 707168 | 707296 | 129 | 31.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 335 | PI0774 | phosphoserine aminotransferase (phosphoserine transaminase) | PI0775 | ATP-independent RNA helicase | ->-> | 710705 | 710913 | 209 | 23.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 336 | PI0777 | predicted TPR-repeat-containing protein | PI0778 | hypothetical protein | ->-> | 714535 | 714684 | 150 | 33.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 337 | PI0779 | predicted TPR-repeat-containing protein | PI0780 | DNA gyrase, subunit A (DNA topoisomerase (ATP-hydrolyzing)) | ->-> | 715861 | 716041 | 181 | 29.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 338 | PI0780 | DNA gyrase, subunit A (DNA topoisomerase (ATP-hydrolyzing)) | PI0781 | UDP-glucose/GDP-mannose dehydrogenase family; probable UDP-glucose 6-dehydrogenase | ->-> | 718574 | 719399 | 826 | 34.7% | 0 | 0 | 0 | +: 0/6/0 | -: 0/2/0 | 57 | 0 | 0 | 0 | Result | |
| 339 | PI0787 | glycosyltransferase | PI0788 | 3-methyladenine DNA glycosylase (DNA-3-methyladenine glycosylase I) | ->-> | 725854 | 726291 | 438 | 37.2% | 0 | 0 | 0 | +: 0/3/0 | -: 0/5/0 | 51 | 0 | 0 | 0 | Result | |
| 340 | PI0792 | conserved hypothetical protein | PI0793 | ABC transporter, permease protein | ->-> | 729688 | 729893 | 206 | 31.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 341 | PI0794 | long-chain-fatty-acid--CoA ligase | PI0796 | competence protein | ->-> | 732926 | 733463 | 538 | 35.5% | 0 | 0 | 0 | +: 0/4/0 | -: 0/3/0 | 48 | 0 | 0 | 0 | Result | |
| 343 | PI0797 | tRNA pseudouridine synthase A (pseudouridylate synthase) | PI0798 | malonyl CoA-acyl carrier protein transacylase | ->-> | 735813 | 736150 | 338 | 27.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 344 | PI0798 | malonyl CoA-acyl carrier protein transacylase | PI0799 | alpha-amylase family protein | ->-> | 737036 | 737222 | 187 | 42.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 345 | PI0800 | alanyl-tRNA synthetase (alanine--tRNA ligase) | PI0801 | hypothetical protein | ->-> | 739392 | 739504 | 113 | 36.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 346 | PI0803 | DNA-damage-inducible protein F | PI0804 | conserved hypothetical protein; possible membrane protein | ->-> | 741232 | 742073 | 842 | 30.2% | 0 | 0 | 0 | +: 1/3/2 | -: 0/5/0 | 1 | 0 | 0 | 0 | Result | |
| 349 | PI0810 | hypothetical protein | PI0812 | conserved hypothetical protein; possible ferredoxin | ->-> | 747087 | 750324 | 3238 | 41.2% | 0 | 0 | 11 | +: 3/2/2 | -: 3/3/6 | 1 | 0 | 0 | 0 | Result | |
| 350 | PI0814 | conserved hypothetical protein | PI0815 | hypothetical protein | ->-> | 754487 | 754614 | 128 | 37.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 351 | PI0815 | hypothetical protein | PI0816 | glycogen debranching enzyme | ->-> | 754738 | 755069 | 332 | 28% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 352 | PI0820 | hypothetical protein | PI0821 | conserved hypothetical protein | ->-> | 760041 | 760202 | 162 | 33.3% | 0 | 0 | 0 | +: 0/3/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 353 | PI0823 | glyceraldehyde 3-phosphate dehydrogenase, type I | PI0824 | large conductance mechanosensitive channel protein | ->-> | 763199 | 763476 | 278 | 26.6% | 0 | 0 | 0 | +: 1/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
| 354 | PI0829 | nucleotidyl transferase family; possible mannose-1-phosphate guanyltransferase | PI0830 | conserved hypothetical protein | ->-> | 766600 | 766715 | 116 | 30.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 355 | PI0831 | hypothetical protein | PI0832 | sigma-54-dependent transcriptional regulator | ->-> | 768509 | 768973 | 465 | 35.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 57 | 0 | 0 | 0 | Result | |
| 359 | PI0846 | transcription regulator, CRP family | PI0847 | thiamine biosynthesis lipoprotein, ApbE | ->-> | 781070 | 781269 | 200 | 44.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 362 | PI0851 | hypothetical protein | PI0852 | conserved hypothetical protein | ->-> | 784585 | 784691 | 107 | 28% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 363 | PI0852 | conserved hypothetical protein | PI0853 | glycosyl transferase, group 2 family protein | ->-> | 785496 | 785654 | 159 | 30.8% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 364 | PI0854 | MiaB-like tRNA modifying enzyme | PI0855 | hypothetical protein | ->-> | 788060 | 789233 | 1174 | 33.8% | 0 | 0 | 0 | +: 2/4/5 | -: 0/7/0 | 46 | 0 | 0 | 0 | Result | |
| 365 | PI0855 | hypothetical protein | PI0856 | hypothetical protein | ->-> | 789606 | 789720 | 115 | 34.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 366 | PI0856 | hypothetical protein | PI0858 | carbamyl phosphate synthase, large subunit | ->-> | 789988 | 790232 | 245 | 27.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 369 | PI0862 | polysaccharide export outer membrane protein | PI0863 | L-asparaginase I | ->-> | 799183 | 799576 | 394 | 29.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 370 | PI0864 | dihydrodipicolinate synthase | PI0865 | possible phosphoglycerol transferase | ->-> | 801519 | 801776 | 258 | 23.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 371 | PI0865 | possible phosphoglycerol transferase | PI0866 | hypothetical protein | ->-> | 803745 | 803915 | 171 | 43.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 372 | PI0869 | possible exodeoxyribonuclease VII (small subunit) | PI0870 | branched-chain amino acid aminotransferase | ->-> | 805835 | 806072 | 238 | 34.9% | 0 | 0 | 4 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 373 | PI0872 | hypothetical protein | PI0873 | conserved hypothetical protein; possible permease | ->-> | 807868 | 808107 | 240 | 37.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 374 | PI0873 | conserved hypothetical protein; possible permease | PI0874 | conserved hypothetical protein | ->-> | 809017 | 809117 | 101 | 27.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 375 | PI0874 | conserved hypothetical protein | PI0875 | conserved hypothetical protein | ->-> | 810342 | 810747 | 406 | 36.9% | 0 | 0 | 0 | +: 0/2/0 | -: 0/3/0 | 50 | 0 | 0 | 0 | Result | |
| 377 | PI0879 | hypothetical protein | PI0880 | hypothetical protein | ->-> | 814112 | 814477 | 366 | 30.9% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 379 | PI0883 | para-aminobenzoate synthase component I | PI0885 | hypothetical protein | ->-> | 817312 | 817419 | 108 | 36.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 380 | PI0888 | hypothetical protein | PI0889 | pyruvate kinase | ->-> | 818674 | 818897 | 224 | 45.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 381 | PI0889 | pyruvate kinase | PI0890 | ribose 5-phosphate isomerase B | ->-> | 820416 | 820556 | 141 | 32.6% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 382 | PI0891 | transketolase | PI0892 | acyl-ACP thioesterase | ->-> | 822966 | 823270 | 305 | 30.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 383 | PI0892 | acyl-ACP thioesterase | PI0893 | outer membrane protein 41 precursor | ->-> | 824000 | 824552 | 553 | 31.5% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 49 | 0 | 0 | 0 | Result | |
| 384 | PI0893 | outer membrane protein 41 precursor | PI0894 | 2-oxoglutarate oxidoreductase, gamma subunit (2-oxoglutarate-ferredoxin oxidoreductase) | ->-> | 825723 | 825915 | 193 | 28% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 385 | PI0900 | signal recognition particle protein | PI0901 | hypothetical protein | ->-> | 831153 | 831367 | 215 | 25.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 386 | PI0901 | hypothetical protein | PI0902 | hypothetical protein | ->-> | 832268 | 832430 | 163 | 39.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 387 | PI0902 | hypothetical protein | PI0903 | conserved hypothetical protein | ->-> | 832641 | 832813 | 173 | 27.2% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 388 | PI0904 | conserved hypothetical protein | PI0905 | hypothetical protein | ->-> | 834356 | 834538 | 183 | 30.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 389 | PI0905 | hypothetical protein | PI0907 | NAD-dependent DNA ligase | ->-> | 834758 | 835026 | 269 | 36.8% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 391 | PI0910 | possible sodium hydrogen antiporter (Na+/H+ antiporter) | PI0911 | tyrosine phenol-lyase | ->-> | 839605 | 839895 | 291 | 26.5% | 0 | 0 | 0 | +: 1/1/0 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
| 394 | PI0914 | ATPase, AAA family | PI0915 | hypothetical protein | ->-> | 845053 | 845322 | 270 | 30.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 395 | PI0916 | hypothetical protein | PI0917 | phosphoglycolate phosphatase | ->-> | 845976 | 846510 | 535 | 31.8% | 0 | 0 | 0 | +: 1/4/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 396 | PI0918 | Fe-S oxidoreductase, family 2 | PI0919 | conserved hypothetical protein | ->-> | 849297 | 849437 | 141 | 31.2% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 397 | PI0922 | conserved hypothetical protein | PI0923 | 6-phosphofructokinase | ->-> | 853254 | 853455 | 202 | 20.8% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 398 | PI0925 | ribosomal protein L11 methyltransferase | PI0926 | hypothetical protein | ->-> | 856699 | 856963 | 265 | 33.6% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 399 | PI0926 | hypothetical protein | PI0927 | transglutaminase-related protein | ->-> | 857108 | 857422 | 315 | 30.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 400 | PI0927 | transglutaminase-related protein | PI0928 | hypothetical protein | ->-> | 859757 | 859990 | 234 | 37.2% | 0 | 0 | 0 | +: 1/1/1 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 401 | PI0928 | hypothetical protein | PI0929 | copper homeostasis protein | ->-> | 860333 | 860433 | 101 | 37.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 402 | PI0930 | alpha-L-fucosidase precursor | PI0931 | hypothetical protein | ->-> | 862473 | 862791 | 319 | 30.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 403 | PI0931 | hypothetical protein | PI0932 | conserved hypothetical protein; possible hemin receptor | ->-> | 863134 | 863993 | 860 | 48.4% | 0 | 0 | 3 | +: 0/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
| 404 | PI0932 | conserved hypothetical protein; possible hemin receptor | PI0933 | hypothetical protein | ->-> | 865425 | 865839 | 415 | 35.4% | 0 | 0 | 0 | +: 0/3/0 | -: 1/2/2 | 46 | 0 | 0 | 0 | Result | |
| 405 | PI0934 | hypothetical protein | PI0935 | collagenase, protease | ->-> | 866193 | 866436 | 244 | 28.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 406 | PI0938 | hypothetical protein | PI0939 | TonB-dependent outer membrane protein | ->-> | 869602 | 870008 | 407 | 30.2% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 407 | PI0939 | TonB-dependent outer membrane protein | PI0940 | ribonuclease G | ->-> | 872502 | 872920 | 419 | 32.5% | 0 | 0 | 0 | +: 0/3/0 | -: 0/4/0 | 2 | 0 | 0 | 0 | Result | |
| 408 | PI0942 | DNA-binding protein HU | PI0944 | hypothetical protein | ->-> | 875040 | 875207 | 168 | 26.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 409 | PI0943 | conserved hypothetical protein | PI0945 | sodium:solute symporter family protein | ->-> | 876052 | 876388 | 337 | 34.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 410 | PI0945 | sodium:solute symporter family protein | PI0946 | glutathione peroxidase | ->-> | 877685 | 878112 | 428 | 34.1% | 0 | 0 | 0 | +: 0/4/0 | -: 0/2/0 | 58 | 0 | 0 | 0 | Result | |
| 411 | PI0946 | glutathione peroxidase | PI0947 | conserved hypothetical protein | ->-> | 878665 | 878915 | 251 | 28.3% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 412 | PI0947 | conserved hypothetical protein | PI0948 | hypothetical protein | ->-> | 880770 | 881219 | 450 | 30% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 413 | PI0948 | hypothetical protein | PI0949 | endonuclease | ->-> | 882039 | 882403 | 365 | 35.3% | 0 | 0 | 0 | +: 0/4/0 | -: 0/2/0 | 46 | 0 | 0 | 0 | Result | |
