Origin IGS:
acatgtccaactaattggatgaatttgtccagctcattagactcgtctgtccaacttattggacaagtgtgtccaatttgcacgaacgtcatacatgctgtaagccatatgctgttgctgtttgccataatcctttgcgagcgattggtgtaggggtatcattgccgttctta
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
taagaacggcaatgatacccctacaccaatcgctcgcaaaggattatggcaaacagcaacagcatatggcttacagcatgtatgacgttcgtgcaaattggacacacttgtccaataagttggacagacgagtctaatgagctggacaaattcatccaattagttggacatgt

Mask Tandem Repeat Region ================================================
acatgtccaactaattggatgaatttgtccagctcattagactcgtctgtccaacttattggacaagtgtgtccaatttgcacgaacgtcatacatgctgtaagccatatgctgttgctgtttgccataatcctttgcgagcgattggtgtaggggtatcattgccgttctta

Find is-nt database================================================
Query_seq: PI0733:PI0734|PI0733:PI0734:membrane protein; predicted exporter:ABC transporter, ATP-binding / permease:->->:667019..667191 173
acatgtccaactaattggatgaatttgtccagctcattagactcgtctgtccaacttattggacaagtgtgtccaatttgcacgaacgtcatacatgctgtaagccatatgctgttgctgtttgccataatcctttgcgagcgattggtgtaggggtatcattgccgttctta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: PI0733:PI0734|PI0733:PI0734:membrane protein; predicted exporter:ABC transporter, ATP-binding / permease:->->:667019..667191 173
acatgtccaactaattggatgaatttgtccagctcattagactcgtctgtccaacttattggacaagtgtgtccaatttgcacgaacgtcatacatgctgtaagccatatgctgttgctgtttgccataatcctttgcgagcgattggtgtaggggtatcattgccgttctta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: PI0733:PI0734|PI0733:PI0734:membrane protein; predicted exporter:ABC transporter, ATP-binding / permease:->->:667019..667191 173
acatgtccaactaattggatgaatttgtccagctcattagactcgtctgtccaacttattggacaagtgtgtccaatttgcacgaacgtcatacatgctgtaagccatatgctgttgctgtttgccataatcctttgcgagcgattggtgtaggggtatcattgccgttctta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

acatgtccaactaattggatgaatttgtccagctcattagactcgtctgtccaacttattggacaagtgtgtccaatttgcacgaacgtcatacatgctgtaagccatatgctgttgctgtttgccataatcctttgcgagcgattggtgtaggggtatcattgccgttctta
Predict ORF larger than 30AA ================================================
Protein_Len: 44	Strand: +	Start: 19	End: 150
.................. M  N  L  S  S  S  L  D  S  S  V  Q  L  I  G  Q  V  C  P  I  C  T  N  V  I  H  A  V  S  H  M  L  L  L  F  A  I  I  L  C  E  R  L  V .......................
Protein_Len: 53	Strand: +	Start: 15	End: 173
.............. M  D  E  F  V  Q  L  I  R  L  V  C  P  T  Y  W  T  S  V  S  N  L  H  E  R  H  T  C  C  K  P  Y  A  V  A  V  C  H  N  P  L  R  A  I  G  V  G  V  S  L  P  F  L 
Protein_Len: 41	Strand: -	Start: 40	End: 162
....................................... V  R  R  D  L  K  N  S  L  H  T  W  N  A  R  V  D  Y  M  S  Y  A  M  H  Q  Q  Q  K  G  Y  D  K  A  L  S  Q  H  L  P  I  M ...........
Protein_Len: 43	Strand: -	Start: 3	End: 131
.. H  G  V  L  Q  I  F  K  D  L  E  N  S  E  D  T  W  S  I  P  C  T  H  G  I  Q  V  F  T  M  C  A  T  L  W  I  S  N  S  N  A  M  M ..........................................

acatgtccaactaattggatgaatttgtccagctcattagactcgtctgtccaacttattggacaagtgtgtccaatttgcacgaacgtcatacatgctgtaagccatatgctgttgctgtttgccataatcctttgcgagcgattggtgtaggggtatcattgccgttctta
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

acatgtccaactaattggatgaatttgtccagctcattagactcgtctgtccaacttattggacaagtgtgtccaatttgcacgaacgtcatacatgctgtaagccatatgctgttgctgtttgccataatcctttgcgagcgattggtgtaggggtatcattgccgttctta
Predict TransTerm conf > 70================================================
TransTerm Strand: +	Conf: 71	HP_score: -8.5	Tail_Score: -3.53444	Start: 59	End: 76	Full_Region: CGTCTGTCCAACTTA TTGGACA AGTG TGTCCAA TTTGCACGAACGTCA
..........................................................TTGGACAAGTGTGTCCAA.................................................................................................

