CDS GC%: 43.5% tRNA GC%: 53.9% rRNA GC%: 54.1%

IGS#	Up stream Locus	Up stream Product	Down Stream Locus	Down Stream Product	Gene Dir type	Start	End	IGS Len	GC%	IS NT	IS AA	NR	PT-Pair	Intra Spp. IGS	Inter Spp. IGS	Conserved Inter-spp IGS Start	Conserved Inter-spp IGS End	Blast Result	Conserved IGS Seq
1	PI2178	1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate synthase, GcpE	PI0001	possible Ton-B receptor	->->	1	539	539	30.8%	0	0	0	+: 2/2/3 \| -: 0/3/0	59	0	0	0	Result
2	PI0001	possible Ton-B receptor	PI0002	conserved hypothetical protein	->->	2973	3111	139	28.8%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
3	PI0002	conserved hypothetical protein	PI0003	pseudouridylate synthase	->->	3931	4409	479	28.6%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
4	PI0003	pseudouridylate synthase	PI0004	hypothetical protein	->->	6105	6338	234	29.1%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
5	PI0004	hypothetical protein	PI0007	hypothetical protein	->->	6450	6556	107	29.9%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
6	PI0008	exoribonuclease II (ribonuclease II)	PI0009	NAD-dependent epimerase/dehydratase family protein	->->	9622	9792	171	32.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
7	PI0010	conserved hypothetical protein	PI0011	conserved hypothetical protein	->->	11740	12281	542	32.7%	0	0	0	+: 2/3/2 \| -: 0/1/0	56	0	0	0	Result
8	PI0011	conserved hypothetical protein	PI0012	conserved hypothetical protein	->->	13389	13545	157	30.6%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
9	PI0013	auxin-regulated protein	PI0014	hypothetical protein	->->	17167	17395	229	27.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
10	PI0014	hypothetical protein	PI0015	possible transport protein	->->	17978	18551	574	28.6%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
11	PI0015	possible transport protein	PI0016	magnesium chelatase, subunit ChlI	->->	20211	20330	120	24.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
13	PI0018	hypothetical protein	PI0019	conserved hypothetical protein	->->	23750	23881	132	28%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
14	PI0019	conserved hypothetical protein	PI0020	conserved hypothetical protein	->->	24515	24664	150	34%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
15	PI0022	hypothetical protein	PI0023	internalin-related protein	->->	25952	26063	112	25%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
16	PI0023	internalin-related protein	PI0024	hypothetical protein	->->	28131	28517	387	38.2%	0	0	0	+: 1/2/2 \| -: 0/2/0	52	0	0	0	Result
17	PI0024	hypothetical protein	PI0025	two component system sensor histidine kinase	->->	28620	28821	202	39.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
18	PI0030	transcriptional regulator, AsnC family	PI0031	peptidylprolyl isomerase	->->	35111	35261	151	29.8%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
20	PI0034	FKBP-type peptidyl-prolyl cis-trans isomerase	PI0035	NAD-dependent protein deacetylase, SIR2 family	->->	37894	38012	119	18.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
21	PI0036	glutathione peroxidase	PI0037	hypothetical protein	->->	39350	39493	144	36.1%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
22	PI0041	hypothetical protein	PI0043	thiamine phosphate pyrophosphorylase	->->	42084	42433	350	32.3%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
24	PI0047	phosphomethylpyrimidine kinase	PI0048	conserved hypothetical protein	->->	46842	47258	417	37.6%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
25	PI0048	conserved hypothetical protein	PI0049	outer membrane receptor protein (iron transport)	->->	48555	48744	190	34.2%	0	0	0	+: 0/2/0 \| -: 1/1/0	1	0	0	0	Result
26	PI0049	outer membrane receptor protein (iron transport)	PI0050	conserved hypothetical protein	->->	51151	51678	528	30.5%	0	0	0	+: 2/1/1 \| -: 0/0/0	1	0	0	0	Result
27	PI0051	hypothetical protein	PI0054	hypothetical protein	->->	53449	54718	1270	32%	0	0	0	+: 1/6/5 \| -: 2/4/0	46	0	0	0	Result
28	PI0056	conserved hypothetical protein; possible DNA uptake protein	PI0057	conserved hypothetical protein	->->	55968	56098	131	42.7%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
29	PI0058	conserved hypothetical protein	PI0059	peptide chain release factor RF-2	->->	57105	57271	167	37.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
31	PI0060	long-chain-fatty-acid--CoA ligase (acyl-CoA synthetase)	PI0061	hypothetical protein	->->	60227	60639	413	30.5%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
32	PI0061	hypothetical protein	PI0062	endopeptidase	->->	60751	61102	352	37.8%	0	0	0	+: 0/3/0 \| -: 0/1/0	2	0	0	0	Result
33	PI0062	endopeptidase	PI0063	transcriptional regulator, GntR family	->->	63083	63320	238	29%	0	0	0	+: 0/2/0 \| -: 0/2/0	1	0	0	0	Result
34	PI0066	ABC transport system, ATP-binding component	PI0067	hypothetical protein	->->	66150	66412	263	28.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
35	PI0068	arginine repressor	PI0069	hypothetical protein	->->	67080	67211	132	40.2%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
36	PI0069	hypothetical protein	PI0070	conserved hypothetical protein	->->	67440	67792	353	28%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
37	PI0073	dihydropteroate synthase	PI0074	Na+/phosphate symporter (sodium-dependent inorganic phosphate (Pi) transporter)	->->	71846	71992	147	36.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
38	PI0074	Na+/phosphate symporter (sodium-dependent inorganic phosphate (Pi) transporter)	PI0075	uridine kinase	->->	73700	73887	188	28.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
39	PI0075	uridine kinase	PI0076	conserved hypothetical protein	->->	75451	75784	334	30.8%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
40	PI0076	conserved hypothetical protein	PI0077	hypothetical protein	->->	76253	76383	131	38.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
41	PI0077	hypothetical protein	PI0078	hypothetical protein	->->	77680	77907	228	36%	0	0	0	+: 0/1/0 \| -: 0/3/0	1	0	0	0	Result
42	PI0078	hypothetical protein	PI0079	hypothetical protein	->->	78391	78704	314	25.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
43	PI0081	hypothetical protein	PI0082	conserved hypothetical protein (possible phosphoglycerol transferase)	->->	80761	80914	154	29.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
44	PI0082	conserved hypothetical protein (possible phosphoglycerol transferase)	PI0083	tyrosyl-tRNA synthetase	->->	82772	82963	192	32.3%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
45	PI0083	tyrosyl-tRNA synthetase	PI0084	conserved hypothetical protein	->->	84176	84334	159	35.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
46	PI0088	S-adenosylmethionine synthetase	PI0089	hypothetical protein	->->	88093	88301	209	28.7%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
47	PI0089	hypothetical protein	PI0090	amidophosphoribosyltransferase	->->	88416	88518	103	36.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
48	PI0095	hypothetical protein	PI0096	glycerol-3-phosphate cytidylyltransferase	->->	91911	92024	114	28.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
49	PI0099	hypothetical protein	PI0100	LPS biosynthesis protein (lipopolysaccharide biosynthesis protein)	->->	95838	95982	145	32.4%	0	0	0	+: 1/1/0 \| -: 0/2/0	1	0	0	0	Result
50	PI0101	lauroyl/myristoyl acyltransferase	PI0102	hypothetical protein	->->	97814	97995	182	30.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
51	PI0102	hypothetical protein	PI0103	conserved hypothetical protein; possible permease	->->	98125	98275	151	41.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
52	PI0104	hypothetical protein	PI0105	possible sulfatase	->->	99407	99542	136	33.1%	0	0	0	+: 1/1/0 \| -: 0/1/0	1	0	0	0	Result
53	PI0107	2-methylthioadenine synthetase	PI0108	L-lactate permease	->->	104713	105031	319	37.9%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
54	PI0108	L-lactate permease	PI0109	hypothetical protein	->->	106529	106856	328	33.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
55	PI0110	ABC transport system, ATP-binding protein	PI0112	hypothetical protein	->->	107981	108152	172	35.5%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
56	PI0113	arginyl-tRNA synthetase	PI0116	conserved hypothetical protein	->->	110143	110352	210	33.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
57	PI0119	hypothetical protein	PI0120	glutamate racemase	->->	111784	111917	134	33.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
58	PI0121	outer membrane protein, ompH family	PI0122	outer membrane protein, ompH family	->->	113269	113458	190	43.7%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
59	PI0125	undecaprenyl pyrophosphate synthase	PI0126	conserved hypothetical protein	->->	117951	118064	114	35.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
60	PI0126	conserved hypothetical protein	PI0127	conserved hypothetical protein	->->	118650	118822	173	40.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
61	PI0127	conserved hypothetical protein	PI0128	dipeptidase, pathogenicity island-encoded protein D	->->	120218	120671	454	35.5%	0	0	3	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
62	PI0129	hypothetical protein	PI0130	hypothetical protein	->->	122002	122171	170	31.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
63	PI0130	hypothetical protein	PI0131	conserved hypothetical protein (possible outer membrane lipoprotein)	->->	122328	122629	302	27.8%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
66	PI0136	surface antigen BspA	PI0137	lectin-like adhesin precursor	->->	128145	129004	860	28.5%	0	0	0	+: 1/1/1 \| -: 0/2/0	1	0	0	0	Result
67	PI0138	hypothetical protein	PI0140	conserved hypothetical protein	->->	131426	131782	357	40.9%	0	0	0	+: 0/3/0 \| -: 0/2/0	1	0	0	0	Result
68	PI0141	glutamine amidotransferase involved in pyridoxine biosynthesis	PI0142	DNA-binding protein	->->	133369	133978	610	34.9%	0	0	0	+: 0/2/0 \| -: 0/4/0	50	0	0	0	Result
69	PI0142	DNA-binding protein	PI0144	conserved hypothetical protein	->->	134252	135559	1308	40.6%	0	0	250	+: 2/0/0 \| -: 0/0/0	1	0	0	0	Result
71	PI0145	secDF export membrane protein	PI0146	transcription elongation factor	->->	139785	140477	693	33.9%	0	0	0	+: 0/4/0 \| -: 1/4/2	56	0	0	0	Result
72	PI0147	HIT family protein	PI0148	mannose-1-phosphate guanylyltransferase	->->	141369	141562	194	41.8%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
73	PI0148	mannose-1-phosphate guanylyltransferase	PI0149	conserved hypothetical protein	->->	142655	142874	220	26.8%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
74	PI0149	conserved hypothetical protein	PI0150	hypothetical protein	->->	143298	143650	353	25.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
78	PI0155	conserved hypothetical protein	PI0156	conserved hypothetical protein	->->	148748	148855	108	30.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
79	PI0156	conserved hypothetical protein	PI0158	hypothetical protein	->->	150974	151181	208	41.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
80	PI0159	hypothetical protein	PI0160	conserved hypothetical protein	->->	152181	152749	569	29%	0	0	0	+: 0/3/0 \| -: 1/2/0	1	0	0	0	Result
81	PI0160	conserved hypothetical protein	PI0161	possible TonB receptor	->->	153329	153503	175	40%	0	0	0	+: 0/2/0 \| -: 0/2/0	1	0	0	0	Result
83	PI0162	ADP-ribosylglycohydrolase (ADP-ribosyl-[dinitrogen reductase] hydrolase)	PI0163	conserved hypothetical protein	->->	157062	157255	194	35.6%	0	0	0	+: 1/2/0 \| -: 0/2/0	1	0	0	0	Result
84	PI0163	conserved hypothetical protein	PI0164	conserved hypothetical protein	->->	158471	158617	147	40.8%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
85	PI0164	conserved hypothetical protein	PI0165	AAA family ATPase	->->	159356	159741	386	29.5%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
86	PI0165	AAA family ATPase	PI0166	hypothetical protein	->->	161107	161225	119	29.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
89	PI0173	hypothetical protein	PI0174	succinyl-CoA synthetase alpha subunit	->->	165619	166260	642	31.5%	0	0	2	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
90	PI0176	hypothetical protein	PI0177	2-oxoglutarate synthase, subunit korB	->->	168502	168638	137	32.8%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
91	PI0178	2-oxoglutarate synthase, subunit korA	PI0179	hypothetical protein	->->	171488	171896	409	35.5%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
92	PI0181	conserved hypothetical protein	PI0182	hypothetical protein	->->	174001	174232	232	28.9%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
93	PI0182	hypothetical protein	PI0183	hypothetical protein	->->	174338	174486	149	31.5%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
94	PI0184	possible fibronectin type III domain protein	PI0185	conserved hypothetical protein	->->	176577	177131	555	34.1%	0	0	0	+: 0/2/0 \| -: 0/2/0	1	0	0	0	Result
97	PI0191	O-methyltransferase	PI0192	conserved hypothetical protein	->->	181846	182270	425	34.6%	0	0	0	+: 0/3/0 \| -: 0/3/0	7	0	0	0	Result
98	PI0193	conserved hypothetical protein	PI0194	2-amino-3-ketobutyrate coenzyme A ligase (glycine C-acetyltransferase)	->->	185756	185943	188	31.4%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
99	PI0194	2-amino-3-ketobutyrate coenzyme A ligase (glycine C-acetyltransferase)	PI0195	epimerase/reductase	->->	187018	187311	294	28.9%	0	0	1	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
100	PI0195	epimerase/reductase	PI0196	hypothetical protein	->->	188263	188574	312	37.2%	0	0	0	+: 0/3/0 \| -: 0/3/0	35	0	0	0	Result
101	PI0197	acetate kinase	PI0199	phosphate acetyltransferase	->->	189888	190029	142	28.9%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
102	PI0198	hypothetical protein	PI0200	hypothetical protein	->->	191117	191684	568	31.5%	0	0	1	+: 1/1/0 \| -: 0/0/0	1	0	0	0	Result
103	PI0203	conserved hypothetical protein	PI0204	dGTP triphosphohydrolase (deoxyguanosinetriphosphate triphosphohydrolase)	->->	196125	196258	134	40.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
104	PI0204	dGTP triphosphohydrolase (deoxyguanosinetriphosphate triphosphohydrolase)	PI0205	deoxyuridine 5'-triphosphate nucleotidohydrolase	->->	197606	197720	115	25.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
105	PI0210	hypothetical protein	PI0211	hypothetical protein	->->	203859	204206	348	37.4%	0	0	0	+: 0/1/0 \| -: 0/1/0	52	0	0	0	Result
106	PI0211	hypothetical protein	PI0212	surface protein/internalin-related protein	->->	204339	204556	218	29.4%	0	0	0	+: 1/1/0 \| -: 0/1/0	1	0	0	0	Result
107	PI0212	surface protein/internalin-related protein	PI0213	conserved hypothetical protein	->->	207083	207204	122	44.3%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
108	PI0214	hypothetical protein	PI0215	hypothetical protein	->->	208711	208962	252	28.6%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
111	PI0224	conserved hypothetical protein	PI0225	conserved hypothetical protein	->->	222040	222177	138	37.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	1	32	138	Result	atattacaatgtatttaataacaccaacagcggtgcacggacaaaagtaaatcaaagaaacagtgtatgttaggggtttgagataactgcgtacttgtggcttcgat
112	PI0227	ABC transporter, ATP-binding/permease protein	PI0228	outer membrane cobalamin receptor protein	->->	225693	225891	199	37.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
113	PI0230	hypothetical protein	PI0231	transcriptional regulator	->->	228967	229592	626	39%	0	0	1	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
114	PI0233	membrane protein, possible exporter	PI0234	integrase	->->	233832	234612	781	37.1%	1	14	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
115	PI0235	hypothetical protein	PI0237	predicted two-component system sensor histidine kinase	->->	236014	236118	105	32.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
116	PI0238	two-component system response regulator	PI0239	conserved hypothetical protein	->->	237887	238114	228	39%	0	0	0	+: 0/0/0 \| -: 2/1/0	1	0	0	0	Result
117	PI0239	conserved hypothetical protein	PI0240	conserved hypothetical protein	->->	238496	238601	106	27.4%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
118	PI0240	conserved hypothetical protein	PI0241	possible tetracycline resistance element /mobilization regulatory protein	->->	239403	239766	364	36%	0	0	0	+: 0/3/0 \| -: 0/2/0	1	0	0	0	Result
119	PI0242	hypothetical protein	PI0243	hypothetical protein	->->	240288	240645	358	43.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	1	134	257	Result	gcccacaagcaggtgaaaggtgcggtgaagactcctatgacgacaaagaggagcagtttgacaatatagtaaacaatccactgcccatttgtcccagccatcatcttataggaatgtacttttc
