Origin IGS:
cataatatatcagttttaatccttattaggataaatgaaaaaagaccaccgcaacaagtttgttcttgcggtggtcttactctttccgttcgctttagcagcgttgggaaatgctaacgggggaaagacacccgcccttaggattgtggggaatggctgttggagccacaccgagtttcgttttttgtta
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
taacaaaaaacgaaactcggtgtggctccaacagccattccccacaatcctaagggcgggtgtctttcccccgttagcatttcccaacgctgctaaagcgaacggaaagagtaagaccaccgcaagaacaaacttgttgcggtggtcttttttcatttatcctaataaggattaaaactgatatattatg

Mask Tandem Repeat Region ================================================
cataatatatcagttttaatccttattaggataaatgaaaaaagaccaccgcaacaagtttgttcttgcggtggtcttactctttccgttcgctttagcagcgttgggaaatgctaacgggggaaagacacccgcccttaggattgtggggaatggctgttggagccacaccgagtttcgttttttgtta

Find is-nt database================================================
Query_seq: PI0121:PI0122|PI0121:PI0122:outer membrane protein, ompH family:outer membrane protein, ompH family:->->:113269..113458 190
cataatatatcagttttaatccttattaggataaatgaaaaaagaccaccgcaacaagtttgttcttgcggtggtcttactctttccgttcgctttagcagcgttgggaaatgctaacgggggaaagacacccgcccttaggattgtggggaatggctgttggagccacaccgagtttcgttttttgtta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: PI0121:PI0122|PI0121:PI0122:outer membrane protein, ompH family:outer membrane protein, ompH family:->->:113269..113458 190
cataatatatcagttttaatccttattaggataaatgaaaaaagaccaccgcaacaagtttgttcttgcggtggtcttactctttccgttcgctttagcagcgttgggaaatgctaacgggggaaagacacccgcccttaggattgtggggaatggctgttggagccacaccgagtttcgttttttgtta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: PI0121:PI0122|PI0121:PI0122:outer membrane protein, ompH family:outer membrane protein, ompH family:->->:113269..113458 190
cataatatatcagttttaatccttattaggataaatgaaaaaagaccaccgcaacaagtttgttcttgcggtggtcttactctttccgttcgctttagcagcgttgggaaatgctaacgggggaaagacacccgcccttaggattgtggggaatggctgttggagccacaccgagtttcgttttttgtta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

cataatatatcagttttaatccttattaggataaatgaaaaaagaccaccgcaacaagtttgttcttgcggtggtcttactctttccgttcgctttagcagcgttgggaaatgctaacgggggaaagacacccgcccttaggattgtggggaatggctgttggagccacaccgagtttcgttttttgtta
Predict ORF larger than 30AA ================================================
Protein_Len: 36	Strand: +	Start: 7	End: 114
...... M  S  V  L  I  L  I  R  I  N  E  K  R  P  P  Q  Q  V  C  S  C  G  G  L  T  L  S  V  R  F  S  S  V  G  K  C ............................................................................
Protein_Len: 52	Strand: +	Start: 35	End: 190
.................................. M  K  K  D  H  R  N  K  F  V  L  A  V  V  L  L  F  P  F  A  L  A  A  L  G  N  A  N  G  G  K  T  P  A  L  R  I  V  G  N  G  C  W  S  H  T  E  F  R  F  L  L 
Protein_Len: 51	Strand: -	Start: 19	End: 171
.................. D  K  N  P  Y  I  F  F  S  W  R  L  L  N  T  R  A  T  T  K  S  K  G  N  A  K  A  A  N  P  F  A  L  P  P  F  V  G  A  R  L  I  T  P  F  P  Q  Q  L  W  M ...................
Protein_Len: 33	Strand: -	Start: 3	End: 101
.. L  I  D  T  K  I  R  I  L  I  F  S  F  L  G  G  C  C  T  Q  E  Q  P  P  R  V  R  E  T  R  K  L  M .........................................................................................