| 414 | PI0949 | endonuclease | PI0950 | 50S ribosomal protein L31 | ->-> | 883340 | 883466 | 127 | 37.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 415 | PI0950 | 50S ribosomal protein L31 | PI0952 | conserved hypothetical protein | ->-> | 883716 | 883857 | 142 | 30.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 416 | PI0953 | hypothetical protein | PI0954 | hypothetical protein | ->-> | 885451 | 885706 | 256 | 46.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 417 | PI0956 | conserved hypothetical protein | PI0957 | conserved hypothetical protein | ->-> | 888797 | 888928 | 132 | 20.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 418 | PI0961 | conserved hypothetical protein | PI0962 | phosphoglycerate mutase | ->-> | 892104 | 892240 | 137 | 23.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 419 | PI0962 | phosphoglycerate mutase | PI0963 | hypothetical protein | ->-> | 892763 | 893337 | 575 | 35.5% | 0 | 0 | 0 | +: 0/3/0 | -: 0/3/0 | 64 | 0 | 0 | 0 | Result | |
| 420 | PI0966 | possible glycosyl hydrolase | PI0967 | conserved hypothetical protein | ->-> | 895270 | 895563 | 294 | 40.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 421 | PI0970 | hypothetical protein | PI0971 | glycine cleavage system T protein (aminomethyltransferase) | ->-> | 897715 | 897986 | 272 | 31.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 422 | PI0976 | dihydrolipoamide dehydrogenase (dihydrolipoyl dehydrogenanse) | PI0977 | riboflavin synthase, alpha subunit | ->-> | 903793 | 904182 | 390 | 37.4% | 0 | 0 | 0 | +: 0/3/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 423 | PI0977 | riboflavin synthase, alpha subunit | PI0978 | hypothetical protein | ->-> | 904762 | 905006 | 245 | 29.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 424 | PI0979 | transcriptional regulator, tetR family | PI0980 | conserved hypothetical protein | ->-> | 905739 | 905842 | 104 | 40.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 425 | PI0981 | outer membrane protein, TonB dependent receptor | PI0982 | hypothetical protein | ->-> | 909451 | 909571 | 121 | 33.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 426 | PI0982 | hypothetical protein | PI0983 | hypothetical protein | ->-> | 909710 | 909889 | 180 | 27.8% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 427 | PI0984 | hypothetical protein | PI0985 | aspartyl-tRNA synthetase | ->-> | 910205 | 910313 | 109 | 47.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 428 | PI0985 | aspartyl-tRNA synthetase | PI0987 | hypothetical protein | ->-> | 911973 | 912119 | 147 | 25.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 429 | PI0988 | hypothetical protein | PI0989 | mannose-1-phosphate guanylyltransferase | ->-> | 912814 | 912972 | 159 | 31.4% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 430 | PI0990 | GDP-mannose 4,6-dehydratase | PI0991 | conserved hypothetical protein | ->-> | 915115 | 915448 | 334 | 39.2% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 53 | 0 | 0 | 0 | Result | |
| 431 | PI0994 | glutaminyl-tRNA synthetase | PI0996 | hypothetical protein | ->-> | 920270 | 920597 | 328 | 26.2% | 0 | 0 | 0 | +: 2/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 432 | PI0995 | hypothetical protein | PI0997 | hypothetical protein | ->-> | 920884 | 921114 | 231 | 26.8% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 433 | PI0997 | hypothetical protein | PI0999 | hypothetical protein | ->-> | 922354 | 922515 | 162 | 32.7% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 434 | PI1003 | conserved hypothetical protein | PI1004 | conserved hypothetical protein | ->-> | 925779 | 925959 | 181 | 32% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 435 | PI1005 | hypothetical protein | PI1006 | conserved hypothetical protein | ->-> | 926542 | 926743 | 202 | 32.7% | 0 | 0 | 0 | +: 2/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 436 | PI1007 | conserved hypothetical protein | PI1008 | cytochrome c nitrite reductase, small subunit | ->-> | 928632 | 928923 | 292 | 31.8% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 438 | PI1011 | cytochrome c biogenesis protein CycY | PI1012 | DNA-binding protein, histone-like family | ->-> | 933050 | 933187 | 138 | 23.2% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 439 | PI1012 | DNA-binding protein, histone-like family | PI1013 | probable transcriptional regulator | ->-> | 933605 | 933903 | 299 | 36.1% | 0 | 0 | 0 | +: 0/0/0 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
| 440 | PI1013 | probable transcriptional regulator | PI1014 | prismane protein, hybrid-cluster protein | ->-> | 934429 | 934665 | 237 | 32.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 441 | PI1014 | prismane protein, hybrid-cluster protein | PI1015 | conserved hypothetical protein | ->-> | 936193 | 936582 | 390 | 29.7% | 0 | 0 | 9 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 442 | PI1019 | hypothetical protein | PI1020 | hypothetical protein | ->-> | 938473 | 938608 | 136 | 23.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 443 | PI1020 | hypothetical protein | PI1021 | conserved hypothetical protein; possible methyltransferase | ->-> | 938840 | 939124 | 285 | 30.5% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
| 444 | PI1021 | conserved hypothetical protein; possible methyltransferase | PI1022 | hypothetical protein | ->-> | 939695 | 940052 | 358 | 29.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 445 | PI1025 | tRNA modification GTPase | PI1026 | uridine phosphorylase | ->-> | 942293 | 942439 | 147 | 31.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 446 | PI1027 | hypothetical protein | PI1028 | glutamate synthase, small subunit | ->-> | 943460 | 943559 | 100 | 27% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 447 | PI1028 | glutamate synthase, small subunit | PI1029 | seryl-tRNA synthetase | ->-> | 945912 | 946077 | 166 | 25.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 448 | PI1029 | seryl-tRNA synthetase | PI1030 | biotin carboxyl carrier protein | ->-> | 947266 | 947985 | 720 | 34.6% | 0 | 0 | 0 | +: 1/3/0 | -: 1/3/3 | 54 | 0 | 0 | 0 | Result | |
| 449 | PI1032 | methylmalonyl-CoA decarboxylase, alpha subunit | PI1033 | ATP-dependent RNA helicase, DEAD/DEAH box family | ->-> | 950223 | 950436 | 214 | 31.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 450 | PI1036 | ATP-dependent Lon protease | PI1037 | probable methyltransferase | ->-> | 957058 | 957167 | 110 | 23.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 451 | PI1040 | 8-amino-7-oxononanoate synthase | PI1041 | hypothetical protein | ->-> | 960263 | 960582 | 320 | 32.5% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 452 | PI1041 | hypothetical protein | PI1043 | conserved hypothetical protein | ->-> | 960736 | 960994 | 259 | 34.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 453 | PI1044 | excinuclease ABC, subunit A | PI1045 | cytidine/deoxycytidylate deaminase family protein | ->-> | 964700 | 965243 | 544 | 33.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 51 | 0 | 0 | 0 | Result | |
| 455 | PI1050 | conserved hypothetical protein | PI1051 | hypothetical protein | ->-> | 969759 | 970192 | 434 | 33.9% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 456 | PI1051 | hypothetical protein | PI1052 | fructose-1,6-bisphosphatase | ->-> | 970289 | 970631 | 343 | 30.9% | 0 | 0 | 0 | +: 0/3/0 | -: 0/2/0 | 51 | 0 | 0 | 0 | Result | |
| 457 | PI1053 | conserved hypothetical protein | PI1054 | conserved hypothetical protein | ->-> | 973699 | 973835 | 137 | 35.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 458 | PI1056 | cell-division ATP-binding protein | PI1057 | hypothetical protein | ->-> | 977161 | 977425 | 265 | 27.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 459 | PI1057 | hypothetical protein | PI1058 | possible FHA domain protein | ->-> | 977609 | 977716 | 108 | 33.3% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 460 | PI1059 | conserved hypothetical protein | PI1060 | conserved hypothetical protein | ->-> | 979235 | 979339 | 105 | 26.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 461 | PI1062 | TPR repeat protein | PI1063 | excinuclease ABC, subunit B | ->-> | 980841 | 981104 | 264 | 30.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 462 | PI1064 | hypothetical protein | PI1065 | hypothetical protein | ->-> | 983385 | 983521 | 137 | 23.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 463 | PI1072 | hypothetical protein | PI1073 | hemogluttinin A-related protein (HagA) | ->-> | 990564 | 990732 | 169 | 28.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 464 | PI1073 | hemogluttinin A-related protein (HagA) | PI1074 | hypothetical protein | ->-> | 993754 | 993854 | 101 | 22.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 465 | PI1074 | hypothetical protein | PI1075 | pyruvate phosphate dikinase | ->-> | 995508 | 995967 | 460 | 27.6% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 466 | PI1075 | pyruvate phosphate dikinase | PI1076 | hypothetical protein | ->-> | 998632 | 999032 | 401 | 26.7% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 467 | PI1076 | hypothetical protein | PI1077 | hypothetical protein | ->-> | 999126 | 999338 | 213 | 27.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 468 | PI1079 | conserved hypothetical protein | PI1080 | conserved hypothetical protein; possible outer membrane lipoprotein | ->-> | 1000216 | 1000403 | 188 | 21.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 469 | PI1082 | polypeptide deformylase | PI1083 | TPR-repeat-containing protein | ->-> | 1001983 | 1002114 | 132 | 40.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 470 | PI1083 | TPR-repeat-containing protein | PI1084 | threonyl-tRNA synthetase | ->-> | 1002649 | 1002803 | 155 | 25.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 474 | PI1087 | conserved hypothetical protein | PI1088 | conserved hypothetical protein | ->-> | 1011618 | 1011745 | 128 | 27.3% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 475 | PI1088 | conserved hypothetical protein | PI1089 | conserved hypothetical protein | ->-> | 1012913 | 1013014 | 102 | 25.5% | 0 | 0 | 0 | +: 0/3/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 476 | PI1089 | conserved hypothetical protein | PI1090 | tRNA uracil 5-methyltransferase | ->-> | 1014101 | 1014505 | 405 | 30.4% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 477 | PI1090 | tRNA uracil 5-methyltransferase | PI1091 | transcriptional regulator, AsnC family | ->-> | 1015841 | 1016319 | 479 | 33% | 0 | 0 | 0 | +: 2/1/1 | -: 0/1/0 | 45 | 0 | 0 | 0 | Result | |
| 478 | PI1091 | transcriptional regulator, AsnC family | PI1092 | conserved hypothetical protein | ->-> | 1016815 | 1016919 | 105 | 28.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 479 | PI1093 | conserved hypothetical protein | PI1094 | recombination protein | ->-> | 1019257 | 1019375 | 119 | 41.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 480 | PI1099 | low molecular weight protein-tyrosine-phosphatase | PI1100 | conserved hypothetical protein; possible rhodanese-domain protein | ->-> | 1023697 | 1024049 | 353 | 28.6% | 0 | 0 | 0 | +: 1/3/0 | -: 0/2/0 | 2 | 0 | 0 | 0 | Result | |
| 481 | PI1100 | conserved hypothetical protein; possible rhodanese-domain protein | PI1101 | hypothetical protein | ->-> | 1024452 | 1024736 | 285 | 27% | 0 | 0 | 0 | +: 1/1/1 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 482 | PI1102 | conserved hypothetical protein | PI1103 | hypothetical protein | ->-> | 1026308 | 1026686 | 379 | 33.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 3 | 0 | 0 | 0 | Result | |
| 483 | PI1103 | hypothetical protein | PI1104 | GDP-4-keto-6-deoxy-D-mannose-3,5-epimerase-4-redu ctase | ->-> | 1027236 | 1027888 | 653 | 27.9% | 0 | 0 | 0 | +: 0/3/0 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
| 484 | PI1105 | hypothetical protein | PI1106 | conserved hypothetical protein | ->-> | 1030296 | 1030605 | 310 | 28.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 487 | PI1112 | glycosyltransferase | PI1113 | conserved hypothetical protein | ->-> | 1037702 | 1038020 | 319 | 22.6% | 0 | 0 | 0 | +: 2/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 488 | PI1113 | conserved hypothetical protein | PI1115 | conserved hypothetical protein | ->-> | 1039206 | 1039383 | 178 | 25.8% | 0 | 0 | 0 | +: 0/3/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 489 | PI1117 | glycosyl transferase, family 2 | PI1118 | glycosyl transferases, group 1 | ->-> | 1042340 | 1042635 | 296 | 31.8% | 0 | 0 | 0 | +: 0/0/0 | -: 1/2/2 | 10 | 0 | 0 | 0 | Result | |