120	PI0244	possible mobilization protein C	PI0245	possible mobilization protein	->->	242860	243085	226	30.1%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
121	PI0246	conserved hypothetical protein	PI0247	conjugative transposon protein, TraA	->->	244660	245512	853	46.5%	0	0	0	+: 0/3/0 \| -: 0/2/0	2	1	149	395	Result	gccctctgcaagagcaagagttctgagttaccgaatttatttcgagtaacgcaggacatatcttgctatttgctccggcgcaaataaatccgtccgtgaaggacggaagtcgagtccctcaaaaaagaacgctttatgcctcgaaggcttcggcttaccgcttgggtgcaaagttactaagcgttgtgcctaaagcacttacctcttacggagccacaaatacgcaaatcgaagccacaagtacgca
122	PI0253	conjugative transposon protein, TraD	PI0256	conjugative transposon protein, TraE	->->	249034	249183	150	41.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
123	PI0258	conjugative transposon protein, TraG	PI0259	conserved protein found in conjugation, TraI	->->	252346	252494	149	30.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
125	PI0263	conjugative transposon protein, TraM	PI0264	transfer region-related protein, TraN	->->	256473	256633	161	46.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
126	PI0268	lysozyme-related protein	PI0269	conserved hypothetical protein	->->	259851	259974	124	33.1%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
127	PI0271	hypothetical protein	PI0272	conserved hypothetical protein	->->	262452	262760	309	37.9%	0	0	0	+: 0/1/0 \| -: 0/0/0	2	1	168	309	Result	ttggctttttgttacttttgagccgtcccaactcactgtcaaaagtaacgaggtacttttcttcgggtttctttgctactttctttgtccgctcgaagctcacgaaagaaagtagcggtcggcagatttgccgaccgcttta
128	PI0282	hypothetical protein	PI0283	Zn-dependent peptidase	->->	266887	267693	807	41.1%	0	0	0	+: 0/0/0 \| -: 0/3/0	2	4	10	584	Result	tttttgattttatgcagattttagaggtgagggagttgagtttccattttctttttccctgcttctcgcatatccgacattttttttatgcgtctttccgtcgggccggtcgttttcgtttcagtggcgtaaaaaggtagggcttaggacaaacaaggttttacggcgagaatactacctgcaatgaaatggaagtgtggagattgtcgtctaaacggcttgccgccccgaccttttttgtccgtagaagcccggaactacctttgccgctgacaacgaacaaccgatcccgacataatacacgggcataagtggaggatgtgcagacggagaagcggggcgaaaacaaaaaacgcagtcttcggggactgcatcttatcataaaacggaatacacggaaaacaaaaagccgccccaacggacggctctatgaaaataatttggagaaaattcttttttctcacgatatacctttatctttgcaacaggttattcgagttatgcaaagcgttgtatatcactgttgaagataggtcgctaaatcattacctactgcatttcataactcataaggc
131	PI0294	conserved hypothetical protein	PI0295	lysine decarboxylase	->->	276867	276985	119	25.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
132	PI0295	lysine decarboxylase	PI0296	hypothetical protein	->->	277559	277761	203	27.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
140	PI0303	hypothetical protein	PI0305	possible aminotransferase	->->	287671	287857	187	21.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
141	PI0306	conserved hypothetical protein	PI0307	RNA polymerase sigma-70 factor, ECF subfamily	->->	289889	290181	293	27%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
142	PI0310	outer membrane protein	PI0312	hypothetical protein	->->	294371	294730	360	26.7%	0	0	0	+: 1/0/0 \| -: 0/0/0	2	0	0	0	Result
144	PI0315	conserved hypothetical protein	PI0316	conserved hypothetical protein	->->	298247	298518	272	42.3%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
146	PI0321	conserved hypothetical protein	PI0322	hypothetical protein	->->	303347	303647	301	33.2%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
150	PI0327	hypothetical protein	PI0328	conserved hypothetical protein	->->	309168	309615	448	41.7%	0	0	0	+: 0/1/0 \| -: 0/1/0	2	0	0	0	Result
151	PI0328	conserved hypothetical protein	PI0329	hypothetical protein	->->	310054	310205	152	32.9%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
152	PI0331	hypothetical protein	PI0332	conserved hypothetical protein	->->	312636	312739	104	44.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
154	PI0338	hypothetical protein	PI0339	hypothetical protein	->->	315774	315874	101	48.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
155	PI0340	conserved hypothetical protein	PI0341	conserved hypothetical protein	->->	316796	317177	382	44%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
156	PI0342	hypothetical protein	PI0344	conserved hypothetical protein	->->	318110	318317	208	41.3%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
157	PI0344	conserved hypothetical protein	PI0345	conserved hypothetical protein	->->	319500	319624	125	50.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
158	PI0345	conserved hypothetical protein	PI0346	hypothetical protein	->->	320870	320973	104	36.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
159	PI0356	hypothetical protein	PI0358	hypothetical protein	->->	327349	327700	352	40.6%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
160	PI0358	hypothetical protein	PI0359	hypothetical protein	->->	328166	328478	313	48.9%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
161	PI0362	hypothetical protein	PI0364	hypothetical protein	->->	333999	334141	143	42.7%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
162	PI0365	hypothetical protein	PI0366	conserved hypothetical protein	->->	336179	336904	726	49%	0	0	0	+: 0/0/0 \| -: 1/2/1	1	0	0	0	Result
163	PI0368	hypothetical protein	PI0369	hypothetical protein	->->	340046	340223	178	39.9%	0	0	0	+: 0/1/0 \| -: 1/0/0	2	0	0	0	Result
164	PI0369	hypothetical protein	PI0370	conserved hypothetical protein	->->	340470	340592	123	43.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
165	PI0371	thymidylate synthase	PI0372	conserved hypothetical protein; possible ATPase	->->	342034	342150	117	27.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
166	PI0375	hypothetical protein	PI0376	conserved hypothetical protein	->->	346143	346556	414	42.3%	0	0	0	+: 1/1/0 \| -: 0/3/0	2	0	0	0	Result
167	PI0377	DNA primase/mobilizable transposon, excision protein	PI0378	conserved hypothetical protein; possible helicase	->->	347884	348165	282	34.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	3	1	100	282	Result	tgttttgatactttaatgggttgaatgataattatttatgcttgtctgttttatggttttaccgtttccaaagttttcccctccaaactttttcatctttcttcttaccacatactattttgtgataaatgattgataatcagtattactttgtagtataagacaatactacacattctacta
168	PI0378	conserved hypothetical protein; possible helicase	PI0379	conserved hypothetical protein	->->	349600	350011	412	38.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	1	114	220	Result	tgattggagcatattttatatcggattactgtgccaacctattccactatgacgccacaagctgccacttgaatgaaaagtgatggaataagaaatgcccgatatta
169	PI0380	conserved hypothetical protein	PI0381	probable transcriptional regulator, AraC family	->->	350602	350711	110	35.5%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
170	PI0382	conserved hypothetical protein	PI0383	conserved hypothetical protein; possible Zn-dependent hydrolase	->->	352184	352292	109	35.8%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
171	PI0384	probable radical SAM domain protein	PI0385	hypothetical protein	->->	353882	354107	226	35%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
172	PI0387	hypothetical protein	PI0388	integrase	->->	354873	355066	194	38.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	2	1	119	Result	tgaggtaatgattattggaagaatttttctcatacggtttcttcttatctgtttatcaatattttgcgtatcagagaacgctttgataacgggtaattttgcccataaagttaaagcgt
173	PI0390	conserved hypothetical protein	PI0391	conserved hypothetical protein	->->	357816	357946	131	32.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	2	4	128	Result	agaaaagcaggcagtaagaaaagtaatttctactgtctgctttttctaatggatttattgccactacctacttcatattctcttttttcagcgtataatggcaatctcaaaaggattctctttca
174	PI0391	conserved hypothetical protein	PI0392	possible transcriptional regulator	->->	358277	358483	207	30.9%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	3	76	207	Result	aaaatgtattttaaattgttgaaatcactgcaaaattatacctttgcactacaatacacaagtacatacaaaaatgtatgatacacactatattgttagttttactgaatatcaacaagaaaaaagttcgct
175	PI0394	transcriptional regulator, AraC family	PI0395	Na+-driven multidrug efflux pump	->->	360390	360527	138	37%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	1	4	138	Result	tgctattatcaccgttgtttgtctattgtgacgacctgtatccccctgtacctttgcagcagaatttatttacttaagaagatacagattataaggatgaacaacgctgtgaatattttgcaagaaggaagtatg
176	PI0395	Na+-driven multidrug efflux pump	PI0396	possible tetracycline resistance element mobilization regulatory protein, C-terminal fragment	->->	361845	362132	288	38.2%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	3	1	288	Result	tgaacataaaagatatgattatgctaagacttactcaaactgaagactttaagacaataatctctttatgctctacaaaaggacagatacaaaaagcgtcagacaactttattctgaagattattgccctatgtgatgcagaaagagatttagtctcattgtttcggaccctccgttatacacgcttttgcctgcaaccgttgcaaaggggagattcaatggacggagaggggaaaaaatgtatcagaactgctctttgtcattgacacggagcttgaattactgaaa
177	PI0397	conserved hypothetical protein	PI0398	hypothetical protein	->->	362960	363517	558	40.7%	0	0	0	+: 0/1/0 \| -: 0/1/0	2	2	1	558	Result	tactttggattttaatggtttgtaattctctcttctggaaatagaacgtgctaaacacaattgaaatccattagagagcgttcacgataaaatagccaatcaagacaacgaaaacttctatccaagaacaccgacttcggaggtgttctgccctctgcaagagcaagggttttgagttaccgaaataatttcgggtaacgcaagacataccttgctatttgcactgacgcaaataaattcgttccgaagaacgatatgttattctctcgaaatgtatgttttcaaagccatgaaataccgacttatcgcttactgcaaagttactaagtgttgtgcctaaatcccttacctcatacgaagccacaactatccaaatcgaagccacaagtacgcactaaagtaaatcacgctgattacagcatcaccgagccatatatttgcaccgtcgaatatgtcggtggaggaatgtgtcttcgatgatatcacgattcgatgagcgatataagcgagggggtatatcaaagaacacgtccttgattctttcacttgaacgtggaa
178	PI0398	hypothetical protein	PI0399	conserved hypothetical protein	->->	363602	363724	123	35.8%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	2	1	123	Result	tagccctgctggtacaaccccattatcgggcatatcttagatagtggatgtattcatctttgcaggtaaatataccggcaaagaaatgaacagtgaattgtataacaataaaattaagtaagt
179	PI0399	conserved hypothetical protein	PI0400	conserved hypothetical protein	->->	364151	364568	418	42.3%	0	0	3	+: 0/2/0 \| -: 0/2/0	1	1	1	302	Result	taaatccctatcttcagatgttttaaatggaactgttcttctgcttgccgtcctttcctacaatgtcgggacaggcaggttgctcggatacggcaagcatcccaagagccgactgttgcggaagatagagtcgggcgacaggaatttctatcgtgaatttgtctctttctgccgatacaagggcaaagtcctcagaggtctcgtcaaacgacgaaaggtggagtttgccctgttttatgtaccctgattaccacatacacctcttgcgacatttttatgctcgcaagaggcgttttcttgcc
180	PI0401	conserved hypothetical protein	PI0402	conserved hypothetical protein	->->	367168	368031	864	42.7%	0	0	0	+: 0/6/0 \| -: 1/4/0	3	3	4	861	Result	ttttatatctctaattttggctttttgttacttttgagctgtctcaactcactgtcaaaagtaacgaagtgtttttcattggggtttctttgctcctttctttgtccgcccgatgctcacgaaagagaggagcggtcggcaaatccgccgaccgctttactccgtctgtttatcttgaacagttatccgtcccgtccttacttcggggtgagtggagaaagcccaatttacgttccaattgggttcattctttatacatgaaataggggataaagtgcaaccataacgagggcataagtcagaatgtacactgcgatagccaaagcgatggtaaggagcagccgaatgaggaaattttccacacatatccctgccagctaaagccagacgcttccgccccaaaggagagagcctgagagtgcaagtgccacccaaattgatattttgtatctctgtttcatcttgtctgattttttttgattttatgcggattccagaggagagggagttgagtttccattttctttttacctgcttctcgcatatccgacctttttttatgcgtctttccgtcgggtcggtcgttttcgtttcgaggcaataaaaaggttaggtggctaggacaacaaggtttagggcaagaatactacctgaagaatgaagtgtggagattgttgccctaacggcttgtcgcttgaccttgttgcccgcagtacaacgaaactacctttgccgaagaaaacgatacgaatgattcgatgcgaaaacatataatagaatgtgaggaatagaatgtaaacagaattgtgttaaactacttttattgtagtctgaaacagttctacttacacacctata
181	PI0402	conserved hypothetical protein	PI0403	probable integrase	->->	370084	370228	145	24.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
183	PI0410	glutamyl-tRNA synthetase (glutamate--tRNA ligase)	PI0411	conserved hypothetial protein; possible hydrolase	->->	377551	377839	289	36.7%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
184	PI0412	primosomal protein N', replication factor Y	PI0413	outer membrane protein	->->	382213	382552	340	37.1%	0	0	0	+: 0/2/0 \| -: 0/2/0	55	0	0	0	Result
185	PI0413	outer membrane protein	PI0414	hypothetical protein	->->	384080	384466	387	30%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
186	PI0414	hypothetical protein	PI0415	malate dehydrogenase	->->	385271	385497	227	33.9%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
187	PI0421	hypothetical protein	PI0423	hypothetical protein	->->	387835	388240	406	43.8%	0	0	2	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
188	PI0424	methylated-DNA--[protein]-cysteine S-methyltransferase	PI0426	conserved hypothetical protein	->->	389037	389484	448	35.9%	0	0	0	+: 0/4/0 \| -: 0/2/0	1	0	0	0	Result
189	PI0425	hypothetical protein	PI0427	conserved hypothetical protein	->->	389783	391279	1497	44%	0	0	3	+: 1/3/3 \| -: 1/0/0	1	0	0	0	Result
190	PI0428	hypothetical protein	PI0429	hypothetical protein	->->	396382	396557	176	34.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
191	PI0429	hypothetical protein	PI0430	periplasmic protease; MdsD protein	->->	399663	399969	307	24.8%	0	0	0	+: 0/3/0 \| -: 1/0/0	1	0	0	0	Result
193	PI0432	hypothetical protein	PI0434	possible beta-lactamase	->->	405098	405831	734	33.4%	0	0	0	+: 0/4/0 \| -: 0/2/0	2	0	0	0	Result
194	PI0434	possible beta-lactamase	PI0435	30S ribosomal protein S21	->->	406951	407136	186	37.1%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
196	PI0444	50S ribosomal protein L7/L12	PI0446	DNA-directed RNA polymerase, beta subunit	->->	413451	413617	167	29.9%	0	0	0	+: 0/1/0 \| -: 0/3/0	1	0	0	0	Result
197	PI0447	DNA-directed RNA polymerase, beta' subunit	PI0448	hypothetical protein	->->	421816	421983	168	31.5%	0	0	0	+: 0/3/0 \| -: 0/1/0	1	0	0	0	Result
198	PI0450	hypothetical protein	PI0451	serine proteases, S51 group	->->	424107	424482	376	25.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
199	PI0451	serine proteases, S51 group	PI0452	conserved hypothetical protein; possible surface antigen	->->	425188	425432	245	26.5%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
200	PI0453	conserved hypothetical protein	PI0455	hypothetical protein	->->	427255	427500	246	25.6%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
201	PI0455	hypothetical protein	PI0456	30S ribosomal protein S12	->->	428563	428898	336	26.5%	0	0	0	+: 0/4/0 \| -: 0/1/0	1	0	0	0	Result
202	PI0456	30S ribosomal protein S12	PI0457	30S ribosomal protein S7	->->	429280	429510	231	33.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
203	PI0473	30S ribosomal protein S14	PI0474	30S ribosomal protein S8	->->	439074	439182	109	24.8%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
204	PI0480	preprotein translocase, SecY subunit	PI0481	translation initiation factor IF-1	->->	443054	443253	200	29.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
205	PI0482	50S ribosomal protein L36	PI0483	30S ribosomal protein S13	->->	443600	443724	125	23.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
206	PI0487	50S ribosomal protein L17	PI0488	conserved hypothetical protein	->->	446764	447045	282	27.7%	0	0	0	+: 1/1/0 \| -: 1/1/0	1	0	0	0	Result
207	PI0488	conserved hypothetical protein	PI0489	probable cardiolipin synthetase	->->	447598	447749	152	34.9%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
208	PI0491	hypothetical protein	PI0492	hypothetical protein	->->	451288	451840	553	31.8%	0	0	0	+: 1/2/1 \| -: 0/1/0	1	0	0	0	Result
209	PI0492	hypothetical protein	PI0493	surface antigen BspA	->->	452519	452983	465	35.1%	0	0	0	+: 0/4/0 \| -: 0/1/0	1	0	0	0	Result
210	PI0495	conserved hypothetical protein	PI0496	heat shock protein hsp70 (chaperone protein dnaK)	->->	456449	456771	323	34.4%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
211	PI0496	heat shock protein hsp70 (chaperone protein dnaK)	PI0497	predicted recombinase, tnpA protein	->->	458671	458880	210	26.7%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
212	PI0499	integrase, C-terminal region	PI0500	mobilizable transposon, tnpC protein	->->	460707	460813	107	32.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
213	PI0500	mobilizable transposon, tnpC protein	PI0501	excisionase	->->	461468	461569	102	31.4%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
214	PI0502	conserved hypothetical protein; possible helicase	PI0503	mobilizable transposon, excision protein	->->	463150	463370	221	29.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
215	PI0503	mobilizable transposon, excision protein	PI0504	hypothetical protein	->->	464259	464598	340	41.2%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
216	PI0508	possible cell filamentation protein	PI0509	conserved hypothetical protein	->->	467497	467693	197	33%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
217	PI0510	hypothetical protein	PI0511	hypothetical protein	->->	470360	470573	214	29%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
218	PI0512	conserved hypothetical protein	PI0513	ion transporter	->->	471501	471669	169	42%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
219	PI0513	ion transporter	PI0514	possible cell filamentation protein	->->	472432	472547	116	30.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