cataatatatcagttttaatccttattaggataaatgaaaaaagaccaccgcaacaagtttgttcttgcggtggtcttactctttccgttcgctttagcagcgttgggaaatgctaacgggggaaagacacccgcccttaggattgtggggaatggctgttggagccacaccgagtttcgttttttgtta
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

cataatatatcagttttaatccttattaggataaatgaaaaaagaccaccgcaacaagtttgttcttgcggtggtcttactctttccgttcgctttagcagcgttgggaaatgctaacgggggaaagacacccgcccttaggattgtggggaatggctgttggagccacaccgagtttcgttttttgtta
Predict TransTerm conf > 70================================================
TransTerm Strand: +	Conf: 68	HP_score: -7.2	Tail_Score: -3.79481	Start: 38	End: 82	Full_Region: TTATTAGGATAAATG AAAAAAGACCACCGCAACAA GTTTG TTCTTGCGGTGGTCTTACTC TTTCCGTTCGCTTTA
.....................................AAAAAAGACCACCGCAACAAGTTTGTTCTTGCGGTGGTCTTACTC............................................................................................................
TransTerm Strand: -	Conf: 100	HP_score: -15.0	Tail_Score: -5.42514	Start: 44	End: 76	Full_Region: gaacggaaagagtaa gaccaccgcaagaa caaac ttgttgcggtggtc ttttttcatttatcc
...........................................gaccaccgcaagaacaaacttgttgcggtggtc..................................................................................................................

Find igs database================================================
Query_seq: PI0121:PI0122|PI0121:PI0122:outer membrane protein, ompH family:outer membrane protein, ompH family:->->:113269..113458 190
cataatatatcagttttaatccttattaggataaatgaaaaaagaccaccgcaacaagtttgttcttgcggtggtcttactctttccgttcgctttagcagcgttgggaaatgctaacgggggaaagacacccgcccttaggattgtggggaatggctgttggagccacaccgagtttcgttttttgtta
Intra-Species Hit: Count: 1	Min: 1	Max: 190	Len: 190
Subject: pint_PI0121_PI0122|outer membrane protein, ompH family:outer membrane protein, ompH family|POSITIVE:POSITIVE|[113269,113458]|190
HSP  1	e-value: 1.0E-104	bit: 377.0	Len: 190	Query Start:1	Query End:190	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 190
cataatatatcagttttaatccttattaggataaatgaaaaaagaccaccgcaacaagtttgttcttgcggtggtcttactctttccgttcgctttagcagcgttgggaaatgctaacgggggaaagacacccgcccttaggattgtggggaatggctgttggagccacaccgagtttcgttttttgtta
cataatatatcagttttaatccttattaggataaatgaaaaaagaccaccgcaacaagtttgttcttgcggtggtcttactctttccgttcgctttagcagcgttgggaaatgctaacgggggaaagacacccgcccttaggattgtggggaatggctgttggagccacaccgagtttcgttttttgtta

