Origin IGS:
tgctacaaagttacattaaaaggtgtgaatgcccaaaatatttcaccatttttttgcttattgcgagccttgcaatgcattctatccataataagaaataaatcagaatactttaaaaatccttgtatgttcgttaaactatatgaaaagaaagaataaaatcgtctatttagataaatgttaccgacgagtaacttatctttgcggttacttgttggtaacattaagtaa
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
ttacttaatgttaccaacaagtaaccgcaaagataagttactcgtcggtaacatttatctaaatagacgattttattctttcttttcatatagtttaacgaacatacaaggatttttaaagtattctgatttatttcttattatggatagaatgcattgcaaggctcgcaataagcaaaaaaatggtgaaatattttgggcattcacaccttttaatgtaactttgtagca

Mask Tandem Repeat Region ================================================
tgctacaaagttacattaaaaggtgtgaatgcccaaaatatttcaccatttttttgcttattgcgagccttgcaatgcattctatccataataagaaataaatcagaatactttaaaaatccttgtatgttcgttaaactatatgaaaagaaagaataaaatcgtctatttagataaatgttaccgacgagtaacttatctttgcggttacttgttggtaacattaagtaa

Find is-nt database================================================
Query_seq: PI0557:PI0558|PI0557:PI0558:conserved hypothetical protein:probable transcriptional regulator, TetR family:->->:506945..507175 231
tgctacaaagttacattaaaaggtgtgaatgcccaaaatatttcaccatttttttgcttattgcgagccttgcaatgcattctatccataataagaaataaatcagaatactttaaaaatccttgtatgttcgttaaactatatgaaaagaaagaataaaatcgtctatttagataaatgttaccgacgagtaacttatctttgcggttacttgttggtaacattaagtaa
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: PI0557:PI0558|PI0557:PI0558:conserved hypothetical protein:probable transcriptional regulator, TetR family:->->:506945..507175 231
tgctacaaagttacattaaaaggtgtgaatgcccaaaatatttcaccatttttttgcttattgcgagccttgcaatgcattctatccataataagaaataaatcagaatactttaaaaatccttgtatgttcgttaaactatatgaaaagaaagaataaaatcgtctatttagataaatgttaccgacgagtaacttatctttgcggttacttgttggtaacattaagtaa
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: PI0557:PI0558|PI0557:PI0558:conserved hypothetical protein:probable transcriptional regulator, TetR family:->->:506945..507175 231
tgctacaaagttacattaaaaggtgtgaatgcccaaaatatttcaccatttttttgcttattgcgagccttgcaatgcattctatccataataagaaataaatcagaatactttaaaaatccttgtatgttcgttaaactatatgaaaagaaagaataaaatcgtctatttagataaatgttaccgacgagtaacttatctttgcggttacttgttggtaacattaagtaa
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

tgctacaaagttacattaaaaggtgtgaatgcccaaaatatttcaccatttttttgcttattgcgagccttgcaatgcattctatccataataagaaataaatcagaatactttaaaaatccttgtatgttcgttaaactatatgaaaagaaagaataaaatcgtctatttagataaatgttaccgacgagtaacttatctttgcggttacttgttggtaacattaagtaa
Predict ORF larger than 30AA ================================================
Protein_Len: 44	Strand: +	Start: 25	End: 156
........................ M  N  A  Q  N  I  S  P  F  F  C  L  L  R  A  L  Q  C  I  L  S  I  I  R  N  K  S  E  Y  F  K  N  P  C  M  F  V  K  L  Y  E  K  K  E ...........................................................................
Protein_Len: 44	Strand: +	Start: 98	End: 229
................................................................................................. M  N  Q  N  T  L  K  I  L  V  C  S  L  N  Y  M  K  R  K  N  K  I  V  Y  L  D  K  C  Y  R  R  V  T  Y  L  C  G  Y  L  L  V  T  L  S ..
Protein_Len: 32	Strand: -	Start: 14	End: 109
............. M  L  L  H  S  H  G  F  Y  K  V  M  K  K  S  I  A  L  R  A  I  C  E  I  W  L  L  F  Y  I  L  M ..........................................................................................................................
Protein_Len: 60	Strand: -	Start: 6	End: 224
..... G  N  K  Q  K  N  R  A  K  C  H  M  R  D  M  I  L  F  L  D  S  Y  K  L  F  G  Q  I  N  T  L  S  Y  S  F  F  S  Y  F  R  R  N  L  Y  I  N  G  V  L  L  K  D  K  R  N  S  T  P  L  M .......