220	PI0514	possible cell filamentation protein	PI0515	conserved hypothetical protein	->->	473001	473184	184	23.4%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
221	PI0515	conserved hypothetical protein	PI0516	ferredoxin, 4Fe-4S	->->	475492	476003	512	29.5%	0	0	0	+: 0/1/0 \| -: 0/0/0	2	0	0	0	Result
222	PI0516	ferredoxin, 4Fe-4S	PI0517	apparent PorT homolog	->->	476169	476400	232	24.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
223	PI0523	hypothetical protein	PI0524	meso-diaminopimelate D-dehydrogenase	->->	479905	480012	108	25.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
224	PI0524	meso-diaminopimelate D-dehydrogenase	PI0525	transcriptional regulator, Arac family	->->	480910	481471	562	31.5%	0	0	0	+: 0/0/0 \| -: 0/3/0	1	0	0	0	Result
225	PI0529	hypothetical protein	PI0530	possible membrane-fusion protein	->->	483802	483911	110	40%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
226	PI0531	ABC transporter, ATP-binding protein; possible gliding motility related	PI0532	ABC transporter, ATP-binding/permease protein	->->	486300	486402	103	34%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
228	PI0538	transcriptional regulator	PI0540	conserved hypothetical protein	->->	492986	493094	109	37.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
229	PI0539	hypothetical protein	PI0541	GTP-binding protein, GTP1/OBG family	->->	493789	493899	111	51.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
230	PI0541	GTP-binding protein, GTP1/OBG family	PI0543	adenylate kinase	->->	495070	495212	143	34.3%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
232	PI0546	hypothetical protein	PI0547	fructose-bisphosphate aldolase	->->	498299	498515	217	28.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
233	PI0547	fructose-bisphosphate aldolase	PI0548	possible acetylxylan esterase	->->	499527	499671	145	36.6%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
234	PI0551	hypothetical protein	PI0552	hypothetical protein	->->	502744	502855	112	30.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
235	PI0553	recombination protein	PI0554	hypothetical protein	->->	504444	504554	111	34.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
236	PI0556	saccharopine dehydrogenase	PI0557	conserved hypothetical protein	->->	506221	506326	106	40.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
237	PI0557	conserved hypothetical protein	PI0558	probable transcriptional regulator, TetR family	->->	506945	507175	231	29.4%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
238	PI0560	hypothetical protein	PI0561	hypothetical protein	->->	508971	509091	121	36.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	3	0	0	0	Result
239	PI0562	conserved hypothetical protein	PI0563	possible integral membrane protein	->->	510259	510387	129	28.7%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
240	PI0563	possible integral membrane protein	PI0565	hypothetical protein	->->	511240	511618	379	30.1%	0	0	0	+: 1/2/0 \| -: 0/0/0	1	0	0	0	Result
241	PI0564	hypothetical protein	PI0566	enoyl-[acyl-carrier-protein] reductase	->->	511782	511971	190	35.8%	0	0	0	+: 0/3/0 \| -: 0/3/0	1	0	0	0	Result
243	PI0568	hypothetical protein	PI0569	phosphoglycerate kinase	->->	513192	513436	245	32.2%	0	0	0	+: 1/3/0 \| -: 0/2/0	1	0	0	0	Result
244	PI0569	phosphoglycerate kinase	PI0570	exsB protein; possible aluminum resistance protein	->->	514685	514804	120	24.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
245	PI0572	tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase	PI0573	aminopeptidase C (bleomycin hydrolase)	->->	517650	517971	322	38.8%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
246	PI0573	aminopeptidase C (bleomycin hydrolase)	PI0574	hypothetical protein	->->	519280	519399	120	37.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
247	PI0574	hypothetical protein	PI0575	hypothetical protein	->->	519505	519700	196	35.2%	0	0	0	+: 0/2/0 \| -: 0/1/0	57	0	0	0	Result
248	PI0576	helicase, UvrD/Rep	PI0577	conserved hypothetical protein	->->	521785	521950	166	36.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
249	PI0578	methyltransferase	PI0579	hypothetical protein	->->	523314	523558	245	32.7%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
251	PI0584	hypothetical protein	PI0585	conserved hypothetical protein	->->	527717	532799	5083	47.5%	0	0	19	+: 0/6/0 \| -: 1/3/2	1	0	0	0	Result
252	PI0585	conserved hypothetical protein	PI0586	hypothetical protein	->->	533319	533896	578	29.6%	0	0	0	+: 0/2/0 \| -: 0/5/0	1	0	0	0	Result
253	PI0586	hypothetical protein	PI0587	conserved hypothetical protein	->->	534425	534555	131	30.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
254	PI0588	hypothetical protein	PI0589	asparaginyl-tRNA synthetase (asparagine--tRNA ligase)	->->	535486	535630	145	31.7%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
255	PI0590	ribosomal large subunit pseudouridine synthase B	PI0591	adenylosuccinate lyase	->->	538606	538734	129	24%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
258	PI0592	DNA mismatch repair protein	PI0593	NAD-specific glutamate dehydrogenase	->->	542672	543106	435	27.1%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
259	PI0594	possible rare lipoprotein A	PI0595	conserved hypothetical protein	->->	545218	545710	493	36.3%	0	0	0	+: 0/0/0 \| -: 0/3/0	1	0	0	0	Result
260	PI0598	hypothetical protein	PI0599	hypothetical protein	->->	547294	547515	222	32%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
261	PI0601	hypothetical protein	PI0602	conserved hypothetical protein	->->	549081	549238	158	27.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
262	PI0602	conserved hypothetical protein	PI0603	3-dehydroquinate synthase	->->	549692	549857	166	33.1%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
263	PI0609	conserved hypothetical protein	PI0610	conserved hypothetical protein	->->	557079	557542	464	33.2%	0	0	0	+: 0/4/0 \| -: 0/3/0	1	0	0	0	Result
264	PI0610	conserved hypothetical protein	PI0611	hypothetical protein	->->	559292	559526	235	24.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
265	PI0611	hypothetical protein	PI0612	lysyl-tRNA synthetase	->->	559962	560600	639	35.1%	0	0	0	+: 1/1/1 \| -: 1/3/0	1	0	0	0	Result
266	PI0615	hydrolase, haloacid dehalogenase-like family	PI0616	electron transfer flavoprotein, beta-subunit	->->	565447	565699	253	31.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
267	PI0618	acyl-CoA dehydrogenase family protein	PI0619	hypothetical protein	->->	569274	569503	230	30%	0	0	0	+: 0/5/0 \| -: 0/2/0	1	0	0	0	Result
268	PI0619	hypothetical protein	PI0620	hypothetical protein	->->	569633	569868	236	29.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
269	PI0620	hypothetical protein	PI0621	conserved hypothetical protein	->->	570691	570909	219	23.7%	0	0	0	+: 0/1/0 \| -: 1/3/0	1	0	0	0	Result
270	PI0622	hypothetical protein	PI0623	hypothetical protein	->->	572148	572306	159	27%	0	0	0	+: 1/2/0 \| -: 0/3/0	1	0	0	0	Result
271	PI0623	hypothetical protein	PI0625	possible membrane transport protein	->->	573141	573243	103	30.1%	0	0	0	+: 0/4/0 \| -: 0/2/0	1	0	0	0	Result
272	PI0631	50S ribosomal protein L25/general stress protein	PI0632	NusB family protein (N utilization substance protein B)	->->	578461	578615	155	35.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
274	PI0638	hypothetical protein	PI0639	small heat shock protein	->->	582463	582817	355	29.3%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
275	PI0639	small heat shock protein	PI0640	conserved hypothetical protein	->->	583226	583428	203	33.5%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
276	PI0641	conserved hypothetical protein	PI0642	thioredoxin family protein	->->	584621	584811	191	29.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
277	PI0642	thioredoxin family protein	PI0644	dnaJ protein	->->	585643	585843	201	26.4%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
278	PI0646	hypothetical protein	PI0647	potassium uptake protein	->->	587266	587644	379	31.4%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
279	PI0647	potassium uptake protein	PI0648	hypothetical protein	->->	589337	589587	251	30.3%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
280	PI0652	conserved hypothetical protein	PI0653	hypothetical protein	->->	595853	596185	333	36%	0	0	0	+: 0/1/0 \| -: 0/0/0	20	0	0	0	Result
281	PI0653	hypothetical protein	PI0654	K+-dependent Na+/Ca+ exchanger related-protein	->->	596297	596422	126	43.7%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
282	PI0654	K+-dependent Na+/Ca+ exchanger related-protein	PI0655	Na+/H+ anitporter	->->	597284	597429	146	41.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
283	PI0655	Na+/H+ anitporter	PI0656	peptidase T (tripeptide aminopeptidase)	->->	599602	599972	371	42.9%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
284	PI0656	peptidase T (tripeptide aminopeptidase)	PI0657	conserved hypothetical protein	->->	601194	601318	125	20.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
285	PI0658	conserved hypothetical protein	PI0659	hypothetical protein	->->	603104	603342	239	34.7%	0	0	0	+: 0/2/0 \| -: 0/3/0	1	0	0	0	Result
286	PI0659	hypothetical protein	PI0660	conserved hypothetical protein	->->	603457	603577	121	34.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
287	PI0662	conserved hypothetical protein	PI0663	possible transcriptional regulator	->->	605274	606138	865	27.6%	0	0	0	+: 1/2/1 \| -: 0/1/0	1	0	0	0	Result
288	PI0663	possible transcriptional regulator	PI0664	dihydroorotate dehydrogenase, electron transfer subunit	->->	606604	607030	427	28.6%	0	0	0	+: 1/1/1 \| -: 0/0/0	1	0	0	0	Result
289	PI0664	dihydroorotate dehydrogenase, electron transfer subunit	PI0665	dihydroorotate dehydrogenase	->->	607880	608004	125	29.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
290	PI0665	dihydroorotate dehydrogenase	PI0666	chorismate synthase	->->	608860	609145	286	31.1%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
292	PI0673	hypothetical protein	PI0675	hypothetical protein	->->	612766	613786	1021	41.4%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
293	PI0676	hypothetical protein	PI0677	hypothetical protein	->->	614896	616652	1757	41%	0	0	24	+: 0/1/0 \| -: 0/3/0	1	0	0	0	Result
294	PI0680	hypothetical protein	PI0682	hypothetical protein	->->	618694	619111	418	33.7%	0	0	0	+: 0/2/0 \| -: 0/3/0	49	0	0	0	Result
295	PI0681	hypothetical protein	PI0683	hypothetical protein	->->	619317	619431	115	46.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
296	PI0684	coproporphyrinogen III oxidase	PI0685	elongation factor G	->->	620568	620987	420	37.1%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
297	PI0685	elongation factor G	PI0686	glycosyl transferase, group 2 family protein	->->	623109	623616	508	38.2%	0	0	0	+: 0/5/0 \| -: 0/5/0	1	0	0	0	Result
298	PI0689	hypothetical protein	PI0690	uracil permease	->->	625938	626164	227	31.3%	0	0	0	+: 0/3/0 \| -: 0/1/0	1	0	0	0	Result
299	PI0690	uracil permease	PI0692	iron compound ABC transporter, permease protein	->->	627377	627489	113	31.9%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
300	PI0693	periplasmic iron binding protein, ABC transporter	PI0694	Na+/dicarboxylate or sulfate symporter	->->	629673	629884	212	31.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
301	PI0694	Na+/dicarboxylate or sulfate symporter	PI0695	xanthine/uracil permease family protein	->->	631238	631552	315	36.2%	0	0	0	+: 0/2/0 \| -: 0/3/0	35	0	0	0	Result
302	PI0695	xanthine/uracil permease family protein	PI0696	NADH pyrophosphatase, MutT family hydrolase (NAD+ diphosphatase)	->->	632762	632880	119	34.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
303	PI0697	5'-nucleotidase family protein	PI0698	conserved hypothetical protein	->->	635401	635511	111	33.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
304	PI0699	conserved hypothetical protein	PI0700	UDP-glucose 4-epimerase	->->	637225	637438	214	29.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
305	PI0701	hypothetical protein	PI0702	conserved hypothetical protein; possible tetracenomycin C synthesis protein homolog	->->	638598	638779	182	33.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
306	PI0703	hypothetical protein	PI0704	conserved hypothetical protein	->->	640257	640386	130	32.3%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
310	PI0713	hypothetical protein	PI0714	conserved hypothetical protein	->->	650590	651484	895	32.7%	0	0	0	+: 1/2/1 \| -: 1/3/1	1	0	0	0	Result
311	PI0721	hypothetical protein	PI0723	conserved hypothetical protein	->->	655043	656182	1140	42.3%	0	3	1	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
312	PI0723	conserved hypothetical protein	PI0724	DNA polymerase III, delta subunit	->->	657440	657542	103	31.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
313	PI0724	DNA polymerase III, delta subunit	PI0725	hypothetical protein	->->	658662	658762	101	30.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
314	PI0725	hypothetical protein	PI0726	hypothetical protein	->->	658994	659181	188	31.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	2	0	0	0	Result
315	PI0730	hypothetical protein	PI0731	conserved hypothetical protein	->->	662227	662428	202	29.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
316	PI0732	conserved hypothetical protein	PI0733	membrane protein; predicted exporter	->->	664428	664528	101	49.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
317	PI0733	membrane protein; predicted exporter	PI0734	ABC transporter, ATP-binding / permease	->->	667019	667191	173	43.4%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
318	PI0734	ABC transporter, ATP-binding / permease	PI0735	ABC transporter, ATP-binding / permease	->->	668821	668932	112	42.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
319	PI0740	hypothetical protein	PI0742	hypothetical protein	->->	672426	672533	108	40.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
320	PI0743	hypothetical protein	PI0744	DNA primase/mobilizable transposon, excision protein	->->	673087	674310	1224	42.6%	0	0	65	+: 0/2/0 \| -: 1/0/0	3	1	972	1081	Result	tagtagaatgtgtagtatctccatatactactaactattgttgattatcaatcatttatattaaaatagtatgtagtaagaagaaagatggaaaagtttggaagggaaaa
321	PI0745	conserved hypothetical protein	PI0746	hypothetical protein	->->	675731	676110	380	43.2%	0	0	0	+: 0/1/0 \| -: 0/1/0	3	1	180	281	Result	ggtagcattgcaagacgtcagtttgtacccacaaactgcgcttgctctcctcgtttaattatcgggaggttagaccgtaatcactccgttctcatcggtcag
322	PI0749	hypothetical protein	PI0750	zinc protease	->->	677530	677885	356	34.8%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	1	67	178	Result	atcaaaaacgcttgttattcaaagcaaattattatctttgcagatagaataacaagcgttctttgttgatgcagaaatctgcgattgaaagtacttcgctcgtttccaaatc
323	PI0754	possible outer membrane receptor	PI0755	hypothetical protein	->->	686485	686830	346	33.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
324	PI0755	hypothetical protein	PI0756	50S ribosomal protein L7/L12	->->	686945	687285	341	31.7%	0	0	0	+: 1/1/0 \| -: 0/0/0	1	0	0	0	Result
325	PI0756	50S ribosomal protein L7/L12	PI0757	possible hemagglutinin/protease	->->	689041	689343	303	32%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
326	PI0758	hypothetical protein	PI0759	hypothetical protein	->->	690567	693902	3336	46.1%	0	0	5	+: 0/3/0 \| -: 1/0/0	1	0	0	0	Result
327	PI0759	hypothetical protein	PI0760	ATP-dependent RNA helicase, DEAD/DEAH box family	->->	694059	694225	167	34.7%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
328	PI0760	ATP-dependent RNA helicase, DEAD/DEAH box family	PI0761	hypothetical protein	->->	696050	696312	263	38.8%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
332	PI0767	possible TonB-dependent receptor	PI0768	conserved hypothetical protein; possible acetyltransferase	->->	704086	704211	126	29.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
333	PI0770	hypothetical protein	PI0771	conserved hypothetical protein	->->	706415	706663	249	35.3%	0	0	0	+: 0/2/0 \| -: 0/1/0	52	0	0	0	Result
334	PI0771	conserved hypothetical protein	PI0772	conserved hypothetical protein	->->	707168	707296	129	31.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
335	PI0774	phosphoserine aminotransferase (phosphoserine transaminase)	PI0775	ATP-independent RNA helicase	->->	710705	710913	209	23.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
336	PI0777	predicted TPR-repeat-containing protein	PI0778	hypothetical protein	->->	714535	714684	150	33.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
337	PI0779	predicted TPR-repeat-containing protein	PI0780	DNA gyrase, subunit A (DNA topoisomerase (ATP-hydrolyzing))	->->	715861	716041	181	29.3%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
