Origin IGS:
tgatcagagaaatatctaaaacgcccaaggtagccctgtgccgtgaatgtcatggcacgggcttccaaaaggtaagtatagacgggacacagacacatgtccggtgtccccagtgtgagggaagcggcagggtgctggtgagttgcaagatgagccttgacatccgcccgtatagaaacagtcaacaatcctaacaaatcccacagct
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
agctgtgggatttgttaggattgttgactgtttctatacgggcggatgtcaaggctcatcttgcaactcaccagcaccctgccgcttccctcacactggggacaccggacatgtgtctgtgtcccgtctatacttaccttttggaagcccgtgccatgacattcacggcacagggctaccttgggcgttttagatatttctctgatca

Mask Tandem Repeat Region ================================================
tgatcagagaaatatctaaaacgcccaaggtagccctgtgccgtgaatgtcatggcacgggcttccaaaaggtaagtatagacgggacacagacacatgtccggtgtccccagtgtgagggaagcggcagggtgctggtgagttgcaagatgagccttgacatccgcccgtatagaaacagtcaacaatcctaacaaatcccacagct

Find is-nt database================================================
Query_seq: PI1634:PI1635|PI1634:PI1635:conserved hypothetical protein:hypothetical protein:->->:1553880..1554087 208
tgatcagagaaatatctaaaacgcccaaggtagccctgtgccgtgaatgtcatggcacgggcttccaaaaggtaagtatagacgggacacagacacatgtccggtgtccccagtgtgagggaagcggcagggtgctggtgagttgcaagatgagccttgacatccgcccgtatagaaacagtcaacaatcctaacaaatcccacagct
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: PI1634:PI1635|PI1634:PI1635:conserved hypothetical protein:hypothetical protein:->->:1553880..1554087 208
tgatcagagaaatatctaaaacgcccaaggtagccctgtgccgtgaatgtcatggcacgggcttccaaaaggtaagtatagacgggacacagacacatgtccggtgtccccagtgtgagggaagcggcagggtgctggtgagttgcaagatgagccttgacatccgcccgtatagaaacagtcaacaatcctaacaaatcccacagct
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: PI1634:PI1635|PI1634:PI1635:conserved hypothetical protein:hypothetical protein:->->:1553880..1554087 208
tgatcagagaaatatctaaaacgcccaaggtagccctgtgccgtgaatgtcatggcacgggcttccaaaaggtaagtatagacgggacacagacacatgtccggtgtccccagtgtgagggaagcggcagggtgctggtgagttgcaagatgagccttgacatccgcccgtatagaaacagtcaacaatcctaacaaatcccacagct
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

tgatcagagaaatatctaaaacgcccaaggtagccctgtgccgtgaatgtcatggcacgggcttccaaaaggtaagtatagacgggacacagacacatgtccggtgtccccagtgtgagggaagcggcagggtgctggtgagttgcaagatgagccttgacatccgcccgtatagaaacagtcaacaatcctaacaaatcccacagct
Predict ORF larger than 30AA ================================================
Protein_Len: 60	Strand: +	Start: 3	End: 191
.. M  R  E  I  S  K  T  P  K  V  A  L  C  R  E  C  H  G  T  G  F  Q  K  V  S  I  D  G  T  Q  T  H  V  R  C  P  Q  C  E  G  S  G  R  V  L  V  S  C  K  M  S  L  D  I  R  P  Y  R  N  S .................
Protein_Len: 43	Strand: -	Start: 53	End: 181
.................................................... P  V  P  K  W  F  T  L  I  S  P  V  C  V  C  T  R  H  G  W  H  S  P  L  P  L  T  S  T  L  Q  L  I  L  R  S  M  R  G  Y  L  F  M ...........................
Protein_Len: 60	Strand: -	Start: 19	End: 204
.................. W  P  L  G  T  G  H  I  D  H  C  P  S  G  F  P  L  Y  L  R  S  V  S  V  H  G  T  D  G  T  H  P  F  R  C  P  A  P  S  N  C  S  S  G  Q  C  G  G  T  Y  F  C  D  V  I  R  V  F  G  M ....
Protein_Len: 60	Strand: -	Start: 3	End: 206
.. L  Y  G  Q  A  T  F  T  M  A  R  A  E  L  L  Y  T  Y  V  P  C  L  C  M  D  P  T  G  L  T  L  S  A  A  P  H  Q  H  T  A  L  H  A  K  V  D  A  R  I  S  V  T  L  L  G  L  L  D  W  M ..