| 490 | PI1123 | conserved hypothetical protein | PI1124 | possible nucleoside-diphosphate sugar epimerase | ->-> | 1049258 | 1049663 | 406 | 27.3% | 0 | 0 | 0 | +: 4/2/4 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 491 | PI1125 | hypothetical protein | PI1126 | methionyl-tRNA formyltransferase | ->-> | 1051577 | 1051692 | 116 | 15.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 492 | PI1128 | probable yrdC domain protein, translation factor (SUA5) | PI1129 | hypothetical protein | ->-> | 1055116 | 1055516 | 401 | 31.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 493 | PI1129 | hypothetical protein | PI1130 | probable glucose/galactose transporter | ->-> | 1055664 | 1055805 | 142 | 31% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 494 | PI1130 | probable glucose/galactose transporter | PI1131 | folylpolyglutamate synthase | ->-> | 1057117 | 1057263 | 147 | 26.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 495 | PI1136 | conserved hypothetical protein | PI1137 | hypothetical protein | ->-> | 1062602 | 1063109 | 508 | 39.8% | 0 | 0 | 0 | +: 1/5/1 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 496 | PI1138 | hypothetical protein | PI1139 | endopeptidase, endothelin-converting enzyme | ->-> | 1064874 | 1065355 | 482 | 29.5% | 0 | 0 | 0 | +: 0/1/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
| 497 | PI1139 | endopeptidase, endothelin-converting enzyme | PI1140 | ABC transporter, ATP-binding protein | ->-> | 1067387 | 1067512 | 126 | 23.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 498 | PI1140 | ABC transporter, ATP-binding protein | PI1141 | hypothetical protein | ->-> | 1069478 | 1069602 | 125 | 35.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 499 | PI1141 | hypothetical protein | PI1143 | hypothetical protein | ->-> | 1069774 | 1069919 | 146 | 34.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 500 | PI1145 | 50S ribosomal protein L35 | PI1146 | translation initiation factor IF3 | ->-> | 1072855 | 1072969 | 115 | 33% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 501 | PI1146 | translation initiation factor IF3 | PI1147 | conserved hypothetical protein | ->-> | 1073564 | 1073821 | 258 | 31.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 502 | PI1147 | conserved hypothetical protein | PI1148 | 50S ribosomal protein L9 | ->-> | 1074830 | 1074993 | 164 | 32.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 503 | PI1153 | histidine kinase sensor protein | PI1154 | conserved hypothetical protein; possible periplasmic solute-binding protein | ->-> | 1078699 | 1079112 | 414 | 28% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 504 | PI1155 | hypothetical protein | PI1156 | possible glycerate kinase family protein | ->-> | 1080413 | 1080722 | 310 | 30.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 505 | PI1160 | possible phosphatidylinositol-4-phosphate 5-kinase | PI1161 | conserved hypothetical protein | ->-> | 1085955 | 1086080 | 126 | 28.6% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 506 | PI1165 | hypothetical protein | PI1167 | hypothetical protein | ->-> | 1089697 | 1089827 | 131 | 26% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 507 | PI1168 | hypothetical protein | PI1169 | hypothetical protein | ->-> | 1089983 | 1090110 | 128 | 30.5% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 508 | PI1172 | sensor histidine kinase | PI1173 | transcription regulatory protein, LacI family | ->-> | 1094975 | 1095190 | 216 | 26.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 509 | PI1174 | hypothetical protein | PI1175 | conserved hypothetical protein | ->-> | 1097103 | 1097511 | 409 | 36.2% | 0 | 0 | 0 | +: 1/3/0 | -: 0/4/0 | 51 | 0 | 0 | 0 | Result | |
| 510 | PI1176 | endonuclease III | PI1177 | hypothtical protein | ->-> | 1098880 | 1098995 | 116 | 27.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 511 | PI1177 | hypothtical protein | PI1178 | histidyl-tRNA synthetase | ->-> | 1099215 | 1099388 | 174 | 37.9% | 0 | 0 | 0 | +: 1/3/0 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
| 515 | PI1182 | hypothetical protein | PI1183 | conserved hypothetical protein | ->-> | 1104432 | 1104581 | 150 | 35.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 516 | PI1190 | conserved hypothetical protein | PI1191 | phosphoribosyl pyrophosphate synthetase | ->-> | 1109380 | 1109603 | 224 | 27.2% | 0 | 0 | 0 | +: 0/2/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 517 | PI1191 | phosphoribosyl pyrophosphate synthetase | PI1193 | conserved hypothetical protein | ->-> | 1110438 | 1110575 | 138 | 33.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 518 | PI1192 | carboxynorspermidine decarboxylase | PI1194 | DnaJ protein (Hsp-40) | ->-> | 1112414 | 1112533 | 120 | 28.3% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 519 | PI1194 | DnaJ protein (Hsp-40) | PI1195 | hypothetical protein | ->-> | 1113185 | 1113310 | 126 | 34.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 520 | PI1197 | pseudouridylate synthetase | PI1198 | acetyltransferase | ->-> | 1114550 | 1114721 | 172 | 30.2% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 521 | PI1201 | peptidyl-arginine deiminase | PI1202 | UvrD/REP helicase | ->-> | 1117896 | 1118278 | 383 | 27.2% | 0 | 0 | 0 | +: 1/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 522 | PI1204 | hypothetical protein | PI1206 | ATP-dependent DNA helicase, UvrD/PcrA/Rep family | ->-> | 1124696 | 1124837 | 142 | 37.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 523 | PI1208 | monofunctional biosynthetic peptidoglycan transglycosylase | PI1209 | phosphate starvation-inducible protein, phoH family | ->-> | 1127940 | 1128098 | 159 | 28.3% | 0 | 0 | 0 | +: 1/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 525 | PI1214 | peptide chain release factor 1 | PI1215 | orotidine 5'-phosphate decarboxylase | ->-> | 1133881 | 1134106 | 226 | 30.1% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 526 | PI1222 | hypothetical protein | PI1223 | conserved hypothetical protein | ->-> | 1143439 | 1143676 | 238 | 41.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 527 | PI1223 | conserved hypothetical protein | PI1224 | sensor histidine kinase and response regulator | ->-> | 1144520 | 1144713 | 194 | 45.4% | 0 | 0 | 0 | +: 0/3/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 528 | PI1224 | sensor histidine kinase and response regulator | PI1225 | hypothetical protein | ->-> | 1147618 | 1147897 | 280 | 33.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 529 | PI1226 | hypothetical protein | PI1227 | conserved hypothetical protein; possible DNA-binding protein, histone-like family | ->-> | 1148324 | 1148587 | 264 | 44.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 530 | PI1227 | conserved hypothetical protein; possible DNA-binding protein, histone-like family | PI1228 | conserved hypothetical protein | ->-> | 1149035 | 1149184 | 150 | 50% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 531 | PI1229 | conserved hypothetical protein | PI1230 | probable metallo-beta-lactamase family protein | ->-> | 1151730 | 1151979 | 250 | 36.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 532 | PI1230 | probable metallo-beta-lactamase family protein | PI1232 | conserved hypothetical protein | ->-> | 1152790 | 1152896 | 107 | 44.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 533 | PI1233 | conserved hypothetical protein; possible MazG family protein | PI1234 | valyl-tRNA synthetase (valine--tRNA ligase) | ->-> | 1154308 | 1154498 | 191 | 29.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 534 | PI1234 | valyl-tRNA synthetase (valine--tRNA ligase) | PI1235 | 60 kDa chaperonin, groEL, cpn60 | ->-> | 1157190 | 1157325 | 136 | 29.4% | 0 | 0 | 0 | +: 1/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 536 | PI1236 | 10 kDa chaperonin, cpn10, GroES | PI1237 | ATP-dependent DNA helicase | ->-> | 1159341 | 1159827 | 487 | 34.9% | 0 | 0 | 0 | +: 0/2/0 | -: 1/2/1 | 1 | 0 | 0 | 0 | Result | |
| 538 | PI1238 | single-strand DNA-specific exonuclease | PI1239 | possible peptidase C1-like family (aminopeptidase C) | ->-> | 1163499 | 1163637 | 139 | 24.5% | 0 | 0 | 0 | +: 1/1/1 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 539 | PI1240 | probable Xaa-Pro dipeptidase (aminopeptidase P) | PI1241 | probable phosphoesterase | ->-> | 1166333 | 1166504 | 172 | 32.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 540 | PI1242 | tRNA (guanine-N1-)-methyltransferase | PI1243 | conserved hypothetical protein | ->-> | 1167941 | 1168073 | 133 | 26.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 541 | PI1243 | conserved hypothetical protein | PI1244 | hypothetical protein | ->-> | 1168821 | 1168942 | 122 | 39.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 542 | PI1244 | hypothetical protein | PI1246 | conserved hypothetical protein; possible lipoprotein | ->-> | 1169237 | 1169531 | 295 | 40.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 543 | PI1245 | hypothetical protein | PI1247 | conserved hypothetical protein | ->-> | 1171553 | 1171769 | 217 | 34.1% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 544 | PI1247 | conserved hypothetical protein | PI1248 | conserved hypothetical protein | ->-> | 1173243 | 1173353 | 111 | 22.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 545 | PI1252 | hypothetical protein | PI1253 | hypothetical protein | ->-> | 1175501 | 1175655 | 155 | 30.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 546 | PI1254 | probable glucokinase | PI1255 | conserved hypothetical protein | ->-> | 1176707 | 1176848 | 142 | 26.8% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 550 | PI1266 | hypothetical protein | PI1267 | probable integrase | ->-> | 1185998 | 1186244 | 247 | 39.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 553 | PI1271 | transcriptional regulator, AraC/XylS family | PI1272 | possible transcriptional regulator | ->-> | 1191345 | 1191841 | 497 | 28.2% | 0 | 0 | 0 | +: 1/1/0 | -: 2/1/2 | 45 | 0 | 0 | 0 | Result | |
| 554 | PI1279 | RNA polymerase sigma factor/ECF subfamily (sigma-70) | PI1280 | conserved hypothetical protein | ->-> | 1195952 | 1196104 | 153 | 24.2% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 555 | PI1280 | conserved hypothetical protein | PI1281 | hypothetical protein | ->-> | 1196615 | 1196784 | 170 | 23.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 556 | PI1281 | hypothetical protein | PI1282 | ATP synthase, gamma subunit (F0F1-ATPase, gamma subunit) | ->-> | 1197052 | 1197357 | 306 | 28.1% | 0 | 0 | 0 | +: 0/1/0 | -: 1/4/1 | 1 | 0 | 0 | 0 | Result | |
| 557 | PI1284 | ATP synthase, delta subunit | PI1285 | ATP synthase, B subunit | ->-> | 1200384 | 1200487 | 104 | 39.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 558 | PI1290 | ATP synthase, beta subunit | PI1291 | 6-phosphofructokinase | ->-> | 1204636 | 1204791 | 156 | 30.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 559 | PI1291 | 6-phosphofructokinase | PI1292 | conserved hypothetical protein | ->-> | 1205767 | 1206245 | 479 | 30.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 562 | PI1300 | probable glycosyltransferase | PI1302 | hypothetical protein | ->-> | 1214431 | 1214936 | 506 | 31.2% | 0 | 0 | 0 | +: 1/1/0 | -: 1/1/1 | 1 | 0 | 0 | 0 | Result | |
| 564 | PI1305 | conserved hypothetical protein | PI1306 | dipeptidyl peptidase IV | ->-> | 1219793 | 1220403 | 611 | 30% | 0 | 0 | 0 | +: 0/2/0 | -: 0/4/0 | 1 | 0 | 0 | 0 | Result | |