338	PI0780	DNA gyrase, subunit A (DNA topoisomerase (ATP-hydrolyzing))	PI0781	UDP-glucose/GDP-mannose dehydrogenase family; probable UDP-glucose 6-dehydrogenase	->->	718574	719399	826	34.7%	0	0	0	+: 0/6/0 \| -: 0/2/0	57	0	0	0	Result
339	PI0787	glycosyltransferase	PI0788	3-methyladenine DNA glycosylase (DNA-3-methyladenine glycosylase I)	->->	725854	726291	438	37.2%	0	0	0	+: 0/3/0 \| -: 0/5/0	51	0	0	0	Result
340	PI0792	conserved hypothetical protein	PI0793	ABC transporter, permease protein	->->	729688	729893	206	31.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
341	PI0794	long-chain-fatty-acid--CoA ligase	PI0796	competence protein	->->	732926	733463	538	35.5%	0	0	0	+: 0/4/0 \| -: 0/3/0	48	0	0	0	Result
343	PI0797	tRNA pseudouridine synthase A (pseudouridylate synthase)	PI0798	malonyl CoA-acyl carrier protein transacylase	->->	735813	736150	338	27.5%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
344	PI0798	malonyl CoA-acyl carrier protein transacylase	PI0799	alpha-amylase family protein	->->	737036	737222	187	42.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
345	PI0800	alanyl-tRNA synthetase (alanine--tRNA ligase)	PI0801	hypothetical protein	->->	739392	739504	113	36.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
346	PI0803	DNA-damage-inducible protein F	PI0804	conserved hypothetical protein; possible membrane protein	->->	741232	742073	842	30.2%	0	0	0	+: 1/3/2 \| -: 0/5/0	1	0	0	0	Result
349	PI0810	hypothetical protein	PI0812	conserved hypothetical protein; possible ferredoxin	->->	747087	750324	3238	41.2%	0	0	11	+: 3/2/2 \| -: 3/3/6	1	0	0	0	Result
350	PI0814	conserved hypothetical protein	PI0815	hypothetical protein	->->	754487	754614	128	37.5%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
351	PI0815	hypothetical protein	PI0816	glycogen debranching enzyme	->->	754738	755069	332	28%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
352	PI0820	hypothetical protein	PI0821	conserved hypothetical protein	->->	760041	760202	162	33.3%	0	0	0	+: 0/3/0 \| -: 0/1/0	1	0	0	0	Result
353	PI0823	glyceraldehyde 3-phosphate dehydrogenase, type I	PI0824	large conductance mechanosensitive channel protein	->->	763199	763476	278	26.6%	0	0	0	+: 1/0/0 \| -: 2/0/0	1	0	0	0	Result
354	PI0829	nucleotidyl transferase family; possible mannose-1-phosphate guanyltransferase	PI0830	conserved hypothetical protein	->->	766600	766715	116	30.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
355	PI0831	hypothetical protein	PI0832	sigma-54-dependent transcriptional regulator	->->	768509	768973	465	35.5%	0	0	0	+: 0/1/0 \| -: 0/1/0	57	0	0	0	Result
359	PI0846	transcription regulator, CRP family	PI0847	thiamine biosynthesis lipoprotein, ApbE	->->	781070	781269	200	44.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
362	PI0851	hypothetical protein	PI0852	conserved hypothetical protein	->->	784585	784691	107	28%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
363	PI0852	conserved hypothetical protein	PI0853	glycosyl transferase, group 2 family protein	->->	785496	785654	159	30.8%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
364	PI0854	MiaB-like tRNA modifying enzyme	PI0855	hypothetical protein	->->	788060	789233	1174	33.8%	0	0	0	+: 2/4/5 \| -: 0/7/0	46	0	0	0	Result
365	PI0855	hypothetical protein	PI0856	hypothetical protein	->->	789606	789720	115	34.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
366	PI0856	hypothetical protein	PI0858	carbamyl phosphate synthase, large subunit	->->	789988	790232	245	27.3%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
369	PI0862	polysaccharide export outer membrane protein	PI0863	L-asparaginase I	->->	799183	799576	394	29.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
370	PI0864	dihydrodipicolinate synthase	PI0865	possible phosphoglycerol transferase	->->	801519	801776	258	23.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
371	PI0865	possible phosphoglycerol transferase	PI0866	hypothetical protein	->->	803745	803915	171	43.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
372	PI0869	possible exodeoxyribonuclease VII (small subunit)	PI0870	branched-chain amino acid aminotransferase	->->	805835	806072	238	34.9%	0	0	4	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
373	PI0872	hypothetical protein	PI0873	conserved hypothetical protein; possible permease	->->	807868	808107	240	37.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
374	PI0873	conserved hypothetical protein; possible permease	PI0874	conserved hypothetical protein	->->	809017	809117	101	27.7%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
375	PI0874	conserved hypothetical protein	PI0875	conserved hypothetical protein	->->	810342	810747	406	36.9%	0	0	0	+: 0/2/0 \| -: 0/3/0	50	0	0	0	Result
377	PI0879	hypothetical protein	PI0880	hypothetical protein	->->	814112	814477	366	30.9%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
379	PI0883	para-aminobenzoate synthase component I	PI0885	hypothetical protein	->->	817312	817419	108	36.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
380	PI0888	hypothetical protein	PI0889	pyruvate kinase	->->	818674	818897	224	45.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
381	PI0889	pyruvate kinase	PI0890	ribose 5-phosphate isomerase B	->->	820416	820556	141	32.6%	0	0	0	+: 0/2/0 \| -: 0/2/0	1	0	0	0	Result
382	PI0891	transketolase	PI0892	acyl-ACP thioesterase	->->	822966	823270	305	30.8%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
383	PI0892	acyl-ACP thioesterase	PI0893	outer membrane protein 41 precursor	->->	824000	824552	553	31.5%	0	0	0	+: 0/2/0 \| -: 0/2/0	49	0	0	0	Result
384	PI0893	outer membrane protein 41 precursor	PI0894	2-oxoglutarate oxidoreductase, gamma subunit (2-oxoglutarate-ferredoxin oxidoreductase)	->->	825723	825915	193	28%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
385	PI0900	signal recognition particle protein	PI0901	hypothetical protein	->->	831153	831367	215	25.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
386	PI0901	hypothetical protein	PI0902	hypothetical protein	->->	832268	832430	163	39.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
387	PI0902	hypothetical protein	PI0903	conserved hypothetical protein	->->	832641	832813	173	27.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
388	PI0904	conserved hypothetical protein	PI0905	hypothetical protein	->->	834356	834538	183	30.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
389	PI0905	hypothetical protein	PI0907	NAD-dependent DNA ligase	->->	834758	835026	269	36.8%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
391	PI0910	possible sodium hydrogen antiporter (Na+/H+ antiporter)	PI0911	tyrosine phenol-lyase	->->	839605	839895	291	26.5%	0	0	0	+: 1/1/0 \| -: 1/2/0	1	0	0	0	Result
394	PI0914	ATPase, AAA family	PI0915	hypothetical protein	->->	845053	845322	270	30.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
395	PI0916	hypothetical protein	PI0917	phosphoglycolate phosphatase	->->	845976	846510	535	31.8%	0	0	0	+: 1/4/0 \| -: 0/3/0	1	0	0	0	Result
396	PI0918	Fe-S oxidoreductase, family 2	PI0919	conserved hypothetical protein	->->	849297	849437	141	31.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
397	PI0922	conserved hypothetical protein	PI0923	6-phosphofructokinase	->->	853254	853455	202	20.8%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
398	PI0925	ribosomal protein L11 methyltransferase	PI0926	hypothetical protein	->->	856699	856963	265	33.6%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
399	PI0926	hypothetical protein	PI0927	transglutaminase-related protein	->->	857108	857422	315	30.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
400	PI0927	transglutaminase-related protein	PI0928	hypothetical protein	->->	859757	859990	234	37.2%	0	0	0	+: 1/1/1 \| -: 0/1/0	1	0	0	0	Result
401	PI0928	hypothetical protein	PI0929	copper homeostasis protein	->->	860333	860433	101	37.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
402	PI0930	alpha-L-fucosidase precursor	PI0931	hypothetical protein	->->	862473	862791	319	30.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
403	PI0931	hypothetical protein	PI0932	conserved hypothetical protein; possible hemin receptor	->->	863134	863993	860	48.4%	0	0	3	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
404	PI0932	conserved hypothetical protein; possible hemin receptor	PI0933	hypothetical protein	->->	865425	865839	415	35.4%	0	0	0	+: 0/3/0 \| -: 1/2/2	46	0	0	0	Result
405	PI0934	hypothetical protein	PI0935	collagenase, protease	->->	866193	866436	244	28.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
406	PI0938	hypothetical protein	PI0939	TonB-dependent outer membrane protein	->->	869602	870008	407	30.2%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
407	PI0939	TonB-dependent outer membrane protein	PI0940	ribonuclease G	->->	872502	872920	419	32.5%	0	0	0	+: 0/3/0 \| -: 0/4/0	2	0	0	0	Result
408	PI0942	DNA-binding protein HU	PI0944	hypothetical protein	->->	875040	875207	168	26.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
409	PI0943	conserved hypothetical protein	PI0945	sodium:solute symporter family protein	->->	876052	876388	337	34.4%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
410	PI0945	sodium:solute symporter family protein	PI0946	glutathione peroxidase	->->	877685	878112	428	34.1%	0	0	0	+: 0/4/0 \| -: 0/2/0	58	0	0	0	Result
411	PI0946	glutathione peroxidase	PI0947	conserved hypothetical protein	->->	878665	878915	251	28.3%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
412	PI0947	conserved hypothetical protein	PI0948	hypothetical protein	->->	880770	881219	450	30%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
413	PI0948	hypothetical protein	PI0949	endonuclease	->->	882039	882403	365	35.3%	0	0	0	+: 0/4/0 \| -: 0/2/0	46	0	0	0	Result
414	PI0949	endonuclease	PI0950	50S ribosomal protein L31	->->	883340	883466	127	37.8%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
415	PI0950	50S ribosomal protein L31	PI0952	conserved hypothetical protein	->->	883716	883857	142	30.3%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
416	PI0953	hypothetical protein	PI0954	hypothetical protein	->->	885451	885706	256	46.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
417	PI0956	conserved hypothetical protein	PI0957	conserved hypothetical protein	->->	888797	888928	132	20.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
418	PI0961	conserved hypothetical protein	PI0962	phosphoglycerate mutase	->->	892104	892240	137	23.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
419	PI0962	phosphoglycerate mutase	PI0963	hypothetical protein	->->	892763	893337	575	35.5%	0	0	0	+: 0/3/0 \| -: 0/3/0	64	0	0	0	Result
420	PI0966	possible glycosyl hydrolase	PI0967	conserved hypothetical protein	->->	895270	895563	294	40.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
421	PI0970	hypothetical protein	PI0971	glycine cleavage system T protein (aminomethyltransferase)	->->	897715	897986	272	31.6%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
422	PI0976	dihydrolipoamide dehydrogenase (dihydrolipoyl dehydrogenanse)	PI0977	riboflavin synthase, alpha subunit	->->	903793	904182	390	37.4%	0	0	0	+: 0/3/0 \| -: 0/2/0	1	0	0	0	Result
423	PI0977	riboflavin synthase, alpha subunit	PI0978	hypothetical protein	->->	904762	905006	245	29.4%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
424	PI0979	transcriptional regulator, tetR family	PI0980	conserved hypothetical protein	->->	905739	905842	104	40.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
425	PI0981	outer membrane protein, TonB dependent receptor	PI0982	hypothetical protein	->->	909451	909571	121	33.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
426	PI0982	hypothetical protein	PI0983	hypothetical protein	->->	909710	909889	180	27.8%	0	0	0	+: 0/2/0 \| -: 0/2/0	1	0	0	0	Result
427	PI0984	hypothetical protein	PI0985	aspartyl-tRNA synthetase	->->	910205	910313	109	47.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
428	PI0985	aspartyl-tRNA synthetase	PI0987	hypothetical protein	->->	911973	912119	147	25.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
429	PI0988	hypothetical protein	PI0989	mannose-1-phosphate guanylyltransferase	->->	912814	912972	159	31.4%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
430	PI0990	GDP-mannose 4,6-dehydratase	PI0991	conserved hypothetical protein	->->	915115	915448	334	39.2%	0	0	0	+: 0/2/0 \| -: 0/1/0	53	0	0	0	Result
431	PI0994	glutaminyl-tRNA synthetase	PI0996	hypothetical protein	->->	920270	920597	328	26.2%	0	0	0	+: 2/1/0 \| -: 0/0/0	1	0	0	0	Result
432	PI0995	hypothetical protein	PI0997	hypothetical protein	->->	920884	921114	231	26.8%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
433	PI0997	hypothetical protein	PI0999	hypothetical protein	->->	922354	922515	162	32.7%	0	0	0	+: 0/2/0 \| -: 0/2/0	1	0	0	0	Result
434	PI1003	conserved hypothetical protein	PI1004	conserved hypothetical protein	->->	925779	925959	181	32%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
435	PI1005	hypothetical protein	PI1006	conserved hypothetical protein	->->	926542	926743	202	32.7%	0	0	0	+: 2/0/0 \| -: 0/0/0	1	0	0	0	Result
436	PI1007	conserved hypothetical protein	PI1008	cytochrome c nitrite reductase, small subunit	->->	928632	928923	292	31.8%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
438	PI1011	cytochrome c biogenesis protein CycY	PI1012	DNA-binding protein, histone-like family	->->	933050	933187	138	23.2%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
439	PI1012	DNA-binding protein, histone-like family	PI1013	probable transcriptional regulator	->->	933605	933903	299	36.1%	0	0	0	+: 0/0/0 \| -: 1/2/0	1	0	0	0	Result
440	PI1013	probable transcriptional regulator	PI1014	prismane protein, hybrid-cluster protein	->->	934429	934665	237	32.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
441	PI1014	prismane protein, hybrid-cluster protein	PI1015	conserved hypothetical protein	->->	936193	936582	390	29.7%	0	0	9	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
442	PI1019	hypothetical protein	PI1020	hypothetical protein	->->	938473	938608	136	23.5%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
443	PI1020	hypothetical protein	PI1021	conserved hypothetical protein; possible methyltransferase	->->	938840	939124	285	30.5%	0	0	0	+: 0/2/0 \| -: 0/0/0	2	0	0	0	Result
444	PI1021	conserved hypothetical protein; possible methyltransferase	PI1022	hypothetical protein	->->	939695	940052	358	29.3%	0	0	0	+: 0/1/0 \| -: 0/3/0	1	0	0	0	Result
445	PI1025	tRNA modification GTPase	PI1026	uridine phosphorylase	->->	942293	942439	147	31.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
446	PI1027	hypothetical protein	PI1028	glutamate synthase, small subunit	->->	943460	943559	100	27%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
447	PI1028	glutamate synthase, small subunit	PI1029	seryl-tRNA synthetase	->->	945912	946077	166	25.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
448	PI1029	seryl-tRNA synthetase	PI1030	biotin carboxyl carrier protein	->->	947266	947985	720	34.6%	0	0	0	+: 1/3/0 \| -: 1/3/3	54	0	0	0	Result
449	PI1032	methylmalonyl-CoA decarboxylase, alpha subunit	PI1033	ATP-dependent RNA helicase, DEAD/DEAH box family	->->	950223	950436	214	31.3%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
450	PI1036	ATP-dependent Lon protease	PI1037	probable methyltransferase	->->	957058	957167	110	23.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
451	PI1040	8-amino-7-oxononanoate synthase	PI1041	hypothetical protein	->->	960263	960582	320	32.5%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
452	PI1041	hypothetical protein	PI1043	conserved hypothetical protein	->->	960736	960994	259	34.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
453	PI1044	excinuclease ABC, subunit A	PI1045	cytidine/deoxycytidylate deaminase family protein	->->	964700	965243	544	33.3%	0	0	0	+: 0/1/0 \| -: 0/1/0	51	0	0	0	Result
455	PI1050	conserved hypothetical protein	PI1051	hypothetical protein	->->	969759	970192	434	33.9%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
456	PI1051	hypothetical protein	PI1052	fructose-1,6-bisphosphatase	->->	970289	970631	343	30.9%	0	0	0	+: 0/3/0 \| -: 0/2/0	51	0	0	0	Result
457	PI1053	conserved hypothetical protein	PI1054	conserved hypothetical protein	->->	973699	973835	137	35.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
458	PI1056	cell-division ATP-binding protein	PI1057	hypothetical protein	->->	977161	977425	265	27.9%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
459	PI1057	hypothetical protein	PI1058	possible FHA domain protein	->->	977609	977716	108	33.3%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
460	PI1059	conserved hypothetical protein	PI1060	conserved hypothetical protein	->->	979235	979339	105	26.7%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