Find igs database================================================
Query_seq: PI0733:PI0734|PI0733:PI0734:membrane protein; predicted exporter:ABC transporter, ATP-binding / permease:->->:667019..667191 173
acatgtccaactaattggatgaatttgtccagctcattagactcgtctgtccaacttattggacaagtgtgtccaatttgcacgaacgtcatacatgctgtaagccatatgctgttgctgtttgccataatcctttgcgagcgattggtgtaggggtatcattgccgttctta
Intra-Species Hit: Count: 1	Min: 1	Max: 173	Len: 173
Subject: pint_PI0733_PI0734|membrane protein; predicted exporter:ABC transporter, ATP-binding / permease|POSITIVE:POSITIVE|[667019,667191]|173
HSP  1	e-value: 1.0E-93	bit: 343.0	Len: 173	Query Start:1	Query End:173	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 173
acatgtccaactaattggatgaatttgtccagctcattagactcgtctgtccaacttattggacaagtgtgtccaatttgcacgaacgtcatacatgctgtaagccatatgctgttgctgtttgccataatcctttgcgagcgattggtgtaggggtatcattgccgttctta
acatgtccaactaattggatgaatttgtccagctcattagactcgtctgtccaacttattggacaagtgtgtccaatttgcacgaacgtcatacatgctgtaagccatatgctgttgctgtttgccataatcctttgcgagcgattggtgtaggggtatcattgccgttctta

