Origin IGS:
taaagagccgcataaggctttcattaccccacgggcaaggtgcaagaacctcgttcgtggggtatttcgtgaatatgcgaaagccgccttggcagagagtgccaaggcggctttgtttacgtttttatactttgtacaccatcttttcagttctcgaaacaaaacagtggacatggcaatgaaagatattgtca
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
tgacaatatctttcattgccatgtccactgttttgtttcgagaactgaaaagatggtgtacaaagtataaaaacgtaaacaaagccgccttggcactctctgccaaggcggctttcgcatattcacgaaataccccacgaacgaggttcttgcaccttgcccgtggggtaatgaaagccttatgcggctcttta

Mask Tandem Repeat Region ================================================
taaagagccgcataaggctttcattaccccacgggcaaggtgcaagaacctcgttcgtggggtatttcgtgaatatgcgaaagccgccttggcagagagtgccaaggcggctttgtttacgtttttatactttgtacaccatcttttcagttctcgaaacaaaacagtggacatggcaatgaaagatattgtca

Find is-nt database================================================
Query_seq: PI1223:PI1224|PI1223:PI1224:conserved hypothetical protein:sensor histidine kinase and response regulator:->->:1144520..1144713 194
taaagagccgcataaggctttcattaccccacgggcaaggtgcaagaacctcgttcgtggggtatttcgtgaatatgcgaaagccgccttggcagagagtgccaaggcggctttgtttacgtttttatactttgtacaccatcttttcagttctcgaaacaaaacagtggacatggcaatgaaagatattgtca
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: PI1223:PI1224|PI1223:PI1224:conserved hypothetical protein:sensor histidine kinase and response regulator:->->:1144520..1144713 194
taaagagccgcataaggctttcattaccccacgggcaaggtgcaagaacctcgttcgtggggtatttcgtgaatatgcgaaagccgccttggcagagagtgccaaggcggctttgtttacgtttttatactttgtacaccatcttttcagttctcgaaacaaaacagtggacatggcaatgaaagatattgtca
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: PI1223:PI1224|PI1223:PI1224:conserved hypothetical protein:sensor histidine kinase and response regulator:->->:1144520..1144713 194
taaagagccgcataaggctttcattaccccacgggcaaggtgcaagaacctcgttcgtggggtatttcgtgaatatgcgaaagccgccttggcagagagtgccaaggcggctttgtttacgtttttatactttgtacaccatcttttcagttctcgaaacaaaacagtggacatggcaatgaaagatattgtca
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

taaagagccgcataaggctttcattaccccacgggcaaggtgcaagaacctcgttcgtggggtatttcgtgaatatgcgaaagccgccttggcagagagtgccaaggcggctttgtttacgtttttatactttgtacaccatcttttcagttctcgaaacaaaacagtggacatggcaatgaaagatattgtca
Predict ORF larger than 30AA ================================================
Protein_Len: 56	Strand: +	Start: 12	End: 179
........... M  R  L  S  L  P  H  G  Q  G  A  R  T  S  F  V  G  Y  F  V  N  M  R  K  P  P  W  Q  R  V  P  R  R  L  C  L  R  F  Y  T  L  Y  T  I  F  S  V  L  E  T  K  Q  W  T  W  Q ...............
Protein_Len: 40	Strand: +	Start: 73	End: 192
........................................................................ M  C  E  S  R  L  G  R  E  C  Q  G  G  F  V  Y  V  F  I  L  C  T  P  S  F  Q  F  S  K  Q  N  S  G  H  G  N  E  R  Y  C ..
Protein_Len: 57	Strand: +	Start: 23	End: 193
...................... M  T  P  R  A  R  C  K  N  L  V  R  G  V  F  R  E  Y  A  K  A  A  L  A  E  S  A  K  A  A  L  F  T  F  L  Y  F  V  H  H  L  F  S  S  R  N  K  T  V  D  M  A  M  K  D  I  V .
Protein_Len: 60	Strand: -	Start: 1	End: 189
 C  L  A  K  M  V  G  R  A  L  H  L  F  R  T  R  P  T  N  R  S  Y  A  F  A  A  K  A  S  L  A  L  A  A  K  N  V  N  K  Y  K  T  C  W  R  K  L  E  R  F  L  V  T  S  M  A  I  F  S  M .....