461	PI1062	TPR repeat protein	PI1063	excinuclease ABC, subunit B	->->	980841	981104	264	30.3%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
462	PI1064	hypothetical protein	PI1065	hypothetical protein	->->	983385	983521	137	23.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
463	PI1072	hypothetical protein	PI1073	hemogluttinin A-related protein (HagA)	->->	990564	990732	169	28.4%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
464	PI1073	hemogluttinin A-related protein (HagA)	PI1074	hypothetical protein	->->	993754	993854	101	22.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
465	PI1074	hypothetical protein	PI1075	pyruvate phosphate dikinase	->->	995508	995967	460	27.6%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
466	PI1075	pyruvate phosphate dikinase	PI1076	hypothetical protein	->->	998632	999032	401	26.7%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
467	PI1076	hypothetical protein	PI1077	hypothetical protein	->->	999126	999338	213	27.7%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
468	PI1079	conserved hypothetical protein	PI1080	conserved hypothetical protein; possible outer membrane lipoprotein	->->	1000216	1000403	188	21.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
469	PI1082	polypeptide deformylase	PI1083	TPR-repeat-containing protein	->->	1001983	1002114	132	40.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
470	PI1083	TPR-repeat-containing protein	PI1084	threonyl-tRNA synthetase	->->	1002649	1002803	155	25.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
474	PI1087	conserved hypothetical protein	PI1088	conserved hypothetical protein	->->	1011618	1011745	128	27.3%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
475	PI1088	conserved hypothetical protein	PI1089	conserved hypothetical protein	->->	1012913	1013014	102	25.5%	0	0	0	+: 0/3/0 \| -: 0/3/0	1	0	0	0	Result
476	PI1089	conserved hypothetical protein	PI1090	tRNA uracil 5-methyltransferase	->->	1014101	1014505	405	30.4%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
477	PI1090	tRNA uracil 5-methyltransferase	PI1091	transcriptional regulator, AsnC family	->->	1015841	1016319	479	33%	0	0	0	+: 2/1/1 \| -: 0/1/0	45	0	0	0	Result
478	PI1091	transcriptional regulator, AsnC family	PI1092	conserved hypothetical protein	->->	1016815	1016919	105	28.6%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
479	PI1093	conserved hypothetical protein	PI1094	recombination protein	->->	1019257	1019375	119	41.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
480	PI1099	low molecular weight protein-tyrosine-phosphatase	PI1100	conserved hypothetical protein; possible rhodanese-domain protein	->->	1023697	1024049	353	28.6%	0	0	0	+: 1/3/0 \| -: 0/2/0	2	0	0	0	Result
481	PI1100	conserved hypothetical protein; possible rhodanese-domain protein	PI1101	hypothetical protein	->->	1024452	1024736	285	27%	0	0	0	+: 1/1/1 \| -: 0/1/0	1	0	0	0	Result
482	PI1102	conserved hypothetical protein	PI1103	hypothetical protein	->->	1026308	1026686	379	33.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	3	0	0	0	Result
483	PI1103	hypothetical protein	PI1104	GDP-4-keto-6-deoxy-D-mannose-3,5-epimerase-4-redu ctase	->->	1027236	1027888	653	27.9%	0	0	0	+: 0/3/0 \| -: 1/2/0	1	0	0	0	Result
484	PI1105	hypothetical protein	PI1106	conserved hypothetical protein	->->	1030296	1030605	310	28.4%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
487	PI1112	glycosyltransferase	PI1113	conserved hypothetical protein	->->	1037702	1038020	319	22.6%	0	0	0	+: 2/0/0 \| -: 0/0/0	1	0	0	0	Result
488	PI1113	conserved hypothetical protein	PI1115	conserved hypothetical protein	->->	1039206	1039383	178	25.8%	0	0	0	+: 0/3/0 \| -: 0/1/0	1	0	0	0	Result
489	PI1117	glycosyl transferase, family 2	PI1118	glycosyl transferases, group 1	->->	1042340	1042635	296	31.8%	0	0	0	+: 0/0/0 \| -: 1/2/2	10	0	0	0	Result
490	PI1123	conserved hypothetical protein	PI1124	possible nucleoside-diphosphate sugar epimerase	->->	1049258	1049663	406	27.3%	0	0	0	+: 4/2/4 \| -: 0/2/0	1	0	0	0	Result
491	PI1125	hypothetical protein	PI1126	methionyl-tRNA formyltransferase	->->	1051577	1051692	116	15.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
492	PI1128	probable yrdC domain protein, translation factor (SUA5)	PI1129	hypothetical protein	->->	1055116	1055516	401	31.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
493	PI1129	hypothetical protein	PI1130	probable glucose/galactose transporter	->->	1055664	1055805	142	31%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
494	PI1130	probable glucose/galactose transporter	PI1131	folylpolyglutamate synthase	->->	1057117	1057263	147	26.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
495	PI1136	conserved hypothetical protein	PI1137	hypothetical protein	->->	1062602	1063109	508	39.8%	0	0	0	+: 1/5/1 \| -: 0/0/0	1	0	0	0	Result
496	PI1138	hypothetical protein	PI1139	endopeptidase, endothelin-converting enzyme	->->	1064874	1065355	482	29.5%	0	0	0	+: 0/1/0 \| -: 1/1/0	1	0	0	0	Result
497	PI1139	endopeptidase, endothelin-converting enzyme	PI1140	ABC transporter, ATP-binding protein	->->	1067387	1067512	126	23.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
498	PI1140	ABC transporter, ATP-binding protein	PI1141	hypothetical protein	->->	1069478	1069602	125	35.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
499	PI1141	hypothetical protein	PI1143	hypothetical protein	->->	1069774	1069919	146	34.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
500	PI1145	50S ribosomal protein L35	PI1146	translation initiation factor IF3	->->	1072855	1072969	115	33%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
501	PI1146	translation initiation factor IF3	PI1147	conserved hypothetical protein	->->	1073564	1073821	258	31.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
502	PI1147	conserved hypothetical protein	PI1148	50S ribosomal protein L9	->->	1074830	1074993	164	32.9%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
503	PI1153	histidine kinase sensor protein	PI1154	conserved hypothetical protein; possible periplasmic solute-binding protein	->->	1078699	1079112	414	28%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
504	PI1155	hypothetical protein	PI1156	possible glycerate kinase family protein	->->	1080413	1080722	310	30.3%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
505	PI1160	possible phosphatidylinositol-4-phosphate 5-kinase	PI1161	conserved hypothetical protein	->->	1085955	1086080	126	28.6%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
506	PI1165	hypothetical protein	PI1167	hypothetical protein	->->	1089697	1089827	131	26%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
507	PI1168	hypothetical protein	PI1169	hypothetical protein	->->	1089983	1090110	128	30.5%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
508	PI1172	sensor histidine kinase	PI1173	transcription regulatory protein, LacI family	->->	1094975	1095190	216	26.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
509	PI1174	hypothetical protein	PI1175	conserved hypothetical protein	->->	1097103	1097511	409	36.2%	0	0	0	+: 1/3/0 \| -: 0/4/0	51	0	0	0	Result
510	PI1176	endonuclease III	PI1177	hypothtical protein	->->	1098880	1098995	116	27.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
511	PI1177	hypothtical protein	PI1178	histidyl-tRNA synthetase	->->	1099215	1099388	174	37.9%	0	0	0	+: 1/3/0 \| -: 1/2/0	1	0	0	0	Result
515	PI1182	hypothetical protein	PI1183	conserved hypothetical protein	->->	1104432	1104581	150	35.3%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
516	PI1190	conserved hypothetical protein	PI1191	phosphoribosyl pyrophosphate synthetase	->->	1109380	1109603	224	27.2%	0	0	0	+: 0/2/0 \| -: 0/3/0	1	0	0	0	Result
517	PI1191	phosphoribosyl pyrophosphate synthetase	PI1193	conserved hypothetical protein	->->	1110438	1110575	138	33.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
518	PI1192	carboxynorspermidine decarboxylase	PI1194	DnaJ protein (Hsp-40)	->->	1112414	1112533	120	28.3%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
519	PI1194	DnaJ protein (Hsp-40)	PI1195	hypothetical protein	->->	1113185	1113310	126	34.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
520	PI1197	pseudouridylate synthetase	PI1198	acetyltransferase	->->	1114550	1114721	172	30.2%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
521	PI1201	peptidyl-arginine deiminase	PI1202	UvrD/REP helicase	->->	1117896	1118278	383	27.2%	0	0	0	+: 1/2/0 \| -: 0/0/0	1	0	0	0	Result
522	PI1204	hypothetical protein	PI1206	ATP-dependent DNA helicase, UvrD/PcrA/Rep family	->->	1124696	1124837	142	37.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
523	PI1208	monofunctional biosynthetic peptidoglycan transglycosylase	PI1209	phosphate starvation-inducible protein, phoH family	->->	1127940	1128098	159	28.3%	0	0	0	+: 1/1/0 \| -: 0/0/0	1	0	0	0	Result
525	PI1214	peptide chain release factor 1	PI1215	orotidine 5'-phosphate decarboxylase	->->	1133881	1134106	226	30.1%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
526	PI1222	hypothetical protein	PI1223	conserved hypothetical protein	->->	1143439	1143676	238	41.2%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
527	PI1223	conserved hypothetical protein	PI1224	sensor histidine kinase and response regulator	->->	1144520	1144713	194	45.4%	0	0	0	+: 0/3/0 \| -: 0/1/0	1	0	0	0	Result
528	PI1224	sensor histidine kinase and response regulator	PI1225	hypothetical protein	->->	1147618	1147897	280	33.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
529	PI1226	hypothetical protein	PI1227	conserved hypothetical protein; possible DNA-binding protein, histone-like family	->->	1148324	1148587	264	44.3%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
530	PI1227	conserved hypothetical protein; possible DNA-binding protein, histone-like family	PI1228	conserved hypothetical protein	->->	1149035	1149184	150	50%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
531	PI1229	conserved hypothetical protein	PI1230	probable metallo-beta-lactamase family protein	->->	1151730	1151979	250	36.4%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
532	PI1230	probable metallo-beta-lactamase family protein	PI1232	conserved hypothetical protein	->->	1152790	1152896	107	44.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
533	PI1233	conserved hypothetical protein; possible MazG family protein	PI1234	valyl-tRNA synthetase (valine--tRNA ligase)	->->	1154308	1154498	191	29.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
534	PI1234	valyl-tRNA synthetase (valine--tRNA ligase)	PI1235	60 kDa chaperonin, groEL, cpn60	->->	1157190	1157325	136	29.4%	0	0	0	+: 1/1/0 \| -: 0/1/0	1	0	0	0	Result
536	PI1236	10 kDa chaperonin, cpn10, GroES	PI1237	ATP-dependent DNA helicase	->->	1159341	1159827	487	34.9%	0	0	0	+: 0/2/0 \| -: 1/2/1	1	0	0	0	Result
538	PI1238	single-strand DNA-specific exonuclease	PI1239	possible peptidase C1-like family (aminopeptidase C)	->->	1163499	1163637	139	24.5%	0	0	0	+: 1/1/1 \| -: 0/1/0	1	0	0	0	Result
539	PI1240	probable Xaa-Pro dipeptidase (aminopeptidase P)	PI1241	probable phosphoesterase	->->	1166333	1166504	172	32.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
540	PI1242	tRNA (guanine-N1-)-methyltransferase	PI1243	conserved hypothetical protein	->->	1167941	1168073	133	26.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
541	PI1243	conserved hypothetical protein	PI1244	hypothetical protein	->->	1168821	1168942	122	39.3%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
542	PI1244	hypothetical protein	PI1246	conserved hypothetical protein; possible lipoprotein	->->	1169237	1169531	295	40.7%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
543	PI1245	hypothetical protein	PI1247	conserved hypothetical protein	->->	1171553	1171769	217	34.1%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
544	PI1247	conserved hypothetical protein	PI1248	conserved hypothetical protein	->->	1173243	1173353	111	22.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
545	PI1252	hypothetical protein	PI1253	hypothetical protein	->->	1175501	1175655	155	30.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
546	PI1254	probable glucokinase	PI1255	conserved hypothetical protein	->->	1176707	1176848	142	26.8%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
550	PI1266	hypothetical protein	PI1267	probable integrase	->->	1185998	1186244	247	39.3%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
553	PI1271	transcriptional regulator, AraC/XylS family	PI1272	possible transcriptional regulator	->->	1191345	1191841	497	28.2%	0	0	0	+: 1/1/0 \| -: 2/1/2	45	0	0	0	Result
554	PI1279	RNA polymerase sigma factor/ECF subfamily (sigma-70)	PI1280	conserved hypothetical protein	->->	1195952	1196104	153	24.2%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
555	PI1280	conserved hypothetical protein	PI1281	hypothetical protein	->->	1196615	1196784	170	23.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
556	PI1281	hypothetical protein	PI1282	ATP synthase, gamma subunit (F0F1-ATPase, gamma subunit)	->->	1197052	1197357	306	28.1%	0	0	0	+: 0/1/0 \| -: 1/4/1	1	0	0	0	Result
557	PI1284	ATP synthase, delta subunit	PI1285	ATP synthase, B subunit	->->	1200384	1200487	104	39.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
558	PI1290	ATP synthase, beta subunit	PI1291	6-phosphofructokinase	->->	1204636	1204791	156	30.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
559	PI1291	6-phosphofructokinase	PI1292	conserved hypothetical protein	->->	1205767	1206245	479	30.1%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
562	PI1300	probable glycosyltransferase	PI1302	hypothetical protein	->->	1214431	1214936	506	31.2%	0	0	0	+: 1/1/0 \| -: 1/1/1	1	0	0	0	Result
564	PI1305	conserved hypothetical protein	PI1306	dipeptidyl peptidase IV	->->	1219793	1220403	611	30%	0	0	0	+: 0/2/0 \| -: 0/4/0	1	0	0	0	Result
565	PI1306	dipeptidyl peptidase IV	PI1307	possible Fe-S oxidoreductase	->->	1222513	1222656	144	30.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
566	PI1308	hypothetical protein	PI1309	excinuclease ABC, A subunit	->->	1223778	1223890	113	34.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
567	PI1312	conserved hypothetical protein	PI1313	possible POT family (proton-dependent oligopeptide transport family)	->->	1229738	1229849	112	32.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
568	PI1314	hypothetical protein	PI1315	conserved hypothetical protein	->->	1231484	1231915	432	29.2%	0	0	0	+: 0/2/0 \| -: 0/2/0	1	0	0	0	Result
569	PI1316	conserved hypothetical protein	PI1317	surface antigen BspA	->->	1232716	1232977	262	24.8%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
570	PI1318	hypothetical protein	PI1319	possible OmpA , outer membrane protein-related protein	->->	1235616	1235794	179	26.8%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
571	PI1319	possible OmpA , outer membrane protein-related protein	PI1320	conserved hypothetical protein	->->	1239053	1239170	118	22%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
572	PI1322	nucleoside permease	PI1323	conserved hypothetical protein	->->	1241697	1241949	253	28.5%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
573	PI1323	conserved hypothetical protein	PI1324	conserved hypothetical protein	->->	1242544	1242659	116	26.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
574	PI1324	conserved hypothetical protein	PI1325	conserved hypothetical protein	->->	1243086	1243554	469	30.3%	0	0	0	+: 1/3/0 \| -: 1/1/0	31	0	0	0	Result
575	PI1325	conserved hypothetical protein	PI1326	Na+-driven multidrug efflux pump	->->	1244155	1244321	167	23.4%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
576	PI1332	aminotransferase, possible pyridoxal-phosphate-dependent aminotransferase	PI1333	conserved hypothetical protein	->->	1250627	1250916	290	32.1%	0	0	0	+: 0/4/0 \| -: 0/1/0	59	0	0	0	Result
577	PI1333	conserved hypothetical protein	PI1334	ferrodoxin	->->	1251433	1251543	111	36.9%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
578	PI1335	Fe-S oxidoreductase	PI1336	dTDP-4-dehydrorhamnose 3,5-epimerase	->->	1253630	1253978	349	26.4%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
579	PI1344	hypothetical protein	PI1345	conserved hypothetical protein; possible TPR-repeat-containing protein	->->	1259165	1259324	160	27.5%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
580	PI1345	conserved hypothetical protein; possible TPR-repeat-containing protein	PI1346	hypothetical protein	->->	1260741	1260953	213	31%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
581	PI1346	hypothetical protein	PI1347	DNA damage-inducible protein	->->	1261089	1261269	181	31.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