tgctacaaagttacattaaaaggtgtgaatgcccaaaatatttcaccatttttttgcttattgcgagccttgcaatgcattctatccataataagaaataaatcagaatactttaaaaatccttgtatgttcgttaaactatatgaaaagaaagaataaaatcgtctatttagataaatgttaccgacgagtaacttatctttgcggttacttgttggtaacattaagtaa
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================
PromScan Matrix: RpoD-17	Strand: +	Score: 83	Start: 111	End: 140
..............................................................................................................CTTTAAAAATCCTTGTATGTTCGTTAAACT...........................................................................................
PromScan Matrix: RpoD-17	Strand: -	Score: 81	Start: 88	End: 117
.......................................................................................TTTAAAGTATTCTGATTTATTTCTTATTAT..................................................................................................................

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

tgctacaaagttacattaaaaggtgtgaatgcccaaaatatttcaccatttttttgcttattgcgagccttgcaatgcattctatccataataagaaataaatcagaatactttaaaaatccttgtatgttcgttaaactatatgaaaagaaagaataaaatcgtctatttagataaatgttaccgacgagtaacttatctttgcggttacttgttggtaacattaagtaa
Predict TransTerm conf > 70================================================

Find igs database================================================
Query_seq: PI0557:PI0558|PI0557:PI0558:conserved hypothetical protein:probable transcriptional regulator, TetR family:->->:506945..507175 231
tgctacaaagttacattaaaaggtgtgaatgcccaaaatatttcaccatttttttgcttattgcgagccttgcaatgcattctatccataataagaaataaatcagaatactttaaaaatccttgtatgttcgttaaactatatgaaaagaaagaataaaatcgtctatttagataaatgttaccgacgagtaacttatctttgcggttacttgttggtaacattaagtaa
Intra-Species Hit: Count: 1	Min: 1	Max: 231	Len: 231
Subject: pint_PI0557_PI0558|conserved hypothetical protein:probable transcriptional regulator, TetR family|POSITIVE:POSITIVE|[506945,507175]|231
HSP  1	e-value: 1.0E-115	bit: 416.0	Len: 231	Query Start:1	Query End:231	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 231
tgctacaaagttacattaaaaggtgtgaatgcccaaaatatttcaccannnnnnngcttattgcgagccttgcaatgcattctatccataataagaaataaatcagaatactttaaaaatccttgtatgttcgttaaactatatgaaaagaaagaataaaatcgtctatttagataaatgttaccgacgagtaacttatctttgcggttacttgttggtaacattaagtaa
tgctacaaagttacattaaaaggtgtgaatgcccaaaatatttcaccatttttttgcttattgcgagccttgcaatgcattctatccataataagaaataaatcagaatactttaaaaatccttgtatgttcgttaaactatatgaaaagaaagaataaaatcgtctatttagataaatgttaccgacgagtaacttatctttgcggttacttgttggtaacattaagtaa