| 565 | PI1306 | dipeptidyl peptidase IV | PI1307 | possible Fe-S oxidoreductase | ->-> | 1222513 | 1222656 | 144 | 30.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 566 | PI1308 | hypothetical protein | PI1309 | excinuclease ABC, A subunit | ->-> | 1223778 | 1223890 | 113 | 34.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 567 | PI1312 | conserved hypothetical protein | PI1313 | possible POT family (proton-dependent oligopeptide transport family) | ->-> | 1229738 | 1229849 | 112 | 32.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 568 | PI1314 | hypothetical protein | PI1315 | conserved hypothetical protein | ->-> | 1231484 | 1231915 | 432 | 29.2% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 569 | PI1316 | conserved hypothetical protein | PI1317 | surface antigen BspA | ->-> | 1232716 | 1232977 | 262 | 24.8% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 570 | PI1318 | hypothetical protein | PI1319 | possible OmpA , outer membrane protein-related protein | ->-> | 1235616 | 1235794 | 179 | 26.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 571 | PI1319 | possible OmpA , outer membrane protein-related protein | PI1320 | conserved hypothetical protein | ->-> | 1239053 | 1239170 | 118 | 22% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 572 | PI1322 | nucleoside permease | PI1323 | conserved hypothetical protein | ->-> | 1241697 | 1241949 | 253 | 28.5% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 573 | PI1323 | conserved hypothetical protein | PI1324 | conserved hypothetical protein | ->-> | 1242544 | 1242659 | 116 | 26.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 574 | PI1324 | conserved hypothetical protein | PI1325 | conserved hypothetical protein | ->-> | 1243086 | 1243554 | 469 | 30.3% | 0 | 0 | 0 | +: 1/3/0 | -: 1/1/0 | 31 | 0 | 0 | 0 | Result | |
| 575 | PI1325 | conserved hypothetical protein | PI1326 | Na+-driven multidrug efflux pump | ->-> | 1244155 | 1244321 | 167 | 23.4% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 576 | PI1332 | aminotransferase, possible pyridoxal-phosphate-dependent aminotransferase | PI1333 | conserved hypothetical protein | ->-> | 1250627 | 1250916 | 290 | 32.1% | 0 | 0 | 0 | +: 0/4/0 | -: 0/1/0 | 59 | 0 | 0 | 0 | Result | |
| 577 | PI1333 | conserved hypothetical protein | PI1334 | ferrodoxin | ->-> | 1251433 | 1251543 | 111 | 36.9% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 578 | PI1335 | Fe-S oxidoreductase | PI1336 | dTDP-4-dehydrorhamnose 3,5-epimerase | ->-> | 1253630 | 1253978 | 349 | 26.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 579 | PI1344 | hypothetical protein | PI1345 | conserved hypothetical protein; possible TPR-repeat-containing protein | ->-> | 1259165 | 1259324 | 160 | 27.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 580 | PI1345 | conserved hypothetical protein; possible TPR-repeat-containing protein | PI1346 | hypothetical protein | ->-> | 1260741 | 1260953 | 213 | 31% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 581 | PI1346 | hypothetical protein | PI1347 | DNA damage-inducible protein | ->-> | 1261089 | 1261269 | 181 | 31.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 582 | PI1347 | DNA damage-inducible protein | PI1348 | glycosyltransferase | ->-> | 1262239 | 1262528 | 290 | 36.2% | 0 | 0 | 3 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 583 | PI1349 | polysaccharide export protein | PI1350 | conserved hypothetical protein | ->-> | 1265781 | 1265956 | 176 | 25% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 584 | PI1356 | hypothetical protein | PI1357 | glycosyltransferase | ->-> | 1273401 | 1273566 | 166 | 31.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 585 | PI1357 | glycosyltransferase | PI1358 | phospho-N-acetylmuramoyl-pentapeptide-transferase | ->-> | 1274320 | 1274466 | 147 | 23.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 586 | PI1360 | conserved hypothetical protein | PI1361 | CTP synthase (UTP-ammonia lyase) | ->-> | 1277656 | 1278384 | 729 | 31.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 47 | 0 | 0 | 0 | Result | |
| 587 | PI1365 | conserved hypothetical protein; probable transmembrane protein | PI1366 | conserved hypothetical protein; possible hydrolase, HAD superfamily | ->-> | 1285736 | 1286185 | 450 | 29.8% | 0 | 0 | 0 | +: 0/2/0 | -: 0/5/0 | 2 | 0 | 0 | 0 | Result | |
| 588 | PI1366 | conserved hypothetical protein; possible hydrolase, HAD superfamily | PI1367 | redox-sensitive transcriptional activator, OxyR | ->-> | 1286708 | 1286999 | 292 | 36.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 589 | PI1367 | redox-sensitive transcriptional activator, OxyR | PI1368 | enolase (phosphopyruvate hydratase) | ->-> | 1287924 | 1288262 | 339 | 31.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 590 | PI1368 | enolase (phosphopyruvate hydratase) | PI1369 | alkyl hydroperoxide reductase, subunit C | ->-> | 1289568 | 1289919 | 352 | 27.3% | 0 | 0 | 0 | +: 1/2/2 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 591 | PI1369 | alkyl hydroperoxide reductase, subunit C | PI1370 | alkyl hydroperoxide reductase, subunit F | ->-> | 1290484 | 1290679 | 196 | 34.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 592 | PI1370 | alkyl hydroperoxide reductase, subunit F | PI1371 | hypothetical protein | ->-> | 1292237 | 1292498 | 262 | 32.1% | 0 | 0 | 0 | +: 1/3/0 | -: 0/1/0 | 13 | 0 | 0 | 0 | Result | |
| 595 | PI1372 | thiamine monophosphate kinase | PI1373 | purine nucleoside phosphorylase (PNP) | ->-> | 1294032 | 1294170 | 139 | 35.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 596 | PI1374 | tetraacyldisaccharide 4'-kinase | PI1375 | protease IV family, clan S (peptidase family S49) | ->-> | 1295981 | 1296102 | 122 | 37.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 597 | PI1375 | protease IV family, clan S (peptidase family S49) | PI1376 | outer membrane protein | ->-> | 1297675 | 1298104 | 430 | 30.5% | 0 | 0 | 0 | +: 0/0/0 | -: 1/4/1 | 1 | 0 | 0 | 0 | Result | |
| 598 | PI1378 | GTP-binding protein lepA | PI1379 | hypothetical protein | ->-> | 1301712 | 1301956 | 245 | 34.7% | 0 | 1 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 599 | PI1379 | hypothetical protein | PI1380 | conserved hypothetical protein | ->-> | 1302353 | 1302726 | 374 | 34.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 51 | 0 | 0 | 0 | Result | |
| 600 | PI1383 | biopolymer transport protein tolQ related | PI1384 | conserved hypothetical protein | ->-> | 1305101 | 1305310 | 210 | 32.4% | 0 | 0 | 0 | +: 1/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 601 | PI1384 | conserved hypothetical protein | PI1385 | 3-deoxy-d-manno-octulosonic acid 8-phosphate synthase (DAHP synthase, Class I) | ->-> | 1306235 | 1306363 | 129 | 27.9% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 602 | PI1389 | transcriptional regulator, LuxR family | PI1390 | hypothetical protein | ->-> | 1310893 | 1311293 | 401 | 35.4% | 0 | 0 | 3 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 603 | PI1390 | hypothetical protein | PI1391 | hypothetical protein | ->-> | 1311390 | 1311559 | 170 | 30% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 604 | PI1391 | hypothetical protein | PI1392 | hypothetical protein | ->-> | 1311755 | 1312040 | 286 | 36.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 44 | 0 | 0 | 0 | Result | |
| 605 | PI1392 | hypothetical protein | PI1393 | aldose 1-epimerase | ->-> | 1312809 | 1312929 | 121 | 28.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 606 | PI1393 | aldose 1-epimerase | PI1394 | glutamate formiminotransferase | ->-> | 1313884 | 1314191 | 308 | 27.3% | 0 | 0 | 0 | +: 2/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 608 | PI1399 | hypothetical protein | PI1400 | hypothetical protein | ->-> | 1320905 | 1321530 | 626 | 33.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/7/0 | 1 | 0 | 0 | 0 | Result | |
| 609 | PI1400 | hypothetical protein | PI1401 | TPR-repeat-containing protein | ->-> | 1321969 | 1322166 | 198 | 28.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 610 | PI1401 | TPR-repeat-containing protein | PI1402 | 3-deoxy-7-phosphoheptulonate synthase | ->-> | 1322944 | 1323074 | 131 | 35.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 611 | PI1404 | hypothetical protein | PI1405 | conserved hypothetical protein | ->-> | 1326060 | 1326174 | 115 | 30.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 612 | PI1408 | glucose-1-phosphate thymidylyltransferase | PI1409 | conserved hypothetical protein | ->-> | 1329822 | 1330988 | 1167 | 32.3% | 0 | 4 | 0 | +: 0/2/0 | -: 1/2/0 | 39 | 0 | 0 | 0 | Result | |
| 613 | PI1417 | MATE efflux family protein (Na+-driven multidrug efflux pump) | PI1418 | UDP-N-acetylglucosamine 2-epimerase | ->-> | 1337562 | 1338124 | 563 | 30.4% | 0 | 0 | 0 | +: 0/3/0 | -: 2/1/0 | 1 | 0 | 0 | 0 | Result | |
| 614 | PI1420 | probable membrane protein | PI1422 | hypothetical protein | ->-> | 1340713 | 1340829 | 117 | 31.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 615 | PI1423 | hypothetical protein | PI1424 | probable peptidase family M48 | ->-> | 1343072 | 1343288 | 217 | 26.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 616 | PI1424 | probable peptidase family M48 | PI1425 | conserved hypothetical protein | ->-> | 1344105 | 1344627 | 523 | 33.8% | 0 | 0 | 0 | +: 0/1/0 | -: 1/5/0 | 53 | 0 | 0 | 0 | Result | |
| 617 | PI1425 | conserved hypothetical protein | PI1426 | flavodoxin | ->-> | 1344910 | 1345020 | 111 | 31.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 618 | PI1426 | flavodoxin | PI1427 | nicotinate-nucleotide pyrophosphorylase | ->-> | 1345507 | 1345847 | 341 | 31.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 619 | PI1429 | L-aspartate oxidase | PI1430 | subtilisin-like serine proteinase | ->-> | 1349386 | 1349737 | 352 | 33.2% | 0 | 0 | 0 | +: 0/3/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 620 | PI1430 | subtilisin-like serine proteinase | PI1431 | conserved hypothetical protein | ->-> | 1351835 | 1352218 | 384 | 35.2% | 0 | 0 | 1 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 621 | PI1431 | conserved hypothetical protein | PI1432 | DNA methylase | ->-> | 1352870 | 1353150 | 281 | 32.7% | 0 | 0 | 0 | +: 0/3/0 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
| 622 | PI1435 | D12 class N6 adenine-specific DNA methyltransferase | PI1436 | hypothetical protein | ->-> | 1355674 | 1356100 | 427 | 26.2% | 0 | 0 | 0 | +: 0/0/0 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
| 623 | PI1439 | hypothetical protein | PI1441 | hypothetical protein | ->-> | 1360407 | 1363268 | 2862 | 42.4% | 0 | 0 | 44 | +: 1/2/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 624 | PI1441 | hypothetical protein | PI1442 | radical-activating enzyme (pyruvate-formate lyase-activating enzyme) | ->-> | 1363734 | 1364088 | 355 | 37.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 32 | 0 | 0 | 0 | Result | |
| 625 | PI1443 | conserved hypotehtical protein; possible tonB-dependent outer membrane receptor | PI1444 | protease ClpB | ->-> | 1365405 | 1365611 | 207 | 33.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 626 | PI1444 | protease ClpB | PI1445 | hypothetical protein | ->-> | 1368198 | 1368542 | 345 | 33.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 627 | PI1446 | conserved hypothetical protein | PI1447 | probable OPT oligopeptide transporter protein | ->-> | 1369893 | 1370111 | 219 | 31.5% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 628 | PI1448 | hypothetical protein | PI1449 | conserved hypothetical protein | ->-> | 1371893 | 1372157 | 265 | 39.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 629 | PI1449 | conserved hypothetical protein | PI1450 | hypothetical protein | ->-> | 1372575 | 1372822 | 248 | 33.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 630 | PI1450 | hypothetical protein | PI1451 | outer membrane receptor proteins, tonB dependent (possibly iron transport related) | ->-> | 1372952 | 1373070 | 119 | 36.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 631 | PI1454 | chromosomal replication initiator protein, DnaA | PI1455 | hypothetical protein | ->-> | 1378202 | 1378402 | 201 | 28.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 632 | PI1461 | conserved hypothetical protein | PI1462 | hypothetical protein | ->-> | 1385134 | 1385233 | 100 | 28% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 633 | PI1463 | fumarate hydratase, class I | PI1464 | zinc protease | ->-> | 1387130 | 1387280 | 151 | 31.1% | 0 | 0 | 0 | +: 0/1/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
