Origin IGS:
taaacgagaatggagaagataaatgccattatcactggtatcggcggctatgtacccgactatgtcctcaccaacgaggaattgtcgcgtatggtcgacaccaccgatgaatggattatggaacgtgtgggcatcaaggaacgccgtatcttaaccgaggagggacttggtacaagctat
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
atagcttgtaccaagtccctcctcggttaagatacggcgttccttgatgcccacacgttccataatccattcatcggtggtgtcgaccatacgcgacaattcctcgttggtgaggacatagtcgggtacatagccgccgataccagtgataatggcatttatcttctccattctcgttta

Mask Tandem Repeat Region ================================================
taaacgagaatggagaagataaatgccattatcactggtatcggcggctatgtacccgactatgtcctcaccaacgaggaattgtcgcgtatggtcgacaccaccgatgaatggattatggaacgtgtgggcatcaaggaacgccgtatcttaaccgaggagggacttggtacaagctat

Find is-nt database================================================
Query_seq: PI1704:PI1705|PI1704:PI1705:50S ribosomal protein L32:3-oxoacyl-(acyl-carrier-protein) synthase III:->->:1621741..1621920 180
taaacgagaatggagaagataaatgccattatcactggtatcggcggctatgtacccgactatgtcctcaccaacgaggaattgtcgcgtatggtcgacaccaccgatgaatggattatggaacgtgtgggcatcaaggaacgccgtatcttaaccgaggagggacttggtacaagctat
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: PI1704:PI1705|PI1704:PI1705:50S ribosomal protein L32:3-oxoacyl-(acyl-carrier-protein) synthase III:->->:1621741..1621920 180
taaacgagaatggagaagataaatgccattatcactggtatcggcggctatgtacccgactatgtcctcaccaacgaggaattgtcgcgtatggtcgacaccaccgatgaatggattatggaacgtgtgggcatcaaggaacgccgtatcttaaccgaggagggacttggtacaagctat
Intra-Species Hit: Count: 0

Inter-species Hit: Count: 1	Min: 31	Max: 150	Len: 120
Subject: gi|89107937|ref|AP_001717.1| 3-oxoacyl-[acyl-carrier-protein] synthase III [Escherichia coli W3110]
HSP  1	e-value: 3.0E-8	bit: 53.9	Len: 120	Query Start:31	Query End:150	Subject Strand: null	Subject Start: 5	Subject End: 44
.............................. I  T  G  I  G  G  Y  V  P  D  Y  V  L  T  N  E  E  L  S  R  M  V  D  T  T  D  E  W  I  M  E  R  V  G  I  K  E  R  R  I ..............................
.............................. I  I  G  T  G  S  Y  L  P  E  Q  V  R  T  N  A  D  L  E  K  M  V  D  T  S  D  E  W  I  V  T  R  T  G  I  R  E  R  H  I ..............................


Find nr database================================================
Query_seq: PI1704:PI1705|PI1704:PI1705:50S ribosomal protein L32:3-oxoacyl-(acyl-carrier-protein) synthase III:->->:1621741..1621920 180
taaacgagaatggagaagataaatgccattnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnttaaccgaggagggacttggtacaagctat
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

taaacgagaatggagaagataaatgccattnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnttaaccgaggagggacttggtacaagctat
Predict ORF larger than 30AA ================================================
Protein_Len: 43	Strand: +	Start: 23	End: 151
...................... M  P  L  S  L  V  S  A  A  M  Y  P  T  M  S  S  P  T  R  N  C  R  V  W  S  T  P  P  M  N  G  L  W  N  V  W  A  S  R  N  A  V  S .............................
Protein_Len: 57	Strand: +	Start: 10	End: 180
......... M  E  K  I  N  A  I  I  T  G  I  G  G  Y  V  P  D  Y  V  L  T  N  E  E  L  S  R  M  V  D  T  T  D  E  W  I  M  E  R  V  G  I  K  E  R  R  I  L  T  E  E  G  L  G  T  S  Y 
Protein_Len: 36	Strand: -	Start: 1	End: 108
 L  R  S  H  L  L  Y  I  G  N  D  S  T  D  A  A  I  Y  G  V  I  D  E  G  V  L  F  Q  R  T  H  D  V  G  G  M ........................................................................

taaacgagaatggagaagataaatgccattnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnttaaccgaggagggacttggtacaagctat
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

taaacgagaatggagaagataaatgccattnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnttaaccgaggagggacttggtacaagctat
Predict TransTerm conf > 70================================================
TransTerm Strand: +	Conf: 43	HP_score: -3.6	Tail_Score: -2.78384	Start: 55	End: 89	Full_Region: ATCGGCGGCTATGTA CCCGACTATGTCCTC ACCAAC GAGGAATTGTCGCG TATGGTCGACACCAC
......................................................CCCGACTATGTCCTCACCAACGAGGAATTGTCGCG...........................................................................................

Find igs database================================================
Query_seq: PI1704:PI1705|PI1704:PI1705:50S ribosomal protein L32:3-oxoacyl-(acyl-carrier-protein) synthase III:->->:1621741..1621920 180
taaacgagaatggagaagataaatgccattnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnttaaccgaggagggacttggtacaagctat
Intra-Species Hit: Count: 1	Min: 1	Max: 180	Len: 180
Subject: pint_PI1704_PI1705|50S ribosomal protein L32:3-oxoacyl-(acyl-carrier-protein) synthase III|POSITIVE:POSITIVE|[1621741,1621920]|180
HSP  1	e-value: 3.0E-8	bit: 60.0	Len: 30	Query Start:1	Query End:30	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 30
taaacgagaatggagaagataaatgccatt......................................................................................................................................................
taaacgagaatggagaagataaatgccatt......................................................................................................................................................
HSP  2	e-value: 3.0E-8	bit: 60.0	Len: 30	Query Start:151	Query End:180	Subject Strand: POSITIVE	Subject Start: 151	Subject End: 180
......................................................................................................................................................ttaaccgaggagggacttggtacaagctat
......................................................................................................................................................ttaaccgaggagggacttggtacaagctat