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
ACAUGUCCAACUAAUUGGAUGAAUUUGUCCAGCUCAUUAGACUCGUCUGUCCAACUUAUUGGACAAGUGUGUCCAAUUUGCACGAACGUCAUACAUGCUGUAAGCCAUAUGCUGUUGCUGUUUGCCAUAAUCCUUUGCGAGCGAUUGGUGUAGGGGUAUCAUUGCCGUUCUUA
....((((((....))))))...........((..(((.(((.((..(((((((....)))))))..)).))).)))..))..(((((.((...(((((.(..((((...((....)).((((((...........))))))...))))...).)))))...)).)))))... (-46.20)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UAAGAACGGCAAUGAUACCCCUACACCAAUCGCUCGCAAAGGAUUAUGGCAAACAGCAACAGCAUAUGGCUUACAGCAUGUAUGACGUUCGUGCAAAUUGGACACACUUGUCCAAUAAGUUGGACAGACGAGUCUAAUGAGCUGGACAAAUUCAUCCAAUUAGUUGGACAUGU
...(((((((.(((((.((.....................))))))).))..(((((...(((.....)))....)).)))....)))))..((.(((((((.....(((((((....(((((((......)))))))....))))))).....))))))).))......... (-38.70)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
484	76	31	180	135	pint:PI0513|5end_ion_transporter_471530..471760_POSITIVE
437	158	112	60	14	pint:PI1650|5end_N-acetylmuramoyl-L-alanine_amidase_1563195..1563425_POSITIVE
389	158	111	216	173	pint:PI0355|5end_probable__N-acetylmuramoyl-L-alanine_amidase_326157..326387_POSITIVE
368	143	105	48	1	pint:PI0010|5end_conserved_hypothetical_protein_10628..10858_POSITIVE
363	170	125	218	171	pint:PI1279|5end_RNA_polymerase_sigma_factor/ECF_subfamily_(sigma-70)_1195215..1195445_POSITIVE
355	140	91	83	31	pint:PI1971|5end_possible_IS1249-related_transposase_1928027..1928257_POSITIVE
355	140	91	83	31	pint:PI1533|5end_conserved_hypothetical_protein;_possible_transposase_1452667..1452897_POSITIVE
355	140	91	83	31	pint:PI0534|5end_conserved_hypothetical_protein;_possible_transposase_488568..488798_POSITIVE
353	159	113	157	92	pint:PI0756|5end_50S_ribosomal_protein_L7/L12_687146..687376_POSITIVE
352	157	111	209	163	pint:PI2017|5end_conserved_hypothetical_protein_1974862..1975092_POSITIVE
351	170	127	48	3	pint:PI0034|5end_FKBP-type_peptidyl-prolyl_cis-trans_isomerase_37151..37381_POSITIVE
342	75	33	206	161	pint:PI0869|5end_possible_exodeoxyribonuclease_VII_(small_subunit)_805518..805748_POSITIVE
340	109	61	176	138	pint:PI0601|5end_hypothetical_protein_548758..548988_POSITIVE
336	127	83	214	168	pint:PI0652|5end_conserved_hypothetical_protein_592878..593108_POSITIVE
330	138	96	228	181	pint:PI1081|5end_probable_endonuclease/resolvase_1000806..1001036_POSITIVE
329	155	113	52	4	pint:PI0806|5end_heavy_metal_efflux_pump_743679..743909_POSITIVE
328	165	124	60	15	pint:PI0122|5end_outer_membrane_protein,_ompH_family_113319..113549_POSITIVE
324	158	115	193	155	pint:PI0036|5end_glutathione_peroxidase_38598..38828_POSITIVE
323	157	112	185	137	pint:PI1575|5end_LemA_protein_1501143..1501373_POSITIVE
322	150	104	76	29	pint:PI0108|5end_L-lactate_permease_104892..105122_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
354	160	111	59	16	pint:PI0114|3end_hypothetical_protein_108527..108677_POSITIVE
340	109	61	135	97	pint:PI0600|3end_bifunctional_purine_biosynthesis_protein,_5-aminoimidazole-4-carboxamide_ribonucleotide(AICAR)_transformylase/IMP_cyclohydrolase_548797..548947_POSITIVE
337	169	132	70	39	pint:PI1585|3end_ampG_permease_1514260..1514410_POSITIVE
336	127	83	151	105	pint:PI0651|3end_HD_superfamily_hydrolase_592895..593045_POSITIVE
329	155	113	100	52	pint:PI0805|3end_conserved_hypothetical_protein_743807..743957_POSITIVE
320	139	92	75	25	pint:PI2148|3end_ribonuclease_III_2095541..2095691_POSITIVE
317	118	80	137	98	pint:PI0896|3end_2-oxoglutarate_oxidoreductase,_alpha_subunit_828276..828426_POSITIVE
315	158	111	136	95	pint:PI1566|3end_predicted_TPR-repeat-containing_protein_1489224..1489374_POSITIVE
314	158	112	96	42	pint:PI2016|3end_ribosomal_large_subunit_pseudouridine_synthase_D_1974933..1975083_POSITIVE
314	160	111	148	80	pint:PI1504|3end_non-specific_DNA-binding_protein_1424904..1425054_POSITIVE
310	126	81	147	99	pint:PI1370|3end_alkyl_hydroperoxide_reductase,_subunit_F_1292176..1292326_POSITIVE
310	170	122	46	3	pint:PI0729|3end_integrase_661765..661915_POSITIVE
304	124	82	113	62	pint:PI1143|3end_hypothetical_protein_1070504..1070654_POSITIVE
304	140	96	74	26	pint:PI0056|3end_conserved_hypothetical_protein;_possible_DNA_uptake_protein_55907..56057_POSITIVE
303	78	31	100	57	pint:PI0733|3end_membrane_protein;_predicted_exporter_666958..667108_POSITIVE
300	159	111	69	27	pint:PI1253|3end_hypothetical_protein_1175691..1175841_POSITIVE
295	157	111	66	22	pint:PI0578|3end_methyltransferase_523253..523403_POSITIVE
294	120	77	69	31	pint:PI0037|3end_hypothetical_protein_39616..39766_POSITIVE
293	127	81	46	14	pint:PI1653|3end_hypothetical_protein_1565714..1565864_POSITIVE
293	157	111	122	82	pint:PI1440|3end_conserved_hypothetical_protein_1363009..1363159_POSITIVE