| 634 | PI1466 | GTP-binding protein, possible GTP1/OBG family | PI1467 | conserved hypothetical protein | ->-> | 1393194 | 1393642 | 449 | 36.5% | 0 | 0 | 18 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 635 | PI1472 | hypothetical protein | PI1474 | conserved hypothetical protein | ->-> | 1395940 | 1396066 | 127 | 27.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 636 | PI1474 | conserved hypothetical protein | PI1475 | possible short chain dehydrogenase | ->-> | 1397030 | 1397281 | 252 | 42.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 637 | PI1476 | acyl-CoA synthase/O-succinylbenzoic acid-CoA ligase | PI1477 | TonB-dependent outer membrane receptor | ->-> | 1399465 | 1399873 | 409 | 30.3% | 0 | 0 | 0 | +: 0/4/0 | -: 0/6/0 | 3 | 0 | 0 | 0 | Result | |
| 638 | PI1485 | hypothetical protein | PI1486 | alginate O-acetylation protein | ->-> | 1405400 | 1405646 | 247 | 38.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 55 | 0 | 0 | 0 | Result | |
| 639 | PI1490 | GTP cyclohydrolase I | PI1491 | conserved hypothetical protein | ->-> | 1409188 | 1409549 | 362 | 38.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 640 | PI1493 | conserved hypothetical protein | PI1494 | conserved hypothetical protein | ->-> | 1412879 | 1413185 | 307 | 32.2% | 0 | 0 | 0 | +: 2/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 641 | PI1494 | conserved hypothetical protein | PI1495 | conserved hypothetical protein | ->-> | 1414029 | 1414571 | 543 | 39.4% | 0 | 0 | 0 | +: 0/3/0 | -: 0/1/0 | 49 | 0 | 0 | 0 | Result | |
| 642 | PI1495 | conserved hypothetical protein | PI1496 | nucleoside phosphorylase | ->-> | 1417083 | 1417255 | 173 | 37.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 643 | PI1497 | LuxS protein, autoinducer AI-2 production protein | PI1498 | probable membrane associated lipoprotein | ->-> | 1418380 | 1418566 | 187 | 32.1% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 644 | PI1499 | hypothetical protein | PI1500 | hypothetical protein | ->-> | 1420241 | 1420765 | 525 | 35.6% | 0 | 0 | 0 | +: 0/3/0 | -: 0/2/0 | 46 | 0 | 0 | 0 | Result | |
| 645 | PI1500 | hypothetical protein | PI1501 | GTP-binding elongation factor family protein TypA/BipA | ->-> | 1421453 | 1421563 | 111 | 28.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 646 | PI1501 | GTP-binding elongation factor family protein TypA/BipA | PI1502 | hypothetical protein | ->-> | 1423307 | 1423406 | 100 | 39% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 647 | PI1503 | 30S ribosomal protein S15 | PI1504 | non-specific DNA-binding protein | ->-> | 1423841 | 1424457 | 617 | 33.7% | 0 | 0 | 0 | +: 0/1/0 | -: 1/2/1 | 58 | 0 | 0 | 0 | Result | |
| 648 | PI1510 | cell division protein | PI1512 | hypothetical protein | ->-> | 1429335 | 1429668 | 334 | 37.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 649 | PI1511 | hypothetical protein | PI1513 | conserved hypothetical protein | ->-> | 1430059 | 1430291 | 233 | 27.9% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 650 | PI1513 | conserved hypothetical protein | PI1514 | tRNA nucleotidyltransferase/poly(A) polymerase | ->-> | 1432563 | 1432683 | 121 | 30.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 651 | PI1514 | tRNA nucleotidyltransferase/poly(A) polymerase | PI1515 | hypothetical protein | ->-> | 1434133 | 1434240 | 108 | 35.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 652 | PI1515 | hypothetical protein | PI1516 | multidrug resistance protein; HlyD family secretion protein | ->-> | 1434385 | 1434520 | 136 | 38.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 654 | PI1521 | hypothetical protein | PI1522 | thioredoxin M | ->-> | 1441522 | 1441785 | 264 | 36% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 5 | 0 | 0 | 0 | Result | |
| 655 | PI1523 | DNA polymerase III, alpha subunit | PI1524 | phosphatidylserine decarboxylase | ->-> | 1445951 | 1446063 | 113 | 24.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 657 | PI1526 | hypothetical protein | PI1527 | immunoreactive 46 kDa antigen PG99 | ->-> | 1447756 | 1448329 | 574 | 32.2% | 0 | 0 | 0 | +: 0/3/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 658 | PI1527 | immunoreactive 46 kDa antigen PG99 | PI1528 | hypothetical protein | ->-> | 1449581 | 1449824 | 244 | 39.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 659 | PI1529 | cytosine/adenosine deaminase | PI1530 | conserved hypothetical protein | ->-> | 1450438 | 1450578 | 141 | 29.8% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 664 | PI1543 | hypothetical protein | PI1544 | hypothetical protein | ->-> | 1463342 | 1463646 | 305 | 39.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 2 | 1 | 1 | 281 | Result | ataagtttccttgaaagtttatcattgtagatgattcattgtttcttaattcctgaatactgaccgatgagaacggagtgattacggtcttatctccccgacaatcgaacgaggggagcaagagcagtttgtgggtacaaactgacgtcttgcaatgctaccgaacaaattatttacgcttaaaacgttttatagcctaaaaatgaattccgtgcattctatgactaactgcgttcgtggcattctcacagagaactaagccgaagaagaaaaggtagacc |
| 665 | PI1546 | mobilizable transposon, excision protein | PI1548 | conserved hypothetical protein | ->-> | 1465160 | 1465440 | 281 | 28.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 3 | 0 | 0 | 0 | Result | |
| 666 | PI1547 | hypothetical protein | PI1549 | conserved hypothetical protein | ->-> | 1466287 | 1467160 | 874 | 42.1% | 0 | 0 | 1 | +: 1/2/2 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 667 | PI1550 | conserved hypothetical protein | PI1551 | HesA/MoeB/ThiF family protein | ->-> | 1467764 | 1467926 | 163 | 27% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 669 | PI1553 | hypothetical protein | PI1554 | hypothetical protein | ->-> | 1470231 | 1470414 | 184 | 27.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 670 | PI1554 | hypothetical protein | PI1555 | conserved hypothetical protein | ->-> | 1470544 | 1470716 | 173 | 28.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 671 | PI1558 | conserved hypothetical protein | PI1559 | hypothetical protein | ->-> | 1476167 | 1476645 | 479 | 34% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 672 | PI1560 | integrase | PI1561 | conserved hypothetical protein; possible lipoprotein | ->-> | 1478326 | 1478856 | 531 | 36% | 0 | 0 | 0 | +: 1/1/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
| 673 | PI1562 | methyltransferase | PI1563 | thiol:disulfide interchange protein dsbD | ->-> | 1480510 | 1480820 | 311 | 29.9% | 0 | 0 | 0 | +: 1/0/0 | -: 1/1/1 | 1 | 0 | 0 | 0 | Result | |
| 674 | PI1563 | thiol:disulfide interchange protein dsbD | PI1564 | surface antigen BspA | ->-> | 1482876 | 1483594 | 719 | 30.7% | 0 | 0 | 0 | +: 1/5/0 | -: 1/4/4 | 60 | 0 | 0 | 0 | Result | |
| 675 | PI1565 | conserved hypothetical protein; possible surface antigen | PI1566 | predicted TPR-repeat-containing protein | ->-> | 1487418 | 1487709 | 292 | 26% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
| 676 | PI1567 | hypothetical protein | PI1568 | OmpA family protein | ->-> | 1489582 | 1489723 | 142 | 35.2% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 677 | PI1568 | OmpA family protein | PI1569 | hypothetical protein | ->-> | 1491104 | 1492571 | 1468 | 34.1% | 0 | 0 | 0 | +: 1/1/0 | -: 4/2/6 | 1 | 0 | 0 | 0 | Result | |
| 678 | PI1571 | surface antigen BspA | PI1573 | transcription-repair coupling factor | ->-> | 1495841 | 1496568 | 728 | 32.4% | 0 | 0 | 0 | +: 0/1/0 | -: 2/3/3 | 3 | 0 | 0 | 0 | Result | |
| 679 | PI1572 | hypothetical protein | PI1574 | conserved hypothetical protein | ->-> | 1498276 | 1500464 | 2189 | 44.4% | 0 | 1 | 17 | +: 0/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 680 | PI1575 | LemA protein | PI1576 | serine protease precursor | ->-> | 1501913 | 1502311 | 399 | 30.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 681 | PI1577 | conserved hypothetical protein | PI1578 | rod shape-determining protein | ->-> | 1503940 | 1504327 | 388 | 35.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 40 | 0 | 0 | 0 | Result | |
| 682 | PI1582 | cell shape-determining protein | PI1583 | phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR)/IMP cyclohydrolase (ATIC) | ->-> | 1510518 | 1510669 | 152 | 30.9% | 0 | 0 | 0 | +: 0/1/0 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
| 683 | PI1583 | phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR)/IMP cyclohydrolase (ATIC) | PI1584 | A/G-specific adenine glycosylase | ->-> | 1511261 | 1512037 | 777 | 30.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 59 | 0 | 0 | 0 | Result | |
| 684 | PI1585 | ampG permease | PI1586 | possible HesA/MoeB/ThiF family protein | ->-> | 1514321 | 1514511 | 191 | 34.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 685 | PI1586 | possible HesA/MoeB/ThiF family protein | PI1587 | conserved hypothetical protein; possible permease | ->-> | 1515244 | 1515423 | 180 | 27.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 686 | PI1587 | conserved hypothetical protein; possible permease | PI1588 | DNA polymerase III, epsilon chain | ->-> | 1516327 | 1516441 | 115 | 33% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 687 | PI1588 | DNA polymerase III, epsilon chain | PI1589 | conserved hypothetical protein | ->-> | 1516991 | 1517497 | 507 | 32.3% | 0 | 0 | 0 | +: 0/2/0 | -: 0/3/0 | 38 | 0 | 0 | 0 | Result | |
| 688 | PI1589 | conserved hypothetical protein | PI1590 | transcriptional regulator | ->-> | 1517903 | 1518192 | 290 | 27.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 691 | PI1593 | 3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II | PI1594 | MotA/TolQ/ExbB proton channel | ->-> | 1523186 | 1523667 | 482 | 25.3% | 0 | 0 | 0 | +: 0/2/0 | -: 0/4/0 | 1 | 0 | 0 | 0 | Result | |
| 692 | PI1598 | phosphate ABC transporter, phosphate-binding component | PI1599 | predicted TPR-repeat-containing protein | ->-> | 1527743 | 1527856 | 114 | 21.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 693 | PI1599 | predicted TPR-repeat-containing protein | PI1600 | conserved hypothetical protein | ->-> | 1529237 | 1529408 | 172 | 33.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 694 | PI1601 | hypothetical protein | PI1602 | conserved hypothetical protein; possible internalin-related protein | ->-> | 1530515 | 1531164 | 650 | 33.4% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
| 695 | PI1604 | hypothetical protein | PI1605 | conserved hypothetical protein | ->-> | 1534256 | 1534383 | 128 | 37.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 696 | PI1610 | Na+/H+ anti-porter | PI1611 | aspartate-semialdehyde dehydrogenase | ->-> | 1538063 | 1538295 | 233 | 38.6% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 697 | PI1612 | hypothetical protein | PI1613 | hypothetical protein | ->-> | 1540006 | 1540117 | 112 | 30.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 698 | PI1614 | hypothetical protein | PI1615 | hypothetical protein | ->-> | 1541469 | 1541601 | 133 | 28.6% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 699 | PI1615 | hypothetical protein | PI1616 | hypothetical protein | ->-> | 1542055 | 1542312 | 258 | 33.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 700 | PI1617 | hypothetical protein | PI1619 | two-component system response regulator | ->-> | 1543225 | 1543349 | 125 | 43.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 701 | PI1620 | two-component system sensor protein | PI1621 | hypothetical protein | ->-> | 1545221 | 1545563 | 343 | 32.7% | 0 | 0 | 0 | +: 1/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 702 | PI1621 | hypothetical protein | PI1622 | hypothetical protein | ->-> | 1545801 | 1546921 | 1121 | 38.5% | 0 | 0 | 1 | +: 0/4/0 | -: 0/3/0 | 2 | 0 | 0 | 0 | Result | |