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UAAACGAGAAUGGAGAAGAUAAAUGCCAUUAUCACUGGUAUCGGCGGCUAUGUACCCGACUAUGUCCUCACCAACGAGGAAUUGUCGCGUAUGGUCGACACCACCGAUGAAUGGAUUAUGGAACGUGUGGGCAUCAAGGAACGCCGUAUCUUAACCGAGGAGGGACUUGGUACAAGCUAU
.....((.(((((............))))).))...((((.(((((.....((((.((((....(((((......)))))...)))).)))).(((.((((..((.((((.....))))))...)))).))).........)))))))))...((((((......))))))......... (-52.10)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
AUAGCUUGUACCAAGUCCCUCCUCGGUUAAGAUACGGCGUUCCUUGAUGCCCACACGUUCCAUAAUCCAUUCAUCGGUGGUGUCGACCAUACGCGACAAUUCCUCGUUGGUGAGGACAUAGUCGGGUACAUAGCCGCCGAUACCAGUGAUAAUGGCAUUUAUCUUCUCCAUUCUCGUUUA
...(((((...)))))........((..((((((.((((((....))))))...............(((((.((((.((((((((........((((.((((((((....)))))).)).))))(((.....)))..)))))))).)))))))))....))))))..))........... (-51.10)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
455	96	55	96	50	pint:PI1230|5end_probable_metallo-beta-lactamase_family_protein_1151840..1152070_POSITIVE
392	77	31	66	15	pint:PI0814|5end_conserved_hypothetical_protein_752946..753176_POSITIVE
387	167	124	57	12	pint:PI1636|5end_hypothetical_protein_1554246..1554476_POSITIVE
379	139	96	53	1	pint:PI0792|5end_conserved_hypothetical_protein_729068..729298_POSITIVE
376	69	24	112	68	pint:PI0093|5end_riboflavin_biosynthesis_protein_90489..90719_POSITIVE
376	147	102	57	7	pint:PI0028|5end_aminopeptidase_31559..31789_POSITIVE
355	64	21	109	59	pint:PI0824|5end_large_conductance_mechanosensitive_channel_protein_763337..763567_POSITIVE
355	86	43	209	165	pint:PI0784|5end_possible_amidase_enhancer_precursor_721892..722122_POSITIVE
353	87	43	183	144	pint:PI0715|5end_hypothetical_protein_652311..652541_POSITIVE
350	168	125	201	161	pint:PI0370|5end_conserved_hypothetical_protein_340453..340683_POSITIVE
349	60	11	134	64	pint:PI0432|5end_hypothetical_protein_404781..405011_POSITIVE
349	60	11	77	7	pint:PI0433|5end_hypothetical_protein_404724..404954_POSITIVE
345	146	101	72	28	pint:PI0273|5end_hypothetical_protein_262956..263186_POSITIVE
343	90	41	61	5	pint:PI0129|5end_hypothetical_protein_121709..121939_POSITIVE
339	170	123	87	42	pint:PI0384|5end_probable_radical_SAM_domain_protein_352884..353114_POSITIVE
337	100	56	90	38	pint:PI0718|5end_hypothetical_protein_653725..653955_POSITIVE
336	99	61	177	134	pint:PI2079|5end_conserved_hypothetical_protein;_possible_ATPase_2036715..2036945_POSITIVE
333	166	123	185	125	pint:PI1708|5end_hypothetical_protein_1625087..1625317_POSITIVE
332	75	34	223	173	pint:PI2011|5end_hypothetical_protein_1970429..1970659_POSITIVE
330	80	36	70	24	pint:PI0282|5end_hypothetical_protein_266540..266770_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
414	148	106	150	97	pint:PI1378|3end_GTP-binding_protein_lepA_1301651..1301801_POSITIVE
401	139	92	111	53	pint:PI0790|3end_hypothetical_protein_729206..729356_POSITIVE
376	69	24	54	10	pint:PI0094|3end_protoporphyrinogen_oxidase_90511..90661_POSITIVE
368	136	102	148	96	pint:PI0130|3end_hypothetical_protein_122267..122417_POSITIVE
350	168	125	77	37	pint:PI0369|3end_hypothetical_protein_340409..340559_POSITIVE
350	169	123	103	49	pint:PI0301|3end_probable_transposase_285982..286132_POSITIVE
343	90	41	98	42	pint:PI0128|3end_dipeptidase,_pathogenicity_island-encoded_protein_D_121826..121976_POSITIVE
339	89	42	139	100	pint:PI0345|3end_conserved_hypothetical_protein_320809..320959_POSITIVE
333	88	43	51	3	pint:PI1223|3end_conserved_hypothetical_protein_1144459..1144609_POSITIVE
332	147	104	73	31	pint:PI1437|3end_hypothetical_protein_1356407..1356557_POSITIVE
330	80	36	54	8	pint:PI0281|3end_conserved_hypothetical_protein_266604..266754_POSITIVE
324	76	38	139	89	pint:PI0955|3end_conserved_hypothetical_protein_886084..886234_POSITIVE
322	117	75	76	29	pint:PI0838|3end_DNA_replication_and_repair_protein_773927..774077_POSITIVE
311	138	103	141	109	pint:PI1416|3end_cation-transporting_ATPase_1336190..1336340_POSITIVE
310	170	125	60	19	pint:PI1365|3end_conserved_hypothetical_protein;_probable_transmembrane_protein_1285675..1285825_POSITIVE
310	158	113	119	70	pint:PI0421|3end_hypothetical_protein_387774..387924_POSITIVE
307	89	46	149	96	pint:PI0726|3end_hypothetical_protein_659253..659403_POSITIVE
305	170	124	73	36	pint:PI0654|3end_K+-dependent_Na+/Ca+_exchanger_related-protein_597223..597373_POSITIVE
304	90	42	76	26	pint:PI0220|3end_conserved_hypothetical_protein_212341..212491_POSITIVE
299	87	41	150	106	pint:PI0351|3end_hypothetical_protein_324768..324918_POSITIVE