taaagagccgcataaggctttcattaccccacgggcaaggtgcaagaacctcgttcgtggggtatttcgtgaatatgcgaaagccgccttggcagagagtgccaaggcggctttgtttacgtttttatactttgtacaccatcttttcagttctcgaaacaaaacagtggacatggcaatgaaagatattgtca
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

taaagagccgcataaggctttcattaccccacgggcaaggtgcaagaacctcgttcgtggggtatttcgtgaatatgcgaaagccgccttggcagagagtgccaaggcggctttgtttacgtttttatactttgtacaccatcttttcagttctcgaaacaaaacagtggacatggcaatgaaagatattgtca
Predict TransTerm conf > 70================================================
TransTerm Strand: +	Conf: 100	HP_score: -15.1	Tail_Score: -3.78022	Start: 25	End: 64	Full_Region: GCATAAGGCTTTCAT TACCCCACGGGCAAGGT GCAAGA ACCTCGTTCGTGGGGTA TTTCGTGAATATGCG
........................TACCCCACGGGCAAGGTGCAAGAACCTCGTTCGTGGGGTA..................................................................................................................................
TransTerm Strand: +	Conf: 100	HP_score: -9.4	Tail_Score: -5.06735	Start: 72	End: 121	Full_Region: GTGGGGTATTTCGTG AATATGCGAAAGCCGCCTTGGCA GAGAG TGCCAAGGCGGCTTTGTTTACG TTTTTATACTTTGTA
.......................................................................AATATGCGAAAGCCGCCTTGGCAGAGAGTGCCAAGGCGGCTTTGTTTACG.........................................................................
TransTerm Strand: +	Conf: 100	HP_score: -20.4	Tail_Score: -4.57205	Start: 83	End: 111	Full_Region: CGTGAATATGCGAAA GCCGCCTTGGCA GAGAG TGCCAAGGCGGC TTTGTTTACGTTTTT
..................................................................................GCCGCCTTGGCAGAGAGTGCCAAGGCGGC...................................................................................
TransTerm Strand: -	Conf: 100	HP_score: -20.4	Tail_Score: -3.66803	Start: 83	End: 111	Full_Region: aaaaacgtaaacaaa gccgccttggca ctctc tgccaaggcggc tttcgcatattcacg
..................................................................................gccgccttggcactctctgccaaggcggc...................................................................................

Find igs database================================================
Query_seq: PI1223:PI1224|PI1223:PI1224:conserved hypothetical protein:sensor histidine kinase and response regulator:->->:1144520..1144713 194
taaagagccgcataaggctttcattaccccacgggcaaggtgcaagaacctcgttcgtggggtatttcgtgaatatgcgaaagccgccttggcagagagtgccaaggcggctttgtttacgtttttatactttgtacaccatcttttcagttctcgaaacaaaacagtggacatggcaatgaaagatattgtca
Intra-Species Hit: Count: 1	Min: 1	Max: 194	Len: 194
Subject: pint_PI1223_PI1224|conserved hypothetical protein:sensor histidine kinase and response regulator|POSITIVE:POSITIVE|[1144520,1144713]|194
HSP  1	e-value: 1.0E-106	bit: 385.0	Len: 194	Query Start:1	Query End:194	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 194
taaagagccgcataaggctttcattaccccacgggcaaggtgcaagaacctcgttcgtggggtatttcgtgaatatgcgaaagccgccttggcagagagtgccaaggcggctttgtttacgtttttatactttgtacaccatcttttcagttctcgaaacaaaacagtggacatggcaatgaaagatattgtca
taaagagccgcataaggctttcattaccccacgggcaaggtgcaagaacctcgttcgtggggtatttcgtgaatatgcgaaagccgccttggcagagagtgccaaggcggctttgtttacgtttttatactttgtacaccatcttttcagttctcgaaacaaaacagtggacatggcaatgaaagatattgtca