| 704 | PI1629 | hypothetical protein | PI1630 | hypothetical protein | ->-> | 1552027 | 1552266 | 240 | 43.3% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 705 | PI1634 | conserved hypothetical protein | PI1635 | hypothetical protein | ->-> | 1553880 | 1554087 | 208 | 51.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 706 | PI1637 | hypothetical protein | PI1638 | conserved hypothetical protein | ->-> | 1555345 | 1555476 | 132 | 43.9% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 707 | PI1638 | conserved hypothetical protein | PI1639 | conserved hypothetical protein | ->-> | 1556674 | 1556864 | 191 | 53.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 708 | PI1651 | hypothetical protein | PI1652 | hypothetical protein | ->-> | 1564573 | 1564794 | 222 | 47.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 709 | PI1653 | hypothetical protein | PI1654 | hypothetical protein | ->-> | 1565775 | 1567808 | 2034 | 43.7% | 0 | 1 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 710 | PI1654 | hypothetical protein | PI1655 | hypothetical protein | ->-> | 1568019 | 1569818 | 1800 | 45.6% | 0 | 0 | 0 | +: 0/1/0 | -: 1/3/0 | 1 | 0 | 0 | 0 | Result | |
| 711 | PI1655 | hypothetical protein | PI1656 | hypothetical protein | ->-> | 1570278 | 1570381 | 104 | 37.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 712 | PI1661 | hypothetical protein | PI1662 | hypothetical protein | ->-> | 1576878 | 1577055 | 178 | 39.3% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 2 | 0 | 0 | 0 | Result | |
| 713 | PI1665 | thymidylate synthase | PI1666 | conserved hypothetical protein | ->-> | 1578865 | 1579370 | 506 | 32.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 715 | PI1671 | hypothetical protein | PI1672 | conserved hypothetical protein; possible DNA-binding protein, histone-like family | ->-> | 1586714 | 1587166 | 453 | 45.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 716 | PI1672 | conserved hypothetical protein; possible DNA-binding protein, histone-like family | PI1673 | hypothetical protein | ->-> | 1587590 | 1587857 | 268 | 25% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 717 | PI1675 | TonB-dependent outer membrane receptor | PI1676 | phosphatidate cytidylyltransferase | ->-> | 1590596 | 1591035 | 440 | 28.6% | 0 | 0 | 0 | +: 2/0/0 | -: 3/3/4 | 1 | 0 | 0 | 0 | Result | |
| 718 | PI1677 | cell division protein FtsH | PI1678 | conserved hypothetical protein | ->-> | 1593862 | 1594023 | 162 | 34% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 721 | PI1679 | hypothetical protein | PI1680 | conserved hypothetical protein | ->-> | 1595025 | 1595177 | 153 | 36.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 722 | PI1680 | conserved hypothetical protein | PI1681 | Mg2+/Co2+ transporter | ->-> | 1597053 | 1597265 | 213 | 29.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 723 | PI1681 | Mg2+/Co2+ transporter | PI1682 | aminoacyl-histidine dipeptidase | ->-> | 1598190 | 1598442 | 253 | 31.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 725 | PI1685 | GAF domain-containing protein | PI1687 | ribosome recycling factor | ->-> | 1602326 | 1602446 | 121 | 30.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 726 | PI1688 | possible GTPase | PI1689 | conserved hypothetical protein | ->-> | 1603964 | 1604449 | 486 | 34.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 43 | 0 | 0 | 0 | Result | |
| 727 | PI1693 | possible RmuC domain protein | PI1694 | hypothetical protein | ->-> | 1609619 | 1609856 | 238 | 33.6% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 729 | PI1695 | hypothetical protein | PI1696 | conserved hypothetical protein | ->-> | 1610371 | 1610683 | 313 | 21.4% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 730 | PI1700 | hypothetical protein | PI1701 | sensor histidine kinase | ->-> | 1619304 | 1619451 | 148 | 38.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 731 | PI1701 | sensor histidine kinase | PI1702 | hypothetical protein | ->-> | 1620619 | 1620726 | 108 | 31.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 732 | PI1704 | 50S ribosomal protein L32 | PI1705 | 3-oxoacyl-(acyl-carrier-protein) synthase III | ->-> | 1621741 | 1621920 | 180 | 48.3% | 0 | 1 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 733 | PI1705 | 3-oxoacyl-(acyl-carrier-protein) synthase III | PI1706 | GTP-binding protein | ->-> | 1622767 | 1622909 | 143 | 35% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 734 | PI1706 | GTP-binding protein | PI1707 | GTP-binding protein | ->-> | 1623729 | 1623934 | 206 | 50% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 735 | PI1708 | hypothetical protein | PI1709 | ABC transporter, ATP-binding protein | ->-> | 1625623 | 1625982 | 360 | 35% | 0 | 0 | 0 | +: 0/1/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 736 | PI1710 | ABC-type permease component | PI1712 | hypothetical protein | ->-> | 1627417 | 1627636 | 220 | 32.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 739 | PI1715 | conserved hypothetical protein; possible DNA-binding protein, histone-like family | PI1717 | major outer membrane protein | ->-> | 1632385 | 1632805 | 421 | 35.4% | 0 | 0 | 0 | +: 1/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 740 | PI1717 | major outer membrane protein | PI1718 | DNA mismatch repair protein | ->-> | 1633949 | 1634136 | 188 | 18.6% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 741 | PI1720 | conserved hypothetical protein | PI1721 | peptidyl-prolyl cis-trans isomerase, PPIC-type | ->-> | 1638053 | 1638225 | 173 | 42.2% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 742 | PI1722 | possible peptidyl-prolyl cis-trans isomerase | PI1724 | inosine-5'-monophosphate dehydrogenase | ->-> | 1641056 | 1641214 | 159 | 34% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 743 | PI1723 | conserved hypothetical protein | PI1725 | hypothetical protein | ->-> | 1642194 | 1643163 | 970 | 38.4% | 0 | 1 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 744 | PI1725 | hypothetical protein | PI1726 | ATP-dependent DNA helicase | ->-> | 1643281 | 1643541 | 261 | 39.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 746 | PI1728 | ATP-dependent Clp protease, proteolytic subunit | PI1729 | FKBP-type peptidyl-prolyl cis-trans isomerase, trigger factor | ->-> | 1647719 | 1648555 | 837 | 35.1% | 0 | 0 | 0 | +: 1/5/4 | -: 4/3/7 | 33 | 0 | 0 | 0 | Result | |
| 747 | PI1729 | FKBP-type peptidyl-prolyl cis-trans isomerase, trigger factor | PI1730 | hypothetical protein | ->-> | 1649996 | 1650253 | 258 | 36% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 748 | PI1732 | hypothetical protein | PI1733 | hypothetical protein | ->-> | 1652159 | 1652299 | 141 | 34% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 749 | PI1736 | topoisomerase IV, subunit A | PI1737 | glycyl-tRNA synthetase | ->-> | 1657151 | 1657905 | 755 | 31.7% | 0 | 44 | 0 | +: 0/1/0 | -: 0/4/0 | 2 | 0 | 0 | 0 | Result | |
| 750 | PI1738 | FKBP-type peptidyl-prolyl cis-trans isomerase | PI1739 | Na+-driven multidrug efflux pump, MATE efflux family protein | ->-> | 1660173 | 1660316 | 144 | 45.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 751 | PI1740 | DedA family protein | PI1741 | lipid-A-disaccharide synthase | ->-> | 1662377 | 1662893 | 517 | 35.2% | 0 | 0 | 0 | +: 0/1/0 | -: 1/3/1 | 3 | 0 | 0 | 0 | Result | |
| 753 | PI1748 | guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase/possible (p)ppgpp synthetase II | PI1749 | conserved hypothetical protein | ->-> | 1670983 | 1671178 | 196 | 44.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 754 | PI1749 | conserved hypothetical protein | PI1750 | sulfate transporter | ->-> | 1671698 | 1672273 | 576 | 32.8% | 0 | 0 | 0 | +: 0/5/0 | -: 1/2/1 | 2 | 0 | 0 | 0 | Result | |
| 760 | PI1755 | RNA polymerase sigma-70 factor, ECF subfamily | PI1756 | conserved hypothetical protein | ->-> | 1682571 | 1682766 | 196 | 23% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 761 | PI1756 | conserved hypothetical protein | PI1758 | hypothetical protein | ->-> | 1683211 | 1683346 | 136 | 33.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 763 | PI1763 | two-component system sensor histidine kinase/response regulator | PI1764 | conserved hypothetical protein | ->-> | 1688663 | 1689087 | 425 | 30.8% | 0 | 0 | 0 | +: 2/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 764 | PI1764 | conserved hypothetical protein | PI1765 | fructanase, glycoside hydrolase family | ->-> | 1691314 | 1691420 | 107 | 34.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 765 | PI1767 | fructokinase, pfkB family | PI1768 | conserved hypothetical protein | ->-> | 1695304 | 1695595 | 292 | 42.5% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 766 | PI1769 | hypothetical protein | PI1770 | 4-alpha-glucanotransferase | ->-> | 1696998 | 1697475 | 478 | 35.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 767 | PI1772 | pullulanase | PI1773 | alpha-amylase (neopullulanase) | ->-> | 1704308 | 1704421 | 114 | 34.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 768 | PI1773 | alpha-amylase (neopullulanase) | PI1774 | hypothetical protein | ->-> | 1706168 | 1706323 | 156 | 34.6% | 0 | 0 | 0 | +: 0/3/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 769 | PI1774 | hypothetical protein | PI1775 | hypothetical protein | ->-> | 1707092 | 1707394 | 303 | 26.1% | 0 | 0 | 0 | +: 0/3/0 | -: 1/1/1 | 1 | 0 | 0 | 0 | Result | |
| 770 | PI1775 | hypothetical protein | PI1776 | probable peptidase of the M22 family (inactive? chaperone?)) | ->-> | 1708181 | 1708762 | 582 | 30.2% | 0 | 0 | 0 | +: 1/4/1 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 771 | PI1783 | possible 4-diphosphocytidyl-2c-methyl-D-erythritol synthase | PI1784 | possible dTDP-glucose 4,6-dehydratase, NAD-dependent epimerase/dehydratase family | ->-> | 1716219 | 1716340 | 122 | 52.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 772 | PI1786 | hypothetical protein | PI1787 | conserved hypothetical protein | ->-> | 1718441 | 1718553 | 113 | 46% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 773 | PI1789 | hypothetical protein | PI1790 | hypothetical protein | ->-> | 1719098 | 1722318 | 3221 | 43.8% | 0 | 0 | 4 | +: 0/2/0 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
| 774 | PI1790 | hypothetical protein | PI1792 | hypothetical protein | ->-> | 1722823 | 1724780 | 1958 | 39.5% | 0 | 0 | 0 | +: 2/2/2 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 775 | PI1794 | conserved hypothetical protein | PI1795 | conserved hypothetical protein | ->-> | 1726757 | 1727003 | 247 | 41.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 776 | PI1796 | 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase, fumarylacetoacetate hydrolase family protein | PI1797 | hypothetical protein | ->-> | 1731147 | 1731286 | 140 | 33.6% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 777 | PI1797 | hypothetical protein | PI1798 | elongation factor Ts | ->-> | 1731620 | 1731927 | 308 | 30.2% | 0 | 0 | 0 | +: 0/2/0 | -: 1/1/1 | 1 | 0 | 0 | 0 | Result | |
| 778 | PI1798 | elongation factor Ts | PI1799 | 30S ribosomal protein S2 | ->-> | 1732885 | 1733039 | 155 | 34.2% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 779 | PI1800 | hypothetical protein | PI1801 | 30S ribosomal protein S9 | ->-> | 1733962 | 1734088 | 127 | 41.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 780 | PI1802 | 50S ribosomal protein L13 | PI1803 | conserved hypothetical protein | ->-> | 1735018 | 1735220 | 203 | 36% | 0 | 0 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 781 | PI1803 | conserved hypothetical protein | PI1804 | hypothetical protein | ->-> | 1737852 | 1738248 | 397 | 37.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 29 | 0 | 0 | 0 | Result | |
| 782 | PI1804 | hypothetical protein | PI1805 | TPR repeat containing protein | ->-> | 1738351 | 1738508 | 158 | 31% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 783 | PI1805 | TPR repeat containing protein | PI1806 | integral membrane transport protein; possible sugar transport proteins | ->-> | 1740594 | 1740916 | 323 | 36.8% | 0 | 0 | 0 | +: 1/5/0 | -: 2/1/1 | 1 | 0 | 0 | 0 | Result | |
| 784 | PI1808 | LacI family transcriptional regulator | PI1809 | outer membrane protein | ->-> | 1743411 | 1746743 | 3333 | 43.1% | 0 | 0 | 250 | +: 2/2/1 | -: 2/1/2 | 1 | 0 | 0 | 0 | Result | |