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
CAUAAUAUAUCAGUUUUAAUCCUUAUUAGGAUAAAUGAAAAAAGACCACCGCAACAAGUUUGUUCUUGCGGUGGUCUUACUCUUUCCGUUCGCUUUAGCAGCGUUGGGAAAUGCUAACGGGGGAAAGACACCCGCCCUUAGGAUUGUGGGGAAUGGCUGUUGGAGCCACACCGAGUUUCGUUUUUUGUUA
..(((((...........(((((....)))))((((((((.(((((((((((((((....)))...))))))))))))..(((((((....((....))..((((((......))))))..)))))))..(((((((...))...)))))...(((((.....))))).......))))))))..))))) (-58.70)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UAACAAAAAACGAAACUCGGUGUGGCUCCAACAGCCAUUCCCCACAAUCCUAAGGGCGGGUGUCUUUCCCCCGUUAGCAUUUCCCAACGCUGCUAAAGCGAACGGAAAGAGUAAGACCACCGCAAGAACAAACUUGUUGCGGUGGUCUUUUUUCAUUUAUCCUAAUAAGGAUUAAAACUGAUAUAUUAUG
..................((.((((((.....)))))).))....((((((..(((.(((......)))))).((((..(((((...((((.....))))...)))))(((.(((((((((((((.((.....)).)))))))))))))..))).......))))..))))))................. (-59.50)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
390	135	92	84	26	pint:PI1799|5end_30S_ribosomal_protein_S2_1732900..1733130_POSITIVE
373	139	91	203	166	pint:PI2134|5end_hypothetical_protein_2082269..2082499_POSITIVE
364	159	113	211	165	pint:PI0258|5end_conjugative_transposon_protein,_TraG_249722..249952_POSITIVE
357	167	121	62	15	pint:PI2086|5end_signal_peptidase_I_2041835..2042065_POSITIVE
357	85	41	169	130	pint:PI1495|5end_conserved_hypothetical_protein_1414432..1414662_POSITIVE
351	175	133	178	124	pint:PI0132|5end_hypothetical_protein_123783..124013_POSITIVE
344	189	141	214	168	pint:PI0051|5end_hypothetical_protein_52607..52837_POSITIVE
340	150	101	198	149	pint:PI0222|5end_conserved_hypothetical_protein_217808..218038_POSITIVE
336	160	112	227	177	pint:PI0655|5end_Na+/H+_anitporter_597290..597520_POSITIVE
336	164	127	73	41	pint:PI0247|5end_conjugative_transposon_protein,_TraA_245373..245603_POSITIVE
334	127	81	175	127	pint:PI1343|5end_conserved_hypothetical_protein_1257782..1258012_POSITIVE
333	150	102	95	52	pint:PI1980|5end_conserved_hypothetical_protein_1937470..1937700_POSITIVE
331	130	87	190	130	pint:PI0941|5end_hypothetical_protein_874443..874673_POSITIVE
330	175	133	76	29	pint:PI1916|5end_conserved_hypothetical_protein_1860211..1860441_POSITIVE
329	180	132	110	39	pint:PI1547|5end_hypothetical_protein_1465808..1466038_POSITIVE
328	180	132	165	125	pint:PI1575|5end_LemA_protein_1501143..1501373_POSITIVE
328	160	111	64	14	pint:PI1446|5end_conserved_hypothetical_protein_1369027..1369257_POSITIVE
326	180	134	216	169	pint:PI1528|5end_hypothetical_protein_1449685..1449915_POSITIVE
325	88	46	198	149	pint:PI0355|5end_probable__N-acetylmuramoyl-L-alanine_amidase_326157..326387_POSITIVE
324	167	121	201	149	pint:PI0281|5end_conserved_hypothetical_protein_266309..266539_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
505	78	42	49	13	pint:PI0121|3end_outer_membrane_protein,_ompH_family_113208..113358_POSITIVE
382	188	145	146	83	pint:PI1686|3end_hypothetical_protein_1601898..1602048_POSITIVE
373	137	92	98	45	pint:PI2129|3end_octaprenyl-diphosphate_synthase_2077721..2077871_POSITIVE
351	179	131	109	41	pint:PI1503|3end_30S_ribosomal_protein_S15_1423780..1423930_POSITIVE
341	105	61	150	92	pint:PI2122|3end_conserved_hypothetical_protein_2070480..2070630_POSITIVE
340	180	132	148	103	pint:PI1128|3end_probable_yrdC_domain_protein,_translation_factor_(SUA5)_1055055..1055205_POSITIVE
340	150	101	106	57	pint:PI0221|3end_DNA_methylase,_site-specific_DNA-methyltransferase_(adenine-specific)_217796..217946_POSITIVE
339	160	112	150	107	pint:PI0865|3end_possible_phosphoglycerol_transferase_803684..803834_POSITIVE
336	160	112	80	30	pint:PI0654|3end_K+-dependent_Na+/Ca+_exchanger_related-protein_597223..597373_POSITIVE
334	127	81	112	64	pint:PI1342|3end_conserved_hypothetical_protein_1257799..1257949_POSITIVE
331	130	87	96	36	pint:PI0940|3end_ribonuclease_G_874429..874579_POSITIVE
324	176	140	69	31	pint:PI2167|3end_hypothetical_protein_2111891..2112041_POSITIVE
323	109	62	64	9	pint:PI0996|3end_hypothetical_protein_920660..920810_POSITIVE
319	109	61	124	81	pint:PI0513|3end_ion_transporter_472371..472521_POSITIVE
318	99	51	76	27	pint:PI0683|3end_hypothetical_protein_619797..619947_POSITIVE
316	109	67	43	1	pint:PI0040|3end_conserved_hypothetical_protein_(possible_integral_membrane_protein)_41872..42022_POSITIVE
313	157	115	95	65	pint:PI2028|3end_shikimate_kinase_1982802..1982952_POSITIVE
312	174	131	46	1	pint:PI1924|3end_cytidine_deaminase_1866495..1866645_POSITIVE
311	138	92	111	67	pint:PI1794|3end_conserved_hypothetical_protein_1726696..1726846_POSITIVE
307	187	156	53	22	pint:PI0337|3end_hypothetical_protein_315402..315552_POSITIVE