582	PI1347	DNA damage-inducible protein	PI1348	glycosyltransferase	->->	1262239	1262528	290	36.2%	0	0	3	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
583	PI1349	polysaccharide export protein	PI1350	conserved hypothetical protein	->->	1265781	1265956	176	25%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
584	PI1356	hypothetical protein	PI1357	glycosyltransferase	->->	1273401	1273566	166	31.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
585	PI1357	glycosyltransferase	PI1358	phospho-N-acetylmuramoyl-pentapeptide-transferase	->->	1274320	1274466	147	23.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
586	PI1360	conserved hypothetical protein	PI1361	CTP synthase (UTP-ammonia lyase)	->->	1277656	1278384	729	31.6%	0	0	0	+: 0/1/0 \| -: 0/1/0	47	0	0	0	Result
587	PI1365	conserved hypothetical protein; probable transmembrane protein	PI1366	conserved hypothetical protein; possible hydrolase, HAD superfamily	->->	1285736	1286185	450	29.8%	0	0	0	+: 0/2/0 \| -: 0/5/0	2	0	0	0	Result
588	PI1366	conserved hypothetical protein; possible hydrolase, HAD superfamily	PI1367	redox-sensitive transcriptional activator, OxyR	->->	1286708	1286999	292	36.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
589	PI1367	redox-sensitive transcriptional activator, OxyR	PI1368	enolase (phosphopyruvate hydratase)	->->	1287924	1288262	339	31.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
590	PI1368	enolase (phosphopyruvate hydratase)	PI1369	alkyl hydroperoxide reductase, subunit C	->->	1289568	1289919	352	27.3%	0	0	0	+: 1/2/2 \| -: 0/3/0	1	0	0	0	Result
591	PI1369	alkyl hydroperoxide reductase, subunit C	PI1370	alkyl hydroperoxide reductase, subunit F	->->	1290484	1290679	196	34.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
592	PI1370	alkyl hydroperoxide reductase, subunit F	PI1371	hypothetical protein	->->	1292237	1292498	262	32.1%	0	0	0	+: 1/3/0 \| -: 0/1/0	13	0	0	0	Result
595	PI1372	thiamine monophosphate kinase	PI1373	purine nucleoside phosphorylase (PNP)	->->	1294032	1294170	139	35.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
596	PI1374	tetraacyldisaccharide 4'-kinase	PI1375	protease IV family, clan S (peptidase family S49)	->->	1295981	1296102	122	37.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
597	PI1375	protease IV family, clan S (peptidase family S49)	PI1376	outer membrane protein	->->	1297675	1298104	430	30.5%	0	0	0	+: 0/0/0 \| -: 1/4/1	1	0	0	0	Result
598	PI1378	GTP-binding protein lepA	PI1379	hypothetical protein	->->	1301712	1301956	245	34.7%	0	1	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
599	PI1379	hypothetical protein	PI1380	conserved hypothetical protein	->->	1302353	1302726	374	34.5%	0	0	0	+: 0/1/0 \| -: 0/2/0	51	0	0	0	Result
600	PI1383	biopolymer transport protein tolQ related	PI1384	conserved hypothetical protein	->->	1305101	1305310	210	32.4%	0	0	0	+: 1/1/0 \| -: 0/0/0	1	0	0	0	Result
601	PI1384	conserved hypothetical protein	PI1385	3-deoxy-d-manno-octulosonic acid 8-phosphate synthase (DAHP synthase, Class I)	->->	1306235	1306363	129	27.9%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
602	PI1389	transcriptional regulator, LuxR family	PI1390	hypothetical protein	->->	1310893	1311293	401	35.4%	0	0	3	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
603	PI1390	hypothetical protein	PI1391	hypothetical protein	->->	1311390	1311559	170	30%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
604	PI1391	hypothetical protein	PI1392	hypothetical protein	->->	1311755	1312040	286	36.4%	0	0	0	+: 0/1/0 \| -: 0/1/0	44	0	0	0	Result
605	PI1392	hypothetical protein	PI1393	aldose 1-epimerase	->->	1312809	1312929	121	28.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
606	PI1393	aldose 1-epimerase	PI1394	glutamate formiminotransferase	->->	1313884	1314191	308	27.3%	0	0	0	+: 2/1/0 \| -: 0/0/0	1	0	0	0	Result
608	PI1399	hypothetical protein	PI1400	hypothetical protein	->->	1320905	1321530	626	33.1%	0	0	0	+: 0/1/0 \| -: 0/7/0	1	0	0	0	Result
609	PI1400	hypothetical protein	PI1401	TPR-repeat-containing protein	->->	1321969	1322166	198	28.8%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
610	PI1401	TPR-repeat-containing protein	PI1402	3-deoxy-7-phosphoheptulonate synthase	->->	1322944	1323074	131	35.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
611	PI1404	hypothetical protein	PI1405	conserved hypothetical protein	->->	1326060	1326174	115	30.4%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
612	PI1408	glucose-1-phosphate thymidylyltransferase	PI1409	conserved hypothetical protein	->->	1329822	1330988	1167	32.3%	0	4	0	+: 0/2/0 \| -: 1/2/0	39	0	0	0	Result
613	PI1417	MATE efflux family protein (Na+-driven multidrug efflux pump)	PI1418	UDP-N-acetylglucosamine 2-epimerase	->->	1337562	1338124	563	30.4%	0	0	0	+: 0/3/0 \| -: 2/1/0	1	0	0	0	Result
614	PI1420	probable membrane protein	PI1422	hypothetical protein	->->	1340713	1340829	117	31.6%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
615	PI1423	hypothetical protein	PI1424	probable peptidase family M48	->->	1343072	1343288	217	26.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
616	PI1424	probable peptidase family M48	PI1425	conserved hypothetical protein	->->	1344105	1344627	523	33.8%	0	0	0	+: 0/1/0 \| -: 1/5/0	53	0	0	0	Result
617	PI1425	conserved hypothetical protein	PI1426	flavodoxin	->->	1344910	1345020	111	31.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
618	PI1426	flavodoxin	PI1427	nicotinate-nucleotide pyrophosphorylase	->->	1345507	1345847	341	31.4%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
619	PI1429	L-aspartate oxidase	PI1430	subtilisin-like serine proteinase	->->	1349386	1349737	352	33.2%	0	0	0	+: 0/3/0 \| -: 0/1/0	1	0	0	0	Result
620	PI1430	subtilisin-like serine proteinase	PI1431	conserved hypothetical protein	->->	1351835	1352218	384	35.2%	0	0	1	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
621	PI1431	conserved hypothetical protein	PI1432	DNA methylase	->->	1352870	1353150	281	32.7%	0	0	0	+: 0/3/0 \| -: 1/2/0	1	0	0	0	Result
622	PI1435	D12 class N6 adenine-specific DNA methyltransferase	PI1436	hypothetical protein	->->	1355674	1356100	427	26.2%	0	0	0	+: 0/0/0 \| -: 1/2/0	1	0	0	0	Result
623	PI1439	hypothetical protein	PI1441	hypothetical protein	->->	1360407	1363268	2862	42.4%	0	0	44	+: 1/2/0 \| -: 1/0/0	1	0	0	0	Result
624	PI1441	hypothetical protein	PI1442	radical-activating enzyme (pyruvate-formate lyase-activating enzyme)	->->	1363734	1364088	355	37.5%	0	0	0	+: 0/1/0 \| -: 0/1/0	32	0	0	0	Result
625	PI1443	conserved hypotehtical protein; possible tonB-dependent outer membrane receptor	PI1444	protease ClpB	->->	1365405	1365611	207	33.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
626	PI1444	protease ClpB	PI1445	hypothetical protein	->->	1368198	1368542	345	33.3%	0	0	0	+: 0/1/0 \| -: 0/3/0	1	0	0	0	Result
627	PI1446	conserved hypothetical protein	PI1447	probable OPT oligopeptide transporter protein	->->	1369893	1370111	219	31.5%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
628	PI1448	hypothetical protein	PI1449	conserved hypothetical protein	->->	1371893	1372157	265	39.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
629	PI1449	conserved hypothetical protein	PI1450	hypothetical protein	->->	1372575	1372822	248	33.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
630	PI1450	hypothetical protein	PI1451	outer membrane receptor proteins, tonB dependent (possibly iron transport related)	->->	1372952	1373070	119	36.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
631	PI1454	chromosomal replication initiator protein, DnaA	PI1455	hypothetical protein	->->	1378202	1378402	201	28.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
632	PI1461	conserved hypothetical protein	PI1462	hypothetical protein	->->	1385134	1385233	100	28%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
633	PI1463	fumarate hydratase, class I	PI1464	zinc protease	->->	1387130	1387280	151	31.1%	0	0	0	+: 0/1/0 \| -: 1/1/0	1	0	0	0	Result
634	PI1466	GTP-binding protein, possible GTP1/OBG family	PI1467	conserved hypothetical protein	->->	1393194	1393642	449	36.5%	0	0	18	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
635	PI1472	hypothetical protein	PI1474	conserved hypothetical protein	->->	1395940	1396066	127	27.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
636	PI1474	conserved hypothetical protein	PI1475	possible short chain dehydrogenase	->->	1397030	1397281	252	42.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
637	PI1476	acyl-CoA synthase/O-succinylbenzoic acid-CoA ligase	PI1477	TonB-dependent outer membrane receptor	->->	1399465	1399873	409	30.3%	0	0	0	+: 0/4/0 \| -: 0/6/0	3	0	0	0	Result
638	PI1485	hypothetical protein	PI1486	alginate O-acetylation protein	->->	1405400	1405646	247	38.5%	0	0	0	+: 0/1/0 \| -: 0/1/0	55	0	0	0	Result
639	PI1490	GTP cyclohydrolase I	PI1491	conserved hypothetical protein	->->	1409188	1409549	362	38.4%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
640	PI1493	conserved hypothetical protein	PI1494	conserved hypothetical protein	->->	1412879	1413185	307	32.2%	0	0	0	+: 2/0/0 \| -: 0/0/0	1	0	0	0	Result
641	PI1494	conserved hypothetical protein	PI1495	conserved hypothetical protein	->->	1414029	1414571	543	39.4%	0	0	0	+: 0/3/0 \| -: 0/1/0	49	0	0	0	Result
642	PI1495	conserved hypothetical protein	PI1496	nucleoside phosphorylase	->->	1417083	1417255	173	37.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
643	PI1497	LuxS protein, autoinducer AI-2 production protein	PI1498	probable membrane associated lipoprotein	->->	1418380	1418566	187	32.1%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
644	PI1499	hypothetical protein	PI1500	hypothetical protein	->->	1420241	1420765	525	35.6%	0	0	0	+: 0/3/0 \| -: 0/2/0	46	0	0	0	Result
645	PI1500	hypothetical protein	PI1501	GTP-binding elongation factor family protein TypA/BipA	->->	1421453	1421563	111	28.8%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
646	PI1501	GTP-binding elongation factor family protein TypA/BipA	PI1502	hypothetical protein	->->	1423307	1423406	100	39%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
647	PI1503	30S ribosomal protein S15	PI1504	non-specific DNA-binding protein	->->	1423841	1424457	617	33.7%	0	0	0	+: 0/1/0 \| -: 1/2/1	58	0	0	0	Result
648	PI1510	cell division protein	PI1512	hypothetical protein	->->	1429335	1429668	334	37.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
649	PI1511	hypothetical protein	PI1513	conserved hypothetical protein	->->	1430059	1430291	233	27.9%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
650	PI1513	conserved hypothetical protein	PI1514	tRNA nucleotidyltransferase/poly(A) polymerase	->->	1432563	1432683	121	30.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
651	PI1514	tRNA nucleotidyltransferase/poly(A) polymerase	PI1515	hypothetical protein	->->	1434133	1434240	108	35.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
652	PI1515	hypothetical protein	PI1516	multidrug resistance protein; HlyD family secretion protein	->->	1434385	1434520	136	38.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
654	PI1521	hypothetical protein	PI1522	thioredoxin M	->->	1441522	1441785	264	36%	0	0	0	+: 0/1/0 \| -: 0/0/0	5	0	0	0	Result
655	PI1523	DNA polymerase III, alpha subunit	PI1524	phosphatidylserine decarboxylase	->->	1445951	1446063	113	24.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
657	PI1526	hypothetical protein	PI1527	immunoreactive 46 kDa antigen PG99	->->	1447756	1448329	574	32.2%	0	0	0	+: 0/3/0 \| -: 0/3/0	1	0	0	0	Result
658	PI1527	immunoreactive 46 kDa antigen PG99	PI1528	hypothetical protein	->->	1449581	1449824	244	39.8%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
659	PI1529	cytosine/adenosine deaminase	PI1530	conserved hypothetical protein	->->	1450438	1450578	141	29.8%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
664	PI1543	hypothetical protein	PI1544	hypothetical protein	->->	1463342	1463646	305	39.7%	0	0	0	+: 0/0/0 \| -: 0/1/0	2	1	1	281	Result	ataagtttccttgaaagtttatcattgtagatgattcattgtttcttaattcctgaatactgaccgatgagaacggagtgattacggtcttatctccccgacaatcgaacgaggggagcaagagcagtttgtgggtacaaactgacgtcttgcaatgctaccgaacaaattatttacgcttaaaacgttttatagcctaaaaatgaattccgtgcattctatgactaactgcgttcgtggcattctcacagagaactaagccgaagaagaaaaggtagacc
665	PI1546	mobilizable transposon, excision protein	PI1548	conserved hypothetical protein	->->	1465160	1465440	281	28.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	3	0	0	0	Result
666	PI1547	hypothetical protein	PI1549	conserved hypothetical protein	->->	1466287	1467160	874	42.1%	0	0	1	+: 1/2/2 \| -: 0/3/0	1	0	0	0	Result
667	PI1550	conserved hypothetical protein	PI1551	HesA/MoeB/ThiF family protein	->->	1467764	1467926	163	27%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
669	PI1553	hypothetical protein	PI1554	hypothetical protein	->->	1470231	1470414	184	27.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
670	PI1554	hypothetical protein	PI1555	conserved hypothetical protein	->->	1470544	1470716	173	28.9%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
671	PI1558	conserved hypothetical protein	PI1559	hypothetical protein	->->	1476167	1476645	479	34%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
672	PI1560	integrase	PI1561	conserved hypothetical protein; possible lipoprotein	->->	1478326	1478856	531	36%	0	0	0	+: 1/1/0 \| -: 0/0/0	2	0	0	0	Result
673	PI1562	methyltransferase	PI1563	thiol:disulfide interchange protein dsbD	->->	1480510	1480820	311	29.9%	0	0	0	+: 1/0/0 \| -: 1/1/1	1	0	0	0	Result
674	PI1563	thiol:disulfide interchange protein dsbD	PI1564	surface antigen BspA	->->	1482876	1483594	719	30.7%	0	0	0	+: 1/5/0 \| -: 1/4/4	60	0	0	0	Result
675	PI1565	conserved hypothetical protein; possible surface antigen	PI1566	predicted TPR-repeat-containing protein	->->	1487418	1487709	292	26%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
676	PI1567	hypothetical protein	PI1568	OmpA family protein	->->	1489582	1489723	142	35.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
677	PI1568	OmpA family protein	PI1569	hypothetical protein	->->	1491104	1492571	1468	34.1%	0	0	0	+: 1/1/0 \| -: 4/2/6	1	0	0	0	Result
678	PI1571	surface antigen BspA	PI1573	transcription-repair coupling factor	->->	1495841	1496568	728	32.4%	0	0	0	+: 0/1/0 \| -: 2/3/3	3	0	0	0	Result
679	PI1572	hypothetical protein	PI1574	conserved hypothetical protein	->->	1498276	1500464	2189	44.4%	0	1	17	+: 0/2/0 \| -: 0/2/0	1	0	0	0	Result
680	PI1575	LemA protein	PI1576	serine protease precursor	->->	1501913	1502311	399	30.6%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
681	PI1577	conserved hypothetical protein	PI1578	rod shape-determining protein	->->	1503940	1504327	388	35.8%	0	0	0	+: 0/1/0 \| -: 0/2/0	40	0	0	0	Result
682	PI1582	cell shape-determining protein	PI1583	phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR)/IMP cyclohydrolase (ATIC)	->->	1510518	1510669	152	30.9%	0	0	0	+: 0/1/0 \| -: 1/2/0	1	0	0	0	Result
683	PI1583	phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR)/IMP cyclohydrolase (ATIC)	PI1584	A/G-specific adenine glycosylase	->->	1511261	1512037	777	30.8%	0	0	0	+: 0/1/0 \| -: 0/1/0	59	0	0	0	Result
684	PI1585	ampG permease	PI1586	possible HesA/MoeB/ThiF family protein	->->	1514321	1514511	191	34.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
685	PI1586	possible HesA/MoeB/ThiF family protein	PI1587	conserved hypothetical protein; possible permease	->->	1515244	1515423	180	27.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
686	PI1587	conserved hypothetical protein; possible permease	PI1588	DNA polymerase III, epsilon chain	->->	1516327	1516441	115	33%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
687	PI1588	DNA polymerase III, epsilon chain	PI1589	conserved hypothetical protein	->->	1516991	1517497	507	32.3%	0	0	0	+: 0/2/0 \| -: 0/3/0	38	0	0	0	Result
688	PI1589	conserved hypothetical protein	PI1590	transcriptional regulator	->->	1517903	1518192	290	27.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
691	PI1593	3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II	PI1594	MotA/TolQ/ExbB proton channel	->->	1523186	1523667	482	25.3%	0	0	0	+: 0/2/0 \| -: 0/4/0	1	0	0	0	Result
692	PI1598	phosphate ABC transporter, phosphate-binding component	PI1599	predicted TPR-repeat-containing protein	->->	1527743	1527856	114	21.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
693	PI1599	predicted TPR-repeat-containing protein	PI1600	conserved hypothetical protein	->->	1529237	1529408	172	33.7%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
694	PI1601	hypothetical protein	PI1602	conserved hypothetical protein; possible internalin-related protein	->->	1530515	1531164	650	33.4%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