| 785 | PI1811 | conserved hypothetical protein | PI1812 | possible alpha-amylase | ->-> | 1750690 | 1750898 | 209 | 32.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 786 | PI1812 | possible alpha-amylase | PI1813 | hypothetical protein | ->-> | 1752915 | 1753017 | 103 | 42.7% | 0 | 0 | 0 | +: 0/3/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 787 | PI1814 | hypothetical protein | PI1815 | polyphosphate-selective porin O | ->-> | 1753294 | 1753523 | 230 | 28.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 788 | PI1815 | polyphosphate-selective porin O | PI1816 | acid phosphatase | ->-> | 1754571 | 1754785 | 215 | 38.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 790 | PI1818 | hypothetical protein | PI1820 | hypothetical protein | ->-> | 1757331 | 1760101 | 2771 | 45.7% | 0 | 0 | 0 | +: 1/2/2 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 791 | PI1820 | hypothetical protein | PI1821 | possible thioredoxin family protein | ->-> | 1760438 | 1760653 | 216 | 40.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 792 | PI1823 | inorganic polyphosphate/ATP-NAD kinase (Poly(P)/ATP NAD kinase) | PI1824 | ThiJ/PfpI family protein | ->-> | 1764263 | 1764618 | 356 | 33.4% | 0 | 0 | 2 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 793 | PI1826 | ATP-dependent DNA helicase | PI1827 | peptidase, M23/M37 family, N-terminal | ->-> | 1767884 | 1768152 | 269 | 31.6% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 794 | PI1828 | peptidase, M23/M37 family, C-terminal | PI1829 | hypothetical protein | ->-> | 1769150 | 1769394 | 245 | 33.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 795 | PI1833 | bacterioferritin comigratory protein | PI1834 | anaerobic C4-dicarboxylate membrane transporter | ->-> | 1774556 | 1775000 | 445 | 27% | 0 | 0 | 0 | +: 2/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 796 | PI1835 | L-asparaginase I | PI1836 | conserved hypothetical protein | ->-> | 1777337 | 1777447 | 111 | 36.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 797 | PI1836 | conserved hypothetical protein | PI1837 | aspartate ammonia-lyase | ->-> | 1778642 | 1779092 | 451 | 33.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 798 | PI1837 | aspartate ammonia-lyase | PI1838 | conserved hypothetical protein | ->-> | 1780467 | 1780912 | 446 | 30.3% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
| 799 | PI1838 | conserved hypothetical protein | PI1839 | hypothetical protein | ->-> | 1782089 | 1782317 | 229 | 36.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
| 800 | PI1839 | hypothetical protein | PI1840 | conserved hypothetical protein | ->-> | 1782561 | 1782995 | 435 | 30.8% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 801 | PI1842 | conserved hypothetical protein | PI1843 | hypothetical protein | ->-> | 1788378 | 1788563 | 186 | 28% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 802 | PI1843 | hypothetical protein | PI1844 | hypothetical protein | ->-> | 1788672 | 1790231 | 1560 | 33.3% | 0 | 0 | 0 | +: 0/0/0 | -: 2/0/0 | 3 | 0 | 0 | 0 | Result | |
| 803 | PI1844 | hypothetical protein | PI1845 | hypothetical protein | ->-> | 1790340 | 1791596 | 1257 | 32.9% | 0 | 0 | 0 | +: 0/0/0 | -: 3/0/0 | 3 | 0 | 0 | 0 | Result | |
| 804 | PI1846 | hypothetical protein | PI1847 | conserved hypothetical protein; possible integral membrane protein | ->-> | 1792004 | 1792145 | 142 | 33.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 805 | PI1851 | conserved hypothetical protein | PI1852 | conserved hypothetical protein | ->-> | 1797947 | 1798091 | 145 | 26.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 807 | PI1855 | lipopolysaccharide biosynthesis protein | PI1856 | nicotinate-nucleotide adenylyltransferase | ->-> | 1803229 | 1803342 | 114 | 40.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 808 | PI1858 | conserved hypothetical protein | PI1859 | conserved hypothetical protein | ->-> | 1805416 | 1805533 | 118 | 31.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 809 | PI1859 | conserved hypothetical protein | PI1861 | hypothetical protein | ->-> | 1805888 | 1806066 | 179 | 33% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 810 | PI1862 | hypothetical protein | PI1863 | phosphoribosylformylglycinamidine synthase | ->-> | 1806452 | 1806813 | 362 | 34.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 811 | PI1865 | chromate transport protein | PI1866 | hypothetical protein | ->-> | 1811648 | 1811832 | 185 | 33% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 812 | PI1866 | hypothetical protein | PI1867 | helicase related protein | ->-> | 1811971 | 1812529 | 559 | 31.5% | 0 | 0 | 0 | +: 2/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 813 | PI1868 | hypothetical protein | PI1869 | hypothetical protein | ->-> | 1814976 | 1815270 | 295 | 33.2% | 0 | 0 | 0 | +: 0/1/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
| 814 | PI1870 | hypothetical protein | PI1871 | glycosyl transferase, group 1 family protein | ->-> | 1815574 | 1815927 | 354 | 29.7% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 815 | PI1878 | hypothetical protein | PI1879 | uracil phosphoribosyltransferase | ->-> | 1820222 | 1820810 | 589 | 37% | 0 | 0 | 0 | +: 0/1/0 | -: 1/4/4 | 54 | 0 | 0 | 0 | Result | |
| 816 | PI1879 | uracil phosphoribosyltransferase | PI1880 | phosphoenolpyruvate carboxykinase (ATP) | ->-> | 1821306 | 1821806 | 501 | 32.1% | 0 | 0 | 10 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 819 | PI1884 | conserved hypothetical protein | PI1886 | cell division protein | ->-> | 1827518 | 1827772 | 255 | 44.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 820 | PI1889 | UDP-N-acetylglucosamine--N-acetylmuramyl-(pentape ptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase | PI1890 | cell division protein FtsW | ->-> | 1832652 | 1833025 | 374 | 31.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 822 | PI1896 | hypothetical protein | PI1898 | S-adenosyl-methyltransferase | ->-> | 1841249 | 1841427 | 179 | 44.1% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 823 | PI1899 | conserved hypothetical protein | PI1900 | conserved hypothetical protein | ->-> | 1842842 | 1843238 | 397 | 31.2% | 0 | 0 | 0 | +: 1/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 824 | PI1903 | hypothetical protein | PI1905 | hypothetical protein | ->-> | 1845630 | 1847767 | 2138 | 46.3% | 0 | 0 | 165 | +: 1/3/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 825 | PI1905 | hypothetical protein | PI1906 | zinc protease, immunoreactive 106 kDa antigen PG115 | ->-> | 1847915 | 1848147 | 233 | 26.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 828 | PI1909 | DNA gyrase, B subunit | PI1910 | hypothetical protein | ->-> | 1855331 | 1855917 | 587 | 34.1% | 0 | 0 | 0 | +: 0/2/0 | -: 0/4/0 | 46 | 0 | 0 | 0 | Result | |
| 830 | PI1915 | conserved hypothetical protein | PI1916 | conserved hypothetical protein | ->-> | 1859967 | 1860350 | 384 | 35.7% | 0 | 0 | 0 | +: 1/2/2 | -: 0/2/0 | 32 | 0 | 0 | 0 | Result | |
| 832 | PI1918 | uracil-DNA glycosylase | PI1919 | 2,3-bisphosphoglycerate-independent phosphoglycerate mutase | ->-> | 1862285 | 1862438 | 154 | 38.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 833 | PI1919 | 2,3-bisphosphoglycerate-independent phosphoglycerate mutase | PI1921 | conserved hypothetical protein | ->-> | 1863936 | 1864056 | 121 | 24.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 834 | PI1922 | hypothetical protein | PI1923 | conserved hypothetical protein | ->-> | 1865515 | 1865699 | 185 | 34.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 835 | PI1925 | conserved hypothetical protein | PI1926 | conserved hypothetical protein | ->-> | 1867994 | 1868253 | 260 | 28.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 836 | PI1926 | conserved hypothetical protein | PI1927 | hypothetical protein | ->-> | 1871038 | 1871326 | 289 | 24.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 837 | PI1929 | conserved hypothetical protein; possible ankyrin repeat protein (eukaryotic-like) | PI1930 | conserved hypothetical protein; possible ankyrin repeat protein (eukaryotic-like) | ->-> | 1874235 | 1874358 | 124 | 33.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 838 | PI1930 | conserved hypothetical protein; possible ankyrin repeat protein (eukaryotic-like) | PI1931 | alpha glycan phosphorylase, maltodextrin phosphorylase | ->-> | 1875115 | 1875595 | 481 | 38% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 53 | 0 | 0 | 0 | Result | |
| 839 | PI1932 | glycogen synthase | PI1933 | hypothetical protein | ->-> | 1879867 | 1880064 | 198 | 28.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 840 | PI1933 | hypothetical protein | PI1934 | hypothetical protein | ->-> | 1880524 | 1882502 | 1979 | 44.6% | 0 | 1 | 22 | +: 0/1/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 841 | PI1934 | hypothetical protein | PI1935 | possible internalin-related protein | ->-> | 1882662 | 1883463 | 802 | 28.6% | 0 | 0 | 0 | +: 1/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 842 | PI1937 | hypothetical protein | PI1938 | hypothetical protein | ->-> | 1891147 | 1891993 | 847 | 31.5% | 0 | 0 | 0 | +: 3/4/4 | -: 1/4/4 | 29 | 0 | 0 | 0 | Result | |
| 843 | PI1938 | hypothetical protein | PI1940 | conserved hypothetical protein; possible outer membrane protein | ->-> | 1895699 | 1895869 | 171 | 25.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 844 | PI1939 | hypothetical protein | PI1941 | outer membrane receptor; ragA protein | ->-> | 1896727 | 1897508 | 782 | 38.9% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 845 | PI1941 | outer membrane receptor; ragA protein | PI1942 | hypothetical protein | ->-> | 1900680 | 1901080 | 401 | 30.7% | 0 | 0 | 0 | +: 1/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 846 | PI1946 | hypothetical protein | PI1948 | hypothetical protein | ->-> | 1903081 | 1903223 | 143 | 33.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
| 847 | PI1952 | hypothetical protein | PI1953 | possible ABC-type permease | ->-> | 1907100 | 1907274 | 175 | 38.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 848 | PI1953 | possible ABC-type permease | PI1954 | translation initiation factor IF-2 | ->-> | 1908643 | 1908923 | 281 | 35.9% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 849 | PI1954 | translation initiation factor IF-2 | PI1955 | N utilization substance protein A | ->-> | 1911708 | 1911921 | 214 | 38.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 850 | PI1956 | conserved hypothetical protein | PI1957 | calcium-transporting ATPase | ->-> | 1913687 | 1913898 | 212 | 33.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 851 | PI1958 | hypothetical protein | PI1959 | hypothetical protein | ->-> | 1917430 | 1917847 | 418 | 34.2% | 0 | 0 | 0 | +: 1/4/3 | -: 0/4/0 | 38 | 0 | 0 | 0 | Result | |
| 852 | PI1959 | hypothetical protein | PI1960 | hypothetical protein | ->-> | 1918031 | 1918152 | 122 | 35.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 853 | PI1962 | conserved hypothetical protein | PI1963 | hypothetical protein | ->-> | 1920767 | 1921348 | 582 | 37.5% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 854 | PI1966 | conserved hypothetical protein | PI1967 | hypothetical protein | ->-> | 1924152 | 1924375 | 224 | 37.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 858 | PI1973 | conserved hypothetical protein | PI1974 | hypothetical protein | ->-> | 1931232 | 1931332 | 101 | 43.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 859 | PI1975 | conserved hypothetical protein | PI1976 | hypothetical protein | ->-> | 1932994 | 1933132 | 139 | 32.4% | 0 | 0 | 0 | +: 1/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 860 | PI1979 | conserved hypothetical protein | PI1980 | conserved hypothetical protein | ->-> | 1937388 | 1937609 | 222 | 48.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 861 | PI1981 | hypothetical protein | PI1982 | conserved hypothetical protein | ->-> | 1938199 | 1938578 | 380 | 32.1% | 0 | 0 | 0 | +: 1/2/1 | -: 0/2/0 | 39 | 0 | 0 | 0 | Result | |
| 862 | PI1983 | possible xylanase | PI1984 | MutT/nudix family protein | ->-> | 1940065 | 1940323 | 259 | 29.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 863 | PI1985 | hypothetical protein | PI1986 | hypothetical protein | ->-> | 1940806 | 1941002 | 197 | 33% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 864 | PI1991 | conserved hypothetical protein | PI1992 | hypothetical protein | ->-> | 1946431 | 1946566 | 136 | 40.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 865 | PI1993 | thiol protease/hemagglutinin, PrtT precursor | PI1995 | hypothetical protein | ->-> | 1949053 | 1949363 | 311 | 30.2% | 0 | 0 | 0 | +: 0/2/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