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UAAAGAGCCGCAUAAGGCUUUCAUUACCCCACGGGCAAGGUGCAAGAACCUCGUUCGUGGGGUAUUUCGUGAAUAUGCGAAAGCCGCCUUGGCAGAGAGUGCCAAGGCGGCUUUGUUUACGUUUUUAUACUUUGUACACCAUCUUUUCAGUUCUCGAAACAAAACAGUGGACAUGGCAAUGAAAGAUAUUGUCA
...((((((......))))))...((((((((((((.((((......)))).))))))))))))...((((((((.....((((((((((((((.....))))))))))))))))))))))...........(((.(((.....((((.......)))).......))).))).(((((((.....))))))). (-76.20)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UGACAAUAUCUUUCAUUGCCAUGUCCACUGUUUUGUUUCGAGAACUGAAAAGAUGGUGUACAAAGUAUAAAAACGUAAACAAAGCCGCCUUGGCACUCUCUGCCAAGGCGGCUUUCGCAUAUUCACGAAAUACCCCACGAACGAGGUUCUUGCACCUUGCCCGUGGGGUAAUGAAAGCCUUAUGCGGCUCUUUA
......(((.(((...(((..(((.(((((((...(((((.....))))).))))))).)))..)))...))).)))...(((((((((((((((.....)))))))))))))))((((((.........(((((((((..((((((......))))))..)))))))))..........))))))........ (-71.21)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
539	125	81	172	132	pint:PI1230|5end_probable_metallo-beta-lactamase_family_protein_1151840..1152070_POSITIVE
470	70	25	194	146	pint:PI1227|5end_conserved_hypothetical_protein;_possible_DNA-binding_protein,_histone-like_family_1148448..1148678_POSITIVE
378	122	83	178	141	pint:PI1564|5end_surface_antigen_BspA_1483455..1483685_POSITIVE
376	109	61	95	54	pint:PI2022|5end_hypothetical_protein_1978631..1978861_POSITIVE
376	109	61	49	8	pint:PI2023|5end_hypothetical_protein_1978585..1978815_POSITIVE
376	117	77	190	156	pint:PI0667|5end_hypothetical_protein_610113..610343_POSITIVE
369	109	69	157	122	pint:PI1371|5end_hypothetical_protein_1292359..1292589_POSITIVE
369	109	69	81	46	pint:PI0659|5end_hypothetical_protein_603203..603433_POSITIVE
365	50	5	171	121	pint:PI1547|5end_hypothetical_protein_1465808..1466038_POSITIVE
365	115	78	45	7	pint:PI0858|5end_carbamyl_phosphate_synthase,_large_subunit_790093..790323_POSITIVE
361	111	77	59	27	pint:PI0265|5end_conjugative_transposon_protein,_TraO_257296..257526_POSITIVE
356	121	83	56	3	pint:PI1634|5end_conserved_hypothetical_protein_1553179..1553409_POSITIVE
356	109	75	222	190	pint:PI0991|5end_conserved_hypothetical_protein_915309..915539_POSITIVE
356	121	83	56	3	pint:PI0340|5end_conserved_hypothetical_protein_316095..316325_POSITIVE
355	80	32	176	114	pint:PI0094|5end_protoporphyrinogen_oxidase_89571..89801_POSITIVE
355	80	32	102	40	pint:PI0091|5end_hypothetical_protein_89497..89727_POSITIVE
347	70	28	161	114	pint:PI1864|5end_chromate_transport_protein_1810318..1810548_POSITIVE
346	112	76	67	25	pint:PI1729|5end_FKBP-type_peptidyl-prolyl_cis-trans_isomerase,_trigger_factor_1648416..1648646_POSITIVE
344	127	82	74	29	pint:PI1778|5end_UDP-N-acetylglucosamine_1-carboxyvinyltransferase_1710009..1710239_POSITIVE
344	110	76	203	169	pint:PI0088|5end_S-adenosylmethionine_synthetase_86663..86893_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
568	127	82	69	29	pint:PI1431|3end_conserved_hypothetical_protein_1352809..1352959_POSITIVE
482	64	25	66	27	pint:PI1223|3end_conserved_hypothetical_protein_1144459..1144609_POSITIVE
475	117	81	80	46	pint:PI1499|3end_hypothetical_protein_1420180..1420330_POSITIVE
361	111	77	54	22	pint:PI0264|3end_transfer_region-related_protein,_TraN_257371..257521_POSITIVE
353	116	77	81	43	pint:PI0005|3end_hypothetical_protein_7450..7600_POSITIVE
345	123	81	148	101	pint:PI0948|3end_hypothetical_protein_881978..882128_POSITIVE
344	127	82	66	21	pint:PI1777|3end_conserved_hypothetical_protein_1710081..1710231_POSITIVE
340	122	84	81	37	pint:PI0539|3end_hypothetical_protein_493728..493878_POSITIVE
336	118	87	41	9	pint:PI0222|3end_conserved_hypothetical_protein_218442..218592_POSITIVE
332	118	76	100	51	pint:PI1892|3end_UDP-N-acetylmuramoylalanine--D-glutamate_ligase_1835547..1835697_POSITIVE
331	130	83	47	1	pint:PI1787|3end_conserved_hypothetical_protein_1719165..1719315_POSITIVE
330	116	78	119	66	pint:PI1722|3end_possible_peptidyl-prolyl_cis-trans_isomerase_1640995..1641145_POSITIVE
326	58	11	65	25	pint:PI1023|3end_hypothetical_protein_940195..940345_POSITIVE
325	120	78	69	19	pint:PI0187|3end_hypothetical_protein_178211..178361_POSITIVE
323	70	27	140	98	pint:PI1437|3end_hypothetical_protein_1356407..1356557_POSITIVE
320	99	52	110	65	pint:PI1440|3end_conserved_hypothetical_protein_1363009..1363159_POSITIVE
320	79	31	145	97	pint:PI0784|3end_possible_amidase_enhancer_precursor_723303..723453_POSITIVE
319	66	27	148	120	pint:PI0407|3end_tryptophanyl-tRNA_synthetase_(tryptophan--tRNA_ligase)_374147..374297_POSITIVE
313	96	52	66	12	pint:PI1647|3end_hypothetical_protein_1562531..1562681_POSITIVE
313	96	52	66	12	pint:PI0353|3end_hypothetical_protein_325337..325487_POSITIVE