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UGCUACAAAGUUACAUUAAAAGGUGUGAAUGCCCAAAAUAUUUCACCAUUUUUUUGCUUAUUGCGAGCCUUGCAAUGCAUUCUAUCCAUAAUAAGAAAUAAAUCAGAAUACUUUAAAAAUCCUUGUAUGUUCGUUAAACUAUAUGAAAAGAAAGAAUAAAAUCGUCUAUUUAGAUAAAUGUUACCGACGAGUAACUUAUCUUUGCGGUUACUUGUUGGUAACAUUAAGUAA
((((..(((((..........((...((((((.(((((.............)))))...(((((((...)))))))))))))...)).......((......)).....))))).......(((.....(((((........)))))....))).........((((....)))).((((((((((((((((((((.........)))))))))))))))))))).)))). (-46.82)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UUACUUAAUGUUACCAACAAGUAACCGCAAAGAUAAGUUACUCGUCGGUAACAUUUAUCUAAAUAGACGAUUUUAUUCUUUCUUUUCAUAUAGUUUAACGAACAUACAAGGAUUUUUAAAGUAUUCUGAUUUAUUUCUUAUUAUGGAUAGAAUGCAUUGCAAGGCUCGCAAUAAGCAAAAAAAUGGUGAAAUAUUUUGGGCAUUCACACCUUUUAAUGUAACUUUGUAGCA
......(((((((((.((.((((((...........)))))).)).)))))))))........(((((........................))))).......(((((((...........((((((.(((((........)))))))))))((((((.((((...((.....)).........(((((............))))).)))).))))))..)))))))... (-40.76)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
313	89	45	231	183	pint:PI0092|5end_regulatory_protein_RecX_89080..89310_POSITIVE
312	230	185	221	170	pint:PI1833|5end_bacterioferritin_comigratory_protein_1773957..1774187_POSITIVE
283	90	46	80	43	pint:PI0339|5end_hypothetical_protein_315735..315965_POSITIVE
273	83	43	169	118	pint:PI0463|5end_50S_ribosomal_protein_L2_434158..434388_POSITIVE
268	68	21	178	139	pint:PI2091|5end_DNA_processing_protein_2048019..2048249_POSITIVE
268	66	21	82	40	pint:PI0592|5end_DNA_mismatch_repair_protein_540795..541025_POSITIVE
265	79	43	51	9	pint:PI1845|5end_hypothetical_protein_1791457..1791687_POSITIVE
265	89	41	91	50	pint:PI0270|5end_conserved_hypothetical_protein_261388..261618_POSITIVE
264	69	21	151	104	pint:PI2131|5end_hypothetical_protein_2080678..2080908_POSITIVE
263	88	43	60	7	pint:PI0308|5end_conserved_hypothetical_protein_290587..290817_POSITIVE
261	78	52	37	5	pint:PI2141|5end_hypothetical_protein_2087169..2087399_POSITIVE
261	78	52	215	183	pint:PI1437|5end_hypothetical_protein_1356088..1356318_POSITIVE
261	78	52	88	56	pint:PI1436|5end_hypothetical_protein_1355961..1356191_POSITIVE
261	78	52	36	4	pint:PI1064|5end_hypothetical_protein_983071..983301_POSITIVE
259	218	172	56	16	pint:PI0763|5end_thymidine_kinase_697317..697547_POSITIVE
256	212	173	173	131	pint:PI1834|5end_anaerobic_C4-dicarboxylate_membrane_transporter_1774861..1775091_POSITIVE
254	87	42	62	29	pint:PI0839|5end_conserved_hypothetical_protein_773843..774073_POSITIVE
254	82	41	204	168	pint:PI0729|5end_integrase_661428..661658_POSITIVE
253	99	61	199	160	pint:PI0418|5end_hypothetical_protein_386666..386896_POSITIVE
253	99	61	84	45	pint:PI0420|5end_hypothetical_protein_386551..386781_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
360	214	179	150	112	pint:PI1554|3end_hypothetical_protein_1470483..1470633_POSITIVE
306	69	22	150	103	pint:PI0601|3end_hypothetical_protein_549020..549170_POSITIVE
268	68	21	145	106	pint:PI2090|3end_thioesterase_family_protein_2048066..2048216_POSITIVE
265	89	41	103	62	pint:PI0269|3end_conserved_hypothetical_protein_261480..261630_POSITIVE
264	69	21	104	57	pint:PI2130|3end_DNA_polymerase_I_2080711..2080861_POSITIVE
263	88	43	60	7	pint:PI0307|3end_RNA_polymerase_sigma-70_factor,_ECF_subfamily_290667..290817_POSITIVE
254	87	42	66	33	pint:PI0838|3end_DNA_replication_and_repair_protein_773927..774077_POSITIVE
252	84	43	117	64	pint:PI0866|3end_hypothetical_protein_803993..804143_POSITIVE
248	219	177	111	61	pint:PI1700|3end_hypothetical_protein_1619243..1619393_POSITIVE
243	77	44	142	94	pint:PI1527|3end_immunoreactive_46_kDa_antigen_PG99_1449520..1449670_POSITIVE
239	73	39	59	25	pint:PI1227|3end_conserved_hypothetical_protein;_possible_DNA-binding_protein,_histone-like_family_1148974..1149124_POSITIVE
237	78	47	143	108	pint:PI1521|3end_hypothetical_protein_1441461..1441611_POSITIVE
237	78	47	52	17	pint:PI1520|3end_hypothetical_protein_1441370..1441520_POSITIVE
237	217	173	127	81	pint:PI0708|3end_conserved_hypothetical_protein_646234..646384_POSITIVE
237	94	61	151	121	pint:PI0416|3end_hypothetical_protein_386707..386857_POSITIVE
236	90	46	136	99	pint:PI1633|3end_hypothetical_protein_1552955..1553105_POSITIVE
234	59	21	63	26	pint:PI1485|3end_hypothetical_protein_1405339..1405489_POSITIVE
233	227	203	103	77	pint:PI0184|3end_possible_fibronectin_type_III_domain_protein_176516..176666_POSITIVE
232	218	172	63	23	pint:PI0792|3end_conserved_hypothetical_protein_729627..729777_POSITIVE
231	220	173	68	16	pint:PI2069|3end_ISPg3-related_transposase,_C-terminal_fragment_2029340..2029490_POSITIVE