tgatcagagaaatatctaaaacgcccaaggtagccctgtgccgtgaatgtcatggcacgggcttccaaaaggtaagtatagacgggacacagacacatgtccggtgtccccagtgtgagggaagcggcagggtgctggtgagttgcaagatgagccttgacatccgcccgtatagaaacagtcaacaatcctaacaaatcccacagct
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

tgatcagagaaatatctaaaacgcccaaggtagccctgtgccgtgaatgtcatggcacgggcttccaaaaggtaagtatagacgggacacagacacatgtccggtgtccccagtgtgagggaagcggcagggtgctggtgagttgcaagatgagccttgacatccgcccgtatagaaacagtcaacaatcctaacaaatcccacagct
Predict TransTerm conf > 70================================================
TransTerm Strand: -	Conf: 75	HP_score: -12.9	Tail_Score: -2.54655	Start: 33	End: 62	Full_Region: acttaccttttggaa gcccgtgccatga cat tcacggcacagggc taccttgggcgtttt
................................gcccgtgccatgacattcacggcacagggc..................................................................................................................................................

Find igs database================================================
Query_seq: PI1634:PI1635|PI1634:PI1635:conserved hypothetical protein:hypothetical protein:->->:1553880..1554087 208
tgatcagagaaatatctaaaacgcccaaggtagccctgtgccgtgaatgtcatggcacgggcttccaaaaggtaagtatagacgggacacagacacatgtccggtgtccccagtgtgagggaagcggcagggtgctggtgagttgcaagatgagccttgacatccgcccgtatagaaacagtcaacaatcctaacaaatcccacagct
Intra-Species Hit: Count: 1	Min: 1	Max: 208	Len: 208
Subject: pint_PI1634_PI1635|conserved hypothetical protein:hypothetical protein|POSITIVE:POSITIVE|[1553880,1554087]|208
HSP  1	e-value: 1.0E-114	bit: 412.0	Len: 208	Query Start:1	Query End:208	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 208
tgatcagagaaatatctaaaacgcccaaggtagccctgtgccgtgaatgtcatggcacgggcttccaaaaggtaagtatagacgggacacagacacatgtccggtgtccccagtgtgagggaagcggcagggtgctggtgagttgcaagatgagccttgacatccgcccgtatagaaacagtcaacaatcctaacaaatcccacagct
tgatcagagaaatatctaaaacgcccaaggtagccctgtgccgtgaatgtcatggcacgggcttccaaaaggtaagtatagacgggacacagacacatgtccggtgtccccagtgtgagggaagcggcagggtgctggtgagttgcaagatgagccttgacatccgcccgtatagaaacagtcaacaatcctaacaaatcccacagct