695	PI1604	hypothetical protein	PI1605	conserved hypothetical protein	->->	1534256	1534383	128	37.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
696	PI1610	Na+/H+ anti-porter	PI1611	aspartate-semialdehyde dehydrogenase	->->	1538063	1538295	233	38.6%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
697	PI1612	hypothetical protein	PI1613	hypothetical protein	->->	1540006	1540117	112	30.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
698	PI1614	hypothetical protein	PI1615	hypothetical protein	->->	1541469	1541601	133	28.6%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
699	PI1615	hypothetical protein	PI1616	hypothetical protein	->->	1542055	1542312	258	33.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
700	PI1617	hypothetical protein	PI1619	two-component system response regulator	->->	1543225	1543349	125	43.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
701	PI1620	two-component system sensor protein	PI1621	hypothetical protein	->->	1545221	1545563	343	32.7%	0	0	0	+: 1/1/0 \| -: 0/1/0	1	0	0	0	Result
702	PI1621	hypothetical protein	PI1622	hypothetical protein	->->	1545801	1546921	1121	38.5%	0	0	1	+: 0/4/0 \| -: 0/3/0	2	0	0	0	Result
704	PI1629	hypothetical protein	PI1630	hypothetical protein	->->	1552027	1552266	240	43.3%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
705	PI1634	conserved hypothetical protein	PI1635	hypothetical protein	->->	1553880	1554087	208	51.4%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
706	PI1637	hypothetical protein	PI1638	conserved hypothetical protein	->->	1555345	1555476	132	43.9%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
707	PI1638	conserved hypothetical protein	PI1639	conserved hypothetical protein	->->	1556674	1556864	191	53.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
708	PI1651	hypothetical protein	PI1652	hypothetical protein	->->	1564573	1564794	222	47.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
709	PI1653	hypothetical protein	PI1654	hypothetical protein	->->	1565775	1567808	2034	43.7%	0	1	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
710	PI1654	hypothetical protein	PI1655	hypothetical protein	->->	1568019	1569818	1800	45.6%	0	0	0	+: 0/1/0 \| -: 1/3/0	1	0	0	0	Result
711	PI1655	hypothetical protein	PI1656	hypothetical protein	->->	1570278	1570381	104	37.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
712	PI1661	hypothetical protein	PI1662	hypothetical protein	->->	1576878	1577055	178	39.3%	0	0	0	+: 0/1/0 \| -: 1/0/0	2	0	0	0	Result
713	PI1665	thymidylate synthase	PI1666	conserved hypothetical protein	->->	1578865	1579370	506	32.8%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
715	PI1671	hypothetical protein	PI1672	conserved hypothetical protein; possible DNA-binding protein, histone-like family	->->	1586714	1587166	453	45.9%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
716	PI1672	conserved hypothetical protein; possible DNA-binding protein, histone-like family	PI1673	hypothetical protein	->->	1587590	1587857	268	25%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
717	PI1675	TonB-dependent outer membrane receptor	PI1676	phosphatidate cytidylyltransferase	->->	1590596	1591035	440	28.6%	0	0	0	+: 2/0/0 \| -: 3/3/4	1	0	0	0	Result
718	PI1677	cell division protein FtsH	PI1678	conserved hypothetical protein	->->	1593862	1594023	162	34%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
721	PI1679	hypothetical protein	PI1680	conserved hypothetical protein	->->	1595025	1595177	153	36.6%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
722	PI1680	conserved hypothetical protein	PI1681	Mg2+/Co2+ transporter	->->	1597053	1597265	213	29.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
723	PI1681	Mg2+/Co2+ transporter	PI1682	aminoacyl-histidine dipeptidase	->->	1598190	1598442	253	31.6%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
725	PI1685	GAF domain-containing protein	PI1687	ribosome recycling factor	->->	1602326	1602446	121	30.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
726	PI1688	possible GTPase	PI1689	conserved hypothetical protein	->->	1603964	1604449	486	34.8%	0	0	0	+: 0/1/0 \| -: 0/1/0	43	0	0	0	Result
727	PI1693	possible RmuC domain protein	PI1694	hypothetical protein	->->	1609619	1609856	238	33.6%	0	0	0	+: 0/2/0 \| -: 0/2/0	1	0	0	0	Result
729	PI1695	hypothetical protein	PI1696	conserved hypothetical protein	->->	1610371	1610683	313	21.4%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
730	PI1700	hypothetical protein	PI1701	sensor histidine kinase	->->	1619304	1619451	148	38.5%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
731	PI1701	sensor histidine kinase	PI1702	hypothetical protein	->->	1620619	1620726	108	31.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
732	PI1704	50S ribosomal protein L32	PI1705	3-oxoacyl-(acyl-carrier-protein) synthase III	->->	1621741	1621920	180	48.3%	0	1	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
733	PI1705	3-oxoacyl-(acyl-carrier-protein) synthase III	PI1706	GTP-binding protein	->->	1622767	1622909	143	35%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
734	PI1706	GTP-binding protein	PI1707	GTP-binding protein	->->	1623729	1623934	206	50%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
735	PI1708	hypothetical protein	PI1709	ABC transporter, ATP-binding protein	->->	1625623	1625982	360	35%	0	0	0	+: 0/1/0 \| -: 0/3/0	1	0	0	0	Result
736	PI1710	ABC-type permease component	PI1712	hypothetical protein	->->	1627417	1627636	220	32.7%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
739	PI1715	conserved hypothetical protein; possible DNA-binding protein, histone-like family	PI1717	major outer membrane protein	->->	1632385	1632805	421	35.4%	0	0	0	+: 1/1/0 \| -: 0/1/0	1	0	0	0	Result
740	PI1717	major outer membrane protein	PI1718	DNA mismatch repair protein	->->	1633949	1634136	188	18.6%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
741	PI1720	conserved hypothetical protein	PI1721	peptidyl-prolyl cis-trans isomerase, PPIC-type	->->	1638053	1638225	173	42.2%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
742	PI1722	possible peptidyl-prolyl cis-trans isomerase	PI1724	inosine-5'-monophosphate dehydrogenase	->->	1641056	1641214	159	34%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
743	PI1723	conserved hypothetical protein	PI1725	hypothetical protein	->->	1642194	1643163	970	38.4%	0	1	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
744	PI1725	hypothetical protein	PI1726	ATP-dependent DNA helicase	->->	1643281	1643541	261	39.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
746	PI1728	ATP-dependent Clp protease, proteolytic subunit	PI1729	FKBP-type peptidyl-prolyl cis-trans isomerase, trigger factor	->->	1647719	1648555	837	35.1%	0	0	0	+: 1/5/4 \| -: 4/3/7	33	0	0	0	Result
747	PI1729	FKBP-type peptidyl-prolyl cis-trans isomerase, trigger factor	PI1730	hypothetical protein	->->	1649996	1650253	258	36%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
748	PI1732	hypothetical protein	PI1733	hypothetical protein	->->	1652159	1652299	141	34%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
749	PI1736	topoisomerase IV, subunit A	PI1737	glycyl-tRNA synthetase	->->	1657151	1657905	755	31.7%	0	44	0	+: 0/1/0 \| -: 0/4/0	2	0	0	0	Result
750	PI1738	FKBP-type peptidyl-prolyl cis-trans isomerase	PI1739	Na+-driven multidrug efflux pump, MATE efflux family protein	->->	1660173	1660316	144	45.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
751	PI1740	DedA family protein	PI1741	lipid-A-disaccharide synthase	->->	1662377	1662893	517	35.2%	0	0	0	+: 0/1/0 \| -: 1/3/1	3	0	0	0	Result
753	PI1748	guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase/possible (p)ppgpp synthetase II	PI1749	conserved hypothetical protein	->->	1670983	1671178	196	44.9%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
754	PI1749	conserved hypothetical protein	PI1750	sulfate transporter	->->	1671698	1672273	576	32.8%	0	0	0	+: 0/5/0 \| -: 1/2/1	2	0	0	0	Result
760	PI1755	RNA polymerase sigma-70 factor, ECF subfamily	PI1756	conserved hypothetical protein	->->	1682571	1682766	196	23%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
761	PI1756	conserved hypothetical protein	PI1758	hypothetical protein	->->	1683211	1683346	136	33.1%	0	0	0	+: 0/0/0 \| -: 0/3/0	1	0	0	0	Result
763	PI1763	two-component system sensor histidine kinase/response regulator	PI1764	conserved hypothetical protein	->->	1688663	1689087	425	30.8%	0	0	0	+: 2/0/0 \| -: 1/0/0	1	0	0	0	Result
764	PI1764	conserved hypothetical protein	PI1765	fructanase, glycoside hydrolase family	->->	1691314	1691420	107	34.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
765	PI1767	fructokinase, pfkB family	PI1768	conserved hypothetical protein	->->	1695304	1695595	292	42.5%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
766	PI1769	hypothetical protein	PI1770	4-alpha-glucanotransferase	->->	1696998	1697475	478	35.4%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
767	PI1772	pullulanase	PI1773	alpha-amylase (neopullulanase)	->->	1704308	1704421	114	34.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
768	PI1773	alpha-amylase (neopullulanase)	PI1774	hypothetical protein	->->	1706168	1706323	156	34.6%	0	0	0	+: 0/3/0 \| -: 0/2/0	1	0	0	0	Result
769	PI1774	hypothetical protein	PI1775	hypothetical protein	->->	1707092	1707394	303	26.1%	0	0	0	+: 0/3/0 \| -: 1/1/1	1	0	0	0	Result
770	PI1775	hypothetical protein	PI1776	probable peptidase of the M22 family (inactive? chaperone?))	->->	1708181	1708762	582	30.2%	0	0	0	+: 1/4/1 \| -: 0/0/0	1	0	0	0	Result
771	PI1783	possible 4-diphosphocytidyl-2c-methyl-D-erythritol synthase	PI1784	possible dTDP-glucose 4,6-dehydratase, NAD-dependent epimerase/dehydratase family	->->	1716219	1716340	122	52.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
772	PI1786	hypothetical protein	PI1787	conserved hypothetical protein	->->	1718441	1718553	113	46%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
773	PI1789	hypothetical protein	PI1790	hypothetical protein	->->	1719098	1722318	3221	43.8%	0	0	4	+: 0/2/0 \| -: 1/2/0	1	0	0	0	Result
774	PI1790	hypothetical protein	PI1792	hypothetical protein	->->	1722823	1724780	1958	39.5%	0	0	0	+: 2/2/2 \| -: 0/2/0	1	0	0	0	Result
775	PI1794	conserved hypothetical protein	PI1795	conserved hypothetical protein	->->	1726757	1727003	247	41.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
776	PI1796	2-hydroxyhepta-2,4-diene-1,7-dioate isomerase, fumarylacetoacetate hydrolase family protein	PI1797	hypothetical protein	->->	1731147	1731286	140	33.6%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
777	PI1797	hypothetical protein	PI1798	elongation factor Ts	->->	1731620	1731927	308	30.2%	0	0	0	+: 0/2/0 \| -: 1/1/1	1	0	0	0	Result
778	PI1798	elongation factor Ts	PI1799	30S ribosomal protein S2	->->	1732885	1733039	155	34.2%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
779	PI1800	hypothetical protein	PI1801	30S ribosomal protein S9	->->	1733962	1734088	127	41.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
780	PI1802	50S ribosomal protein L13	PI1803	conserved hypothetical protein	->->	1735018	1735220	203	36%	0	0	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
781	PI1803	conserved hypothetical protein	PI1804	hypothetical protein	->->	1737852	1738248	397	37.3%	0	0	0	+: 0/1/0 \| -: 0/1/0	29	0	0	0	Result
782	PI1804	hypothetical protein	PI1805	TPR repeat containing protein	->->	1738351	1738508	158	31%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
783	PI1805	TPR repeat containing protein	PI1806	integral membrane transport protein; possible sugar transport proteins	->->	1740594	1740916	323	36.8%	0	0	0	+: 1/5/0 \| -: 2/1/1	1	0	0	0	Result
784	PI1808	LacI family transcriptional regulator	PI1809	outer membrane protein	->->	1743411	1746743	3333	43.1%	0	0	250	+: 2/2/1 \| -: 2/1/2	1	0	0	0	Result
785	PI1811	conserved hypothetical protein	PI1812	possible alpha-amylase	->->	1750690	1750898	209	32.1%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
786	PI1812	possible alpha-amylase	PI1813	hypothetical protein	->->	1752915	1753017	103	42.7%	0	0	0	+: 0/3/0 \| -: 0/1/0	1	0	0	0	Result
787	PI1814	hypothetical protein	PI1815	polyphosphate-selective porin O	->->	1753294	1753523	230	28.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
788	PI1815	polyphosphate-selective porin O	PI1816	acid phosphatase	->->	1754571	1754785	215	38.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
790	PI1818	hypothetical protein	PI1820	hypothetical protein	->->	1757331	1760101	2771	45.7%	0	0	0	+: 1/2/2 \| -: 0/3/0	1	0	0	0	Result
791	PI1820	hypothetical protein	PI1821	possible thioredoxin family protein	->->	1760438	1760653	216	40.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
792	PI1823	inorganic polyphosphate/ATP-NAD kinase (Poly(P)/ATP NAD kinase)	PI1824	ThiJ/PfpI family protein	->->	1764263	1764618	356	33.4%	0	0	2	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
793	PI1826	ATP-dependent DNA helicase	PI1827	peptidase, M23/M37 family, N-terminal	->->	1767884	1768152	269	31.6%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
794	PI1828	peptidase, M23/M37 family, C-terminal	PI1829	hypothetical protein	->->	1769150	1769394	245	33.1%	0	0	0	+: 0/1/0 \| -: 0/3/0	1	0	0	0	Result
795	PI1833	bacterioferritin comigratory protein	PI1834	anaerobic C4-dicarboxylate membrane transporter	->->	1774556	1775000	445	27%	0	0	0	+: 2/0/0 \| -: 0/0/0	1	0	0	0	Result
796	PI1835	L-asparaginase I	PI1836	conserved hypothetical protein	->->	1777337	1777447	111	36.9%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
797	PI1836	conserved hypothetical protein	PI1837	aspartate ammonia-lyase	->->	1778642	1779092	451	33.7%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
798	PI1837	aspartate ammonia-lyase	PI1838	conserved hypothetical protein	->->	1780467	1780912	446	30.3%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
799	PI1838	conserved hypothetical protein	PI1839	hypothetical protein	->->	1782089	1782317	229	36.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	2	0	0	0	Result
800	PI1839	hypothetical protein	PI1840	conserved hypothetical protein	->->	1782561	1782995	435	30.8%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
801	PI1842	conserved hypothetical protein	PI1843	hypothetical protein	->->	1788378	1788563	186	28%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
802	PI1843	hypothetical protein	PI1844	hypothetical protein	->->	1788672	1790231	1560	33.3%	0	0	0	+: 0/0/0 \| -: 2/0/0	3	0	0	0	Result
803	PI1844	hypothetical protein	PI1845	hypothetical protein	->->	1790340	1791596	1257	32.9%	0	0	0	+: 0/0/0 \| -: 3/0/0	3	0	0	0	Result
804	PI1846	hypothetical protein	PI1847	conserved hypothetical protein; possible integral membrane protein	->->	1792004	1792145	142	33.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
805	PI1851	conserved hypothetical protein	PI1852	conserved hypothetical protein	->->	1797947	1798091	145	26.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
807	PI1855	lipopolysaccharide biosynthesis protein	PI1856	nicotinate-nucleotide adenylyltransferase	->->	1803229	1803342	114	40.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
808	PI1858	conserved hypothetical protein	PI1859	conserved hypothetical protein	->->	1805416	1805533	118	31.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
809	PI1859	conserved hypothetical protein	PI1861	hypothetical protein	->->	1805888	1806066	179	33%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
810	PI1862	hypothetical protein	PI1863	phosphoribosylformylglycinamidine synthase	->->	1806452	1806813	362	34.5%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
811	PI1865	chromate transport protein	PI1866	hypothetical protein	->->	1811648	1811832	185	33%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
812	PI1866	hypothetical protein	PI1867	helicase related protein	->->	1811971	1812529	559	31.5%	0	0	0	+: 2/1/0 \| -: 0/1/0	1	0	0	0	Result
813	PI1868	hypothetical protein	PI1869	hypothetical protein	->->	1814976	1815270	295	33.2%	0	0	0	+: 0/1/0 \| -: 1/1/0	1	0	0	0	Result
814	PI1870	hypothetical protein	PI1871	glycosyl transferase, group 1 family protein	->->	1815574	1815927	354	29.7%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
815	PI1878	hypothetical protein	PI1879	uracil phosphoribosyltransferase	->->	1820222	1820810	589	37%	0	0	0	+: 0/1/0 \| -: 1/4/4	54	0	0	0	Result
816	PI1879	uracil phosphoribosyltransferase	PI1880	phosphoenolpyruvate carboxykinase (ATP)	->->	1821306	1821806	501	32.1%	0	0	10	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
819	PI1884	conserved hypothetical protein	PI1886	cell division protein	->->	1827518	1827772	255	44.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