| 866 | PI1994 | hypothetical protein | PI1996 | hypothetical protein | ->-> | 1949905 | 1950453 | 549 | 33.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 874 | PI2000 | conserved hypothetical protein; possible membrane protein | PI2001 | hypothetical protein | ->-> | 1959770 | 1959989 | 220 | 28.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 875 | PI2001 | hypothetical protein | PI2002 | hypothetical protein | ->-> | 1960539 | 1960801 | 263 | 35% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 876 | PI2005 | potassium uptake protein | PI2006 | potassium uptake system protein | ->-> | 1964428 | 1964619 | 192 | 43.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 877 | PI2006 | potassium uptake system protein | PI2008 | ABC transporter, ATP-binding protein | ->-> | 1965907 | 1967262 | 1356 | 44.6% | 0 | 0 | 4 | +: 0/4/0 | -: 2/7/0 | 1 | 0 | 0 | 0 | Result | |
| 878 | PI2008 | ABC transporter, ATP-binding protein | PI2009 | ribosome-binding factor A | ->-> | 1968022 | 1968740 | 719 | 33.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 880 | PI2011 | hypothetical protein | PI2012 | hypothetical protein | ->-> | 1970791 | 1970946 | 156 | 34.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 881 | PI2017 | conserved hypothetical protein | PI2018 | 50S ribosomal protein L34 | ->-> | 1975779 | 1975896 | 118 | 33.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 882 | PI2018 | 50S ribosomal protein L34 | PI2019 | elongation factor P | ->-> | 1976050 | 1976270 | 221 | 26.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 883 | PI2019 | elongation factor P | PI2020 | glycosyl transferase, group 2 family protein | ->-> | 1976835 | 1977005 | 171 | 42.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 884 | PI2024 | hypothetical protein | PI2025 | conserved hypothetical protein | ->-> | 1979046 | 1979167 | 122 | 27% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 886 | PI2026 | RNA polymerase sigma-70 factor, ECF subfamily | PI2027 | arginine decarboxylase | ->-> | 1980144 | 1980300 | 157 | 38.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 887 | PI2027 | arginine decarboxylase | PI2028 | shikimate kinase | ->-> | 1982191 | 1982301 | 111 | 36% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 888 | PI2029 | DNA topoisomerase I | PI2030 | hypothetical protein | ->-> | 1985315 | 1985740 | 426 | 35.2% | 0 | 0 | 0 | +: 1/1/1 | -: 0/2/0 | 49 | 0 | 0 | 0 | Result | |
| 889 | PI2034 | conserved hypothetical protein | PI2035 | Holliday junction DNA helicase ruvB | ->-> | 1988181 | 1988351 | 171 | 28.7% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 890 | PI2037 | TIM-barrel protein, NifR3 family | PI2038 | conserved hypothetical protein; possible internalin-related protein | ->-> | 1990430 | 1990602 | 173 | 38.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 891 | PI2038 | conserved hypothetical protein; possible internalin-related protein | PI2039 | hypothetical protein | ->-> | 1992652 | 1992772 | 121 | 37.2% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 892 | PI2039 | hypothetical protein | PI2040 | conserved hypothetical protein; possible transporter | ->-> | 1993052 | 1993207 | 156 | 39.1% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 893 | PI2040 | conserved hypothetical protein; possible transporter | PI2041 | conserved hypothetical protein | ->-> | 1994126 | 1994300 | 175 | 25.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 894 | PI2043 | hypothetical protein | PI2044 | hypothetical protein | ->-> | 1996318 | 1997138 | 821 | 42.8% | 0 | 1 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 896 | PI2045 | hypothetical protein | PI2046 | hypothetical protein | ->-> | 1998784 | 1999169 | 386 | 39.9% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 44 | 0 | 0 | 0 | Result | |
| 897 | PI2046 | hypothetical protein | PI2047 | UDP-N-acetylmuramoylalanyl-D-glutamyl-2,6-diamino pimelate--D-alanyl-D-alanyl ligase | ->-> | 1999266 | 1999467 | 202 | 36.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 898 | PI2049 | possible transcriptional regulator, AraC family | PI2050 | hypothetical protein | ->-> | 2003764 | 2004151 | 388 | 22.2% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 899 | PI2051 | hypothetical protein | PI2052 | hypothetical protein | ->-> | 2007896 | 2008733 | 838 | 33.1% | 0 | 0 | 0 | +: 1/7/0 | -: 0/4/0 | 54 | 0 | 0 | 0 | Result | |
| 900 | PI2052 | hypothetical protein | PI2053 | conserved hypothetical protein; possible outer membrane receptor protein | ->-> | 2009757 | 2010812 | 1056 | 40.5% | 0 | 0 | 2 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 901 | PI2055 | hypothetical protein | PI2056 | conserved hypothetical protein | ->-> | 2013466 | 2013906 | 441 | 32.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 902 | PI2056 | conserved hypothetical protein | PI2057 | conserved hypothetical protein; possible metal-dependent membrane protease | ->-> | 2014489 | 2015078 | 590 | 34.7% | 0 | 0 | 0 | +: 0/4/0 | -: 0/3/0 | 35 | 0 | 0 | 0 | Result | |
| 905 | PI2066 | hypothetical protein | PI2067 | hypothetical protein | ->-> | 2027787 | 2027899 | 113 | 35.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 910 | PI2073 | mobilization protein | PI2074 | conserved hypothetical protein | ->-> | 2033548 | 2033799 | 252 | 52% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 911 | PI2074 | conserved hypothetical protein | PI2075 | conserved hypothetical protein | ->-> | 2034436 | 2034560 | 125 | 36.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 912 | PI2075 | conserved hypothetical protein | PI2076 | hypothetical protein | ->-> | 2035416 | 2035542 | 127 | 52% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 913 | PI2076 | hypothetical protein | PI2077 | hypothetical protein | ->-> | 2035819 | 2036031 | 213 | 35.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 914 | PI2079 | conserved hypothetical protein; possible ATPase | PI2080 | hypothetical protein | ->-> | 2038022 | 2038232 | 211 | 36.5% | 0 | 0 | 0 | +: 0/2/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 915 | PI2081 | conserved hypothetical protein; possible integrase | PI2082 | hypothetical protein | ->-> | 2039717 | 2040017 | 301 | 29.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 916 | PI2082 | hypothetical protein | PI2083 | hypothetical protein | ->-> | 2040324 | 2040463 | 140 | 36.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 917 | PI2084 | hypothetical protein | PI2085 | conserved hypothetical protein | ->-> | 2041130 | 2041239 | 110 | 31.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 918 | PI2085 | conserved hypothetical protein | PI2086 | signal peptidase I | ->-> | 2041864 | 2041974 | 111 | 36% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 919 | PI2087 | dihydropicolinate reductase | PI2088 | conserved hypothetical protein; possible PAP2 superfamily protein | ->-> | 2044316 | 2044576 | 261 | 28.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 920 | PI2088 | conserved hypothetical protein; possible PAP2 superfamily protein | PI2089 | conserved hypothetical protein | ->-> | 2045876 | 2046339 | 464 | 38.1% | 0 | 0 | 0 | +: 1/1/1 | -: 0/1/0 | 53 | 0 | 0 | 0 | Result | |
| 921 | PI2096 | conserved hypothetical protein; possible phosphoesterase | PI2097 | conserved hypothetical protein | ->-> | 2050945 | 2051051 | 107 | 45.8% | 0 | 0 | 0 | +: 0/2/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 922 | PI2099 | D-alanyl-D-alanine dipeptidase | PI2100 | conserved hypothetical protein | ->-> | 2053338 | 2053490 | 153 | 44.4% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 923 | PI2105 | hypothetical protein | PI2108 | cell surface protein; possible cell surface antigen BspA | ->-> | 2059647 | 2059800 | 154 | 31.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 927 | PI2115 | hypothetical protein | PI2116 | fumarate reductase/succinate dehydrogenase, iron-sulfur protein | ->-> | 2065226 | 2065354 | 129 | 26.4% | 0 | 0 | 0 | +: 0/1/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
| 928 | PI2118 | fumarate reductase/succinate dehydrogenase flavoprotein subunit, N-terminal | PI2119 | conserved hypothetical protein; possible cytochrome B subunit | ->-> | 2068058 | 2068170 | 113 | 33.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 929 | PI2119 | conserved hypothetical protein; possible cytochrome B subunit | PI2120 | hypothetical protein | ->-> | 2068819 | 2068978 | 160 | 28.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 930 | PI2120 | hypothetical protein | PI2122 | conserved hypothetical protein | ->-> | 2069111 | 2069883 | 773 | 35.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 931 | PI2123 | adenine phosphoribosyltransferase | PI2124 | excinuclease ABC, subunit C | ->-> | 2072385 | 2072723 | 339 | 40.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 932 | PI2127 | deoxyribose-phosphate aldolase | PI2128 | hypothetical protein | ->-> | 2076372 | 2076651 | 280 | 30.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 933 | PI2129 | octaprenyl-diphosphate synthase | PI2130 | DNA polymerase I | ->-> | 2077782 | 2078119 | 338 | 35.8% | 0 | 0 | 16 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 934 | PI2131 | hypothetical protein | PI2132 | hypothetical protein | ->-> | 2080929 | 2081100 | 172 | 27.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 935 | PI2137 | RNA methylase SpoU family | PI2138 | nicotinate phosphoribosyltransferase | ->-> | 2083868 | 2083975 | 108 | 38.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 936 | PI2138 | nicotinate phosphoribosyltransferase | PI2139 | cysteinyl-tRNA synthetase | ->-> | 2085194 | 2085405 | 212 | 32.1% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 937 | PI2139 | cysteinyl-tRNA synthetase | PI2140 | conserved hypothetical protein | ->-> | 2086813 | 2086912 | 100 | 35% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 938 | PI2141 | hypothetical protein | PI2142 | conserved hypothetical protein | ->-> | 2087618 | 2087745 | 128 | 28.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 939 | PI2147 | GTP-binding protein | PI2148 | ribonuclease III | ->-> | 2094468 | 2094644 | 177 | 30.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 940 | PI2149 | 3-oxoacyl-acyl-carrier-protein synthase | PI2150 | acyl carrier protein | ->-> | 2096854 | 2097111 | 258 | 32.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 941 | PI2150 | acyl carrier protein | PI2151 | conserved hypothetical protein | ->-> | 2097346 | 2097712 | 367 | 27.2% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 942 | PI2152 | heptosyltransferase | PI2153 | hypothetical protein | ->-> | 2099357 | 2099531 | 175 | 28.6% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 943 | PI2153 | hypothetical protein | PI2154 | leucyl-tRNA synthetase | ->-> | 2099691 | 2100000 | 310 | 35.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 944 | PI2155 | hypothetical protein | PI2156 | conserved hypothetical protein; possible permease | ->-> | 2101113 | 2102935 | 1823 | 46.5% | 0 | 1 | 0 | +: 1/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 945 | PI2160 | hypothetical protein | PI2161 | hypothetical protein | ->-> | 2108418 | 2108718 | 301 | 25.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 946 | PI2161 | hypothetical protein | PI2162 | conserved hypothetical protein | ->-> | 2108812 | 2108935 | 124 | 42.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 947 | PI2165 | conserved hypothetical protein; possible membrane protein | PI2168 | hypothetical protein | ->-> | 2111266 | 2111425 | 160 | 38.8% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
| 948 | PI2172 | hypothetical protein | PI2174 | hypothetical protein | ->-> | 2114052 | 2114384 | 333 | 30.3% | 0 | 0 | 0 | +: 0/1/0 | -: 1/1/0 | 56 | 0 | 0 | 0 | Result | |
| 949 | PI2174 | hypothetical protein | PI2175 | RNA polymerase sigma-54 | ->-> | 2115030 | 2115146 | 117 | 36.8% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| Total: | 1 | 20 | 0/70 | 804 | 20 | ||||||||||||||