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UGAUCAGAGAAAUAUCUAAAACGCCCAAGGUAGCCCUGUGCCGUGAAUGUCAUGGCACGGGCUUCCAAAAGGUAAGUAUAGACGGGACACAGACACAUGUCCGGUGUCCCCAGUGUGAGGGAAGCGGCAGGGUGCUGGUGAGUUGCAAGAUGAGCCUUGACAUCCGCCCGUAUAGAAACAGUCAACAAUCCUAACAAAUCCCACAGCU
.....(((......)))...((((....((.(((((.((((((((.....))))))))))))).)).................(((((((.(((....)))..)))))))..))))..((((.((((..((((((.(((..(((....)))..)))..).)))))..))))...((.....))...............))))...... (-69.60)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
AGCUGUGGGAUUUGUUAGGAUUGUUGACUGUUUCUAUACGGGCGGAUGUCAAGGCUCAUCUUGCAACUCACCAGCACCCUGCCGCUUCCCUCACACUGGGGACACCGGACAUGUGUCUGUGUCCCGUCUAUACUUACCUUUUGGAAGCCCGUGCCAUGACAUUCACGGCACAGGGCUACCUUGGGCGUUUUAGAUAUUUCUCUGAUCA
.(.((.((((..((.((((..(((((.((((......))))(((((((........)))).))).......))))).)))).))..)))).)))....(((((((.((((....)))))))))))...........(((...((.((((((((((.((.....)).))))).))))).))..)))....(((((......)))))... (-71.30)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
542	128	83	221	175	pint:PI0356|5end_hypothetical_protein_326642..326872_POSITIVE
447	72	33	229	181	pint:PI0333|5end_hypothetical_protein_313478..313708_POSITIVE
419	145	101	83	36	pint:PI0128|5end_dipeptidase,_pathogenicity_island-encoded_protein_D_120532..120762_POSITIVE
389	167	121	95	35	pint:PI1664|5end_conserved_hypothetical_protein_1577285..1577515_POSITIVE
387	170	124	196	131	pint:PI1947|5end_hypothetical_protein_1902534..1902764_POSITIVE
387	68	21	223	176	pint:PI0330|5end_hypothetical_protein_310447..310677_POSITIVE
386	159	113	206	158	pint:PI0051|5end_hypothetical_protein_52607..52837_POSITIVE
379	129	84	60	11	pint:PI0265|5end_conjugative_transposon_protein,_TraO_257296..257526_POSITIVE
376	138	91	62	6	pint:PI1588|5end_DNA_polymerase_III,_epsilon_chain_1516302..1516532_POSITIVE
373	67	22	87	34	pint:PI1609|5end_Na+/H+_anti-porter_1536058..1536288_POSITIVE
371	156	112	80	23	pint:PI1757|5end_hypothetical_protein_1683934..1684164_POSITIVE
371	167	121	95	35	pint:PI0370|5end_conserved_hypothetical_protein_340453..340683_POSITIVE
369	147	101	224	163	pint:PI1365|5end_conserved_hypothetical_protein;_probable_transmembrane_protein_1283976..1284206_POSITIVE
367	169	123	107	50	pint:PI0126|5end_conserved_hypothetical_protein_117925..118155_POSITIVE
366	70	22	214	172	pint:PI0034|5end_FKBP-type_peptidyl-prolyl_cis-trans_isomerase_37151..37381_POSITIVE
364	72	36	229	177	pint:PI1626|5end_hypothetical_protein_1550194..1550424_POSITIVE
364	150	106	231	168	pint:PI0427|5end_conserved_hypothetical_protein_391140..391370_POSITIVE
360	149	101	59	4	pint:PI1672|5end_conserved_hypothetical_protein;_possible_DNA-binding_protein,_histone-like_family_1587027..1587257_POSITIVE
360	129	83	228	176	pint:PI1531|5end_biotin--acetyl-CoA-carboxylase_ligase_1450839..1451069_POSITIVE
357	170	123	196	144	pint:PI0171|5end_hypothetical_protein_163850..164080_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
501	66	29	62	25	pint:PI1634|3end_conserved_hypothetical_protein_1553819..1553969_POSITIVE
406	155	111	119	75	pint:PI2129|3end_octaprenyl-diphosphate_synthase_2077721..2077871_POSITIVE
389	167	121	77	17	pint:PI1663|3end_hypothetical_protein_1577347..1577497_POSITIVE
388	170	122	122	47	pint:PI0906|3end_hypothetical_protein_836008..836158_POSITIVE
379	129	84	55	6	pint:PI0264|3end_transfer_region-related_protein,_TraN_257371..257521_POSITIVE
373	168	121	121	55	pint:PI1741|3end_lipid-A-disaccharide_synthase_1663856..1664006_POSITIVE
371	156	112	123	66	pint:PI1758|3end_hypothetical_protein_1684057..1684207_POSITIVE
366	146	101	104	59	pint:PI1227|3end_conserved_hypothetical_protein;_possible_DNA-binding_protein,_histone-like_family_1148974..1149124_POSITIVE
366	70	22	84	42	pint:PI0033|3end_peptidylprolyl_isomerase_37101..37251_POSITIVE
359	73	33	87	50	pint:PI0340|3end_conserved_hypothetical_protein_316735..316885_POSITIVE
352	170	125	142	77	pint:PI2074|3end_conserved_hypothetical_protein_2034375..2034525_POSITIVE
352	146	101	56	7	pint:PI1783|3end_possible_4-diphosphocytidyl-2c-methyl-D-erythritol_synthase_1716158..1716308_POSITIVE
350	150	102	109	46	pint:PI1488|3end_hypothetical_protein_1407829..1407979_POSITIVE
347	160	111	106	53	pint:PI1954|3end_translation_initiation_factor_IF-2_1911647..1911797_POSITIVE
347	132	102	47	10	pint:PI1402|3end_3-deoxy-7-phosphoheptulonate_synthase_1323980..1324130_POSITIVE
345	144	102	79	37	pint:PI2157|3end_xanthosine_triphosphate_pyrophosphatase,_HAM1_family_2104457..2104607_POSITIVE
336	68	22	138	84	pint:PI0998|3end_possible_flavin_reductase_domain_protein_923336..923486_POSITIVE
336	170	123	76	25	pint:PI0363|3end_hypothetical_protein_333760..333910_POSITIVE
334	69	25	70	25	pint:PI1353|3end_conserved_hypothetical_protein_1270932..1271082_POSITIVE
331	169	126	81	28	pint:PI1265|3end_hypothetical_protein_1185512..1185662_POSITIVE