820	PI1889	UDP-N-acetylglucosamine--N-acetylmuramyl-(pentape ptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase	PI1890	cell division protein FtsW	->->	1832652	1833025	374	31.8%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
822	PI1896	hypothetical protein	PI1898	S-adenosyl-methyltransferase	->->	1841249	1841427	179	44.1%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
823	PI1899	conserved hypothetical protein	PI1900	conserved hypothetical protein	->->	1842842	1843238	397	31.2%	0	0	0	+: 1/1/0 \| -: 0/0/0	1	0	0	0	Result
824	PI1903	hypothetical protein	PI1905	hypothetical protein	->->	1845630	1847767	2138	46.3%	0	0	165	+: 1/3/0 \| -: 0/3/0	1	0	0	0	Result
825	PI1905	hypothetical protein	PI1906	zinc protease, immunoreactive 106 kDa antigen PG115	->->	1847915	1848147	233	26.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
828	PI1909	DNA gyrase, B subunit	PI1910	hypothetical protein	->->	1855331	1855917	587	34.1%	0	0	0	+: 0/2/0 \| -: 0/4/0	46	0	0	0	Result
830	PI1915	conserved hypothetical protein	PI1916	conserved hypothetical protein	->->	1859967	1860350	384	35.7%	0	0	0	+: 1/2/2 \| -: 0/2/0	32	0	0	0	Result
832	PI1918	uracil-DNA glycosylase	PI1919	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	->->	1862285	1862438	154	38.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
833	PI1919	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	PI1921	conserved hypothetical protein	->->	1863936	1864056	121	24.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
834	PI1922	hypothetical protein	PI1923	conserved hypothetical protein	->->	1865515	1865699	185	34.1%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
835	PI1925	conserved hypothetical protein	PI1926	conserved hypothetical protein	->->	1867994	1868253	260	28.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
836	PI1926	conserved hypothetical protein	PI1927	hypothetical protein	->->	1871038	1871326	289	24.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
837	PI1929	conserved hypothetical protein; possible ankyrin repeat protein (eukaryotic-like)	PI1930	conserved hypothetical protein; possible ankyrin repeat protein (eukaryotic-like)	->->	1874235	1874358	124	33.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
838	PI1930	conserved hypothetical protein; possible ankyrin repeat protein (eukaryotic-like)	PI1931	alpha glycan phosphorylase, maltodextrin phosphorylase	->->	1875115	1875595	481	38%	0	0	0	+: 0/1/0 \| -: 0/2/0	53	0	0	0	Result
839	PI1932	glycogen synthase	PI1933	hypothetical protein	->->	1879867	1880064	198	28.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
840	PI1933	hypothetical protein	PI1934	hypothetical protein	->->	1880524	1882502	1979	44.6%	0	1	22	+: 0/1/0 \| -: 0/3/0	1	0	0	0	Result
841	PI1934	hypothetical protein	PI1935	possible internalin-related protein	->->	1882662	1883463	802	28.6%	0	0	0	+: 1/1/0 \| -: 0/1/0	1	0	0	0	Result
842	PI1937	hypothetical protein	PI1938	hypothetical protein	->->	1891147	1891993	847	31.5%	0	0	0	+: 3/4/4 \| -: 1/4/4	29	0	0	0	Result
843	PI1938	hypothetical protein	PI1940	conserved hypothetical protein; possible outer membrane protein	->->	1895699	1895869	171	25.1%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
844	PI1939	hypothetical protein	PI1941	outer membrane receptor; ragA protein	->->	1896727	1897508	782	38.9%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
845	PI1941	outer membrane receptor; ragA protein	PI1942	hypothetical protein	->->	1900680	1901080	401	30.7%	0	0	0	+: 1/1/0 \| -: 0/0/0	1	0	0	0	Result
846	PI1946	hypothetical protein	PI1948	hypothetical protein	->->	1903081	1903223	143	33.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	2	0	0	0	Result
847	PI1952	hypothetical protein	PI1953	possible ABC-type permease	->->	1907100	1907274	175	38.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
848	PI1953	possible ABC-type permease	PI1954	translation initiation factor IF-2	->->	1908643	1908923	281	35.9%	0	0	0	+: 0/2/0 \| -: 0/2/0	1	0	0	0	Result
849	PI1954	translation initiation factor IF-2	PI1955	N utilization substance protein A	->->	1911708	1911921	214	38.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
850	PI1956	conserved hypothetical protein	PI1957	calcium-transporting ATPase	->->	1913687	1913898	212	33.5%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
851	PI1958	hypothetical protein	PI1959	hypothetical protein	->->	1917430	1917847	418	34.2%	0	0	0	+: 1/4/3 \| -: 0/4/0	38	0	0	0	Result
852	PI1959	hypothetical protein	PI1960	hypothetical protein	->->	1918031	1918152	122	35.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
853	PI1962	conserved hypothetical protein	PI1963	hypothetical protein	->->	1920767	1921348	582	37.5%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
854	PI1966	conserved hypothetical protein	PI1967	hypothetical protein	->->	1924152	1924375	224	37.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
858	PI1973	conserved hypothetical protein	PI1974	hypothetical protein	->->	1931232	1931332	101	43.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
859	PI1975	conserved hypothetical protein	PI1976	hypothetical protein	->->	1932994	1933132	139	32.4%	0	0	0	+: 1/1/0 \| -: 1/0/0	1	0	0	0	Result
860	PI1979	conserved hypothetical protein	PI1980	conserved hypothetical protein	->->	1937388	1937609	222	48.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
861	PI1981	hypothetical protein	PI1982	conserved hypothetical protein	->->	1938199	1938578	380	32.1%	0	0	0	+: 1/2/1 \| -: 0/2/0	39	0	0	0	Result
862	PI1983	possible xylanase	PI1984	MutT/nudix family protein	->->	1940065	1940323	259	29.3%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
863	PI1985	hypothetical protein	PI1986	hypothetical protein	->->	1940806	1941002	197	33%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
864	PI1991	conserved hypothetical protein	PI1992	hypothetical protein	->->	1946431	1946566	136	40.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
865	PI1993	thiol protease/hemagglutinin, PrtT precursor	PI1995	hypothetical protein	->->	1949053	1949363	311	30.2%	0	0	0	+: 0/2/0 \| -: 2/0/0	1	0	0	0	Result
866	PI1994	hypothetical protein	PI1996	hypothetical protein	->->	1949905	1950453	549	33.2%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
874	PI2000	conserved hypothetical protein; possible membrane protein	PI2001	hypothetical protein	->->	1959770	1959989	220	28.2%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
875	PI2001	hypothetical protein	PI2002	hypothetical protein	->->	1960539	1960801	263	35%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
876	PI2005	potassium uptake protein	PI2006	potassium uptake system protein	->->	1964428	1964619	192	43.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
877	PI2006	potassium uptake system protein	PI2008	ABC transporter, ATP-binding protein	->->	1965907	1967262	1356	44.6%	0	0	4	+: 0/4/0 \| -: 2/7/0	1	0	0	0	Result
878	PI2008	ABC transporter, ATP-binding protein	PI2009	ribosome-binding factor A	->->	1968022	1968740	719	33.4%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
880	PI2011	hypothetical protein	PI2012	hypothetical protein	->->	1970791	1970946	156	34.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
881	PI2017	conserved hypothetical protein	PI2018	50S ribosomal protein L34	->->	1975779	1975896	118	33.1%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
882	PI2018	50S ribosomal protein L34	PI2019	elongation factor P	->->	1976050	1976270	221	26.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
883	PI2019	elongation factor P	PI2020	glycosyl transferase, group 2 family protein	->->	1976835	1977005	171	42.7%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
884	PI2024	hypothetical protein	PI2025	conserved hypothetical protein	->->	1979046	1979167	122	27%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
886	PI2026	RNA polymerase sigma-70 factor, ECF subfamily	PI2027	arginine decarboxylase	->->	1980144	1980300	157	38.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
887	PI2027	arginine decarboxylase	PI2028	shikimate kinase	->->	1982191	1982301	111	36%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
888	PI2029	DNA topoisomerase I	PI2030	hypothetical protein	->->	1985315	1985740	426	35.2%	0	0	0	+: 1/1/1 \| -: 0/2/0	49	0	0	0	Result
889	PI2034	conserved hypothetical protein	PI2035	Holliday junction DNA helicase ruvB	->->	1988181	1988351	171	28.7%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
890	PI2037	TIM-barrel protein, NifR3 family	PI2038	conserved hypothetical protein; possible internalin-related protein	->->	1990430	1990602	173	38.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
891	PI2038	conserved hypothetical protein; possible internalin-related protein	PI2039	hypothetical protein	->->	1992652	1992772	121	37.2%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
892	PI2039	hypothetical protein	PI2040	conserved hypothetical protein; possible transporter	->->	1993052	1993207	156	39.1%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
893	PI2040	conserved hypothetical protein; possible transporter	PI2041	conserved hypothetical protein	->->	1994126	1994300	175	25.1%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
894	PI2043	hypothetical protein	PI2044	hypothetical protein	->->	1996318	1997138	821	42.8%	0	1	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
896	PI2045	hypothetical protein	PI2046	hypothetical protein	->->	1998784	1999169	386	39.9%	0	0	0	+: 0/2/0 \| -: 0/1/0	44	0	0	0	Result
897	PI2046	hypothetical protein	PI2047	UDP-N-acetylmuramoylalanyl-D-glutamyl-2,6-diamino pimelate--D-alanyl-D-alanyl ligase	->->	1999266	1999467	202	36.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
898	PI2049	possible transcriptional regulator, AraC family	PI2050	hypothetical protein	->->	2003764	2004151	388	22.2%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
899	PI2051	hypothetical protein	PI2052	hypothetical protein	->->	2007896	2008733	838	33.1%	0	0	0	+: 1/7/0 \| -: 0/4/0	54	0	0	0	Result
900	PI2052	hypothetical protein	PI2053	conserved hypothetical protein; possible outer membrane receptor protein	->->	2009757	2010812	1056	40.5%	0	0	2	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
901	PI2055	hypothetical protein	PI2056	conserved hypothetical protein	->->	2013466	2013906	441	32.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
902	PI2056	conserved hypothetical protein	PI2057	conserved hypothetical protein; possible metal-dependent membrane protease	->->	2014489	2015078	590	34.7%	0	0	0	+: 0/4/0 \| -: 0/3/0	35	0	0	0	Result
905	PI2066	hypothetical protein	PI2067	hypothetical protein	->->	2027787	2027899	113	35.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
910	PI2073	mobilization protein	PI2074	conserved hypothetical protein	->->	2033548	2033799	252	52%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
911	PI2074	conserved hypothetical protein	PI2075	conserved hypothetical protein	->->	2034436	2034560	125	36.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
912	PI2075	conserved hypothetical protein	PI2076	hypothetical protein	->->	2035416	2035542	127	52%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
913	PI2076	hypothetical protein	PI2077	hypothetical protein	->->	2035819	2036031	213	35.7%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
914	PI2079	conserved hypothetical protein; possible ATPase	PI2080	hypothetical protein	->->	2038022	2038232	211	36.5%	0	0	0	+: 0/2/0 \| -: 1/0/0	1	0	0	0	Result
915	PI2081	conserved hypothetical protein; possible integrase	PI2082	hypothetical protein	->->	2039717	2040017	301	29.6%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
916	PI2082	hypothetical protein	PI2083	hypothetical protein	->->	2040324	2040463	140	36.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
917	PI2084	hypothetical protein	PI2085	conserved hypothetical protein	->->	2041130	2041239	110	31.8%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
918	PI2085	conserved hypothetical protein	PI2086	signal peptidase I	->->	2041864	2041974	111	36%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
919	PI2087	dihydropicolinate reductase	PI2088	conserved hypothetical protein; possible PAP2 superfamily protein	->->	2044316	2044576	261	28.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
920	PI2088	conserved hypothetical protein; possible PAP2 superfamily protein	PI2089	conserved hypothetical protein	->->	2045876	2046339	464	38.1%	0	0	0	+: 1/1/1 \| -: 0/1/0	53	0	0	0	Result
921	PI2096	conserved hypothetical protein; possible phosphoesterase	PI2097	conserved hypothetical protein	->->	2050945	2051051	107	45.8%	0	0	0	+: 0/2/0 \| -: 0/3/0	1	0	0	0	Result
922	PI2099	D-alanyl-D-alanine dipeptidase	PI2100	conserved hypothetical protein	->->	2053338	2053490	153	44.4%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
923	PI2105	hypothetical protein	PI2108	cell surface protein; possible cell surface antigen BspA	->->	2059647	2059800	154	31.8%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
927	PI2115	hypothetical protein	PI2116	fumarate reductase/succinate dehydrogenase, iron-sulfur protein	->->	2065226	2065354	129	26.4%	0	0	0	+: 0/1/0 \| -: 1/1/0	1	0	0	0	Result
928	PI2118	fumarate reductase/succinate dehydrogenase flavoprotein subunit, N-terminal	PI2119	conserved hypothetical protein; possible cytochrome B subunit	->->	2068058	2068170	113	33.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
929	PI2119	conserved hypothetical protein; possible cytochrome B subunit	PI2120	hypothetical protein	->->	2068819	2068978	160	28.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
930	PI2120	hypothetical protein	PI2122	conserved hypothetical protein	->->	2069111	2069883	773	35.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
931	PI2123	adenine phosphoribosyltransferase	PI2124	excinuclease ABC, subunit C	->->	2072385	2072723	339	40.1%	0	0	0	+: 0/0/0 \| -: 0/3/0	1	0	0	0	Result
932	PI2127	deoxyribose-phosphate aldolase	PI2128	hypothetical protein	->->	2076372	2076651	280	30.7%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
933	PI2129	octaprenyl-diphosphate synthase	PI2130	DNA polymerase I	->->	2077782	2078119	338	35.8%	0	0	16	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
934	PI2131	hypothetical protein	PI2132	hypothetical protein	->->	2080929	2081100	172	27.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
935	PI2137	RNA methylase SpoU family	PI2138	nicotinate phosphoribosyltransferase	->->	2083868	2083975	108	38.9%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
936	PI2138	nicotinate phosphoribosyltransferase	PI2139	cysteinyl-tRNA synthetase	->->	2085194	2085405	212	32.1%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
937	PI2139	cysteinyl-tRNA synthetase	PI2140	conserved hypothetical protein	->->	2086813	2086912	100	35%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
938	PI2141	hypothetical protein	PI2142	conserved hypothetical protein	->->	2087618	2087745	128	28.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
939	PI2147	GTP-binding protein	PI2148	ribonuclease III	->->	2094468	2094644	177	30.5%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
940	PI2149	3-oxoacyl-acyl-carrier-protein synthase	PI2150	acyl carrier protein	->->	2096854	2097111	258	32.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
941	PI2150	acyl carrier protein	PI2151	conserved hypothetical protein	->->	2097346	2097712	367	27.2%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
942	PI2152	heptosyltransferase	PI2153	hypothetical protein	->->	2099357	2099531	175	28.6%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
943	PI2153	hypothetical protein	PI2154	leucyl-tRNA synthetase	->->	2099691	2100000	310	35.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
944	PI2155	hypothetical protein	PI2156	conserved hypothetical protein; possible permease	->->	2101113	2102935	1823	46.5%	0	1	0	+: 1/0/0 \| -: 1/0/0	1	0	0	0	Result
945	PI2160	hypothetical protein	PI2161	hypothetical protein	->->	2108418	2108718	301	25.9%	0	0	0	+: 0/1/0 \| -: 0/3/0	1	0	0	0	Result
946	PI2161	hypothetical protein	PI2162	conserved hypothetical protein	->->	2108812	2108935	124	42.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
947	PI2165	conserved hypothetical protein; possible membrane protein	PI2168	hypothetical protein	->->	2111266	2111425	160	38.8%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
948	PI2172	hypothetical protein	PI2174	hypothetical protein	->->	2114052	2114384	333	30.3%	0	0	0	+: 0/1/0 \| -: 1/1/0	56	0	0	0	Result
949	PI2174	hypothetical protein	PI2175	RNA polymerase sigma-54	->->	2115030	2115146	117	36.8%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
Total:										1	20	0/70		804	20