CDS GC%: 48.7% tRNA GC%: 54.7% rRNA GC%: 53.4%

IGS#	Up stream Locus	Up stream Product	Down Stream Locus	Down Stream Product	Gene Dir type	Start	End	IGS Len	GC%	IS NT	IS AA	NR	PT-Pair	Intra Spp. IGS	Inter Spp. IGS	Conserved Inter-spp IGS Start	Conserved Inter-spp IGS End	Blast Result	Conserved IGS Seq
4	PG0010	ATP-dependent Clp protease, ATP-binding subunit ClpC	PG0011	glycosyl hydrolase, family 3	->->	11495	11633	139	44.6%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
5	PG0013	hypothetical protein	PG0016	sigma-54 dependent DNA-binding response regulator	->->	16502	17086	585	43.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	6	0	0	0	Result
8	PG0022	sulfate permease family protein	PG0024	redox-sensing transcriptional repressor Rex	<-->	26887	27871	985	38%	0	0	0	+: 0/6/0 \| -: 0/3/0	18	0	0	0	Result
9	PG0025	fumarylacetoacetate hydrolase family protein	PG0026	hypothetical protein	->->	29257	29373	117	50.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
12	PG0030	cytidine deaminase	PG0031	hypothetical protein	-><-	36463	36994	532	42.9%	0	0	3	+: 1/1/0 \| -: 0/0/0	4	0	0	0	Result
13	PG0033	RmuC domain protein	PG0034	thioredoxin	<-<-	41631	42324	694	43.2%	0	0	3	+: 0/2/0 \| -: 0/3/0	2	0	0	0	Result
14	PG0035	DNA polymerase III, alpha subunit	PG0037	50S ribosomal protein L19	<-->	46375	46658	284	37%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
15	PG0037	50S ribosomal protein L19	PG0039	hypothetical protein	->->	47025	47776	752	39.1%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
18	PG0042	serine hydroxymethyltransferase	PG0043	beta-hexosaminidase	->->	51050	51205	156	44.2%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
19	PG0043	beta-hexosaminidase	PG0045	heat shock protein 90	->->	53540	54198	659	43.2%	0	0	0	+: 0/1/0 \| -: 0/0/0	3	0	0	0	Result
20	PG0045	heat shock protein 90	PG0046	phosphatidate cytidylyltransferase	-><-	56254	56435	182	51.1%	0	0	0	+: 0/3/0 \| -: 0/3/0	1	0	0	0	Result
21	PG0047	cell division protein FtsH, putative	PG0048	conserved hypothetical protein TIGR00092	<-<-	59341	59543	203	38.4%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
24	PG0052	sensor histidine kinase	PG0053	hypothetical protein	-><-	64747	65056	310	47.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
25	PG0055	hypothetical protein	PG0056	hypothetical protein	->->	68012	68141	130	30%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
26	PG0066	hypothetical protein	PG0068	hypothetical protein	<-->	81642	81887	246	43.9%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
27	PG0068	hypothetical protein	PG0069	hypothetical protein	-><-	82140	82510	371	46.9%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
28	PG0076	N-acetylmuramoyl-L-alanine amidase, family 4	PG0078	hypothetical protein	<-<-	91424	91655	232	38.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
29	PG0084	L-serine dehydratase, iron-sulfur-dependent, single chain form	PG0085	alpha-galactosidase	->->	99172	99311	140	51.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
30	PG0086	ATP-dependent RNA helicase, DEAD/DEAH box family	PG0087	SIS domain protein	<-<-	102450	102594	145	44.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
31	PG0087	SIS domain protein	PG0088	peptidase, M16 family	<-->	103216	103414	199	33.7%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
32	PG0088	peptidase, M16 family	PG0090	Dps family protein	->->	104633	105663	1031	41.9%	0	0	2	+: 0/2/0 \| -: 0/0/0	15	0	0	0	Result
33	PG0090	Dps family protein	PG0091	transporter, putative	-><-	106144	106272	129	45.7%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
34	PG0094	outer membrane efflux protein, putative	PG0095	DNA mismatch repair protein	<-<-	111284	112177	894	39.3%	0	0	0	+: 0/5/0 \| -: 0/5/0	12	0	0	0	Result
35	PG0095	DNA mismatch repair protein	PG0097	hypothetical protein	<-<-	114854	115145	292	47.3%	0	0	0	+: 0/2/0 \| -: 1/0/0	1	0	0	0	Result
36	PG0099	phenylalanyl-tRNA synthetase beta subunit	PG0100	hypothetical protein	<-<-	118377	119141	765	43.8%	0	0	1	+: 1/3/0 \| -: 0/0/0	3	0	0	0	Result
38	PG0102	hypothetical protein	PG0103	hypothetical protein	->->	121302	121429	128	49.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	4	0	0	0	Result
42	PG0104	DNA topoisomerase III	PG0106	glycosyl transferase, group 4 family protein	->->	127509	128857	1349	40.4%	0	0	7	+: 0/4/0 \| -: 1/5/0	1	0	0	0	Result
43	PG0106	glycosyl transferase, group 4 family protein	PG0108	UDP-N-acetyl-D-mannosaminuronic acid dehydrogenase	->->	129995	130240	246	30.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
45	PG0114	hypothetical protein	PG0115	hexapeptide transferase family protein	->->	138059	138177	119	39.5%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
46	PG0120	UDP-N-acetylglucosamine 2-epimerase	PG0121	DNA-binding protein HU	->->	144305	144607	303	36.6%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
47	PG0121	DNA-binding protein HU	PG0123	hypothetical protein	->->	144875	145126	252	40.9%	0	0	0	+: 0/3/0 \| -: 0/4/0	1	0	0	0	Result
48	PG0126	type I phosphodiesterase/nucleotide pyrophosphatase family protein	PG0127	ferrochelatase	<-->	148109	148689	581	47.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
49	PG0129	mannosyltransferase	PG0130	phosphoglyceromutase	-><-	151850	152011	162	50%	0	0	0	+: 0/3/0 \| -: 0/1/0	1	0	0	0	Result
50	PG0130	phosphoglyceromutase	PG0132	hypothetical protein	<-->	152759	153018	260	44.6%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
51	PG0132	hypothetical protein	PG0133	hypothetical protein	-><-	153115	154348	1234	53.2%	0	0	7	+: 0/4/0 \| -: 0/1/0	1	0	0	0	Result
52	PG0135	dimethyladenosine transferase	PG0136	hypothetical protein	<-->	158034	158163	130	26.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
53	PG0137	aminoacyl-histidine dipeptidase	PG0138	malonyl CoA-acyl carrier protein transacylase	->->	160699	160812	114	37.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
54	PG0138	malonyl CoA-acyl carrier protein transacylase	PG0139	membrane-bound lytic murein transglycosylase D, putative	-><-	161695	161875	181	51.4%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
55	PG0142	SpoOJ regulator protein	PG0143	hydrolase, carbon-nitrogen family	<-<-	165622	165836	215	47.4%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
56	PG0144	hypothetical protein	PG0145	hypothetical protein	<-->	167759	167970	212	52.4%	0	0	0	+: 0/3/0 \| -: 0/3/0	2	0	0	0	Result
57	PG0153	aspartyl-tRNA synthetase	PG0155	riboflavin biosynthesis protein RibD	<-<-	177521	177950	430	45.6%	0	0	0	+: 0/0/0 \| -: 0/3/0	1	0	0	0	Result
58	PG0158	competence protein F-related protein	PG0159	endopeptidase PepO	-><-	181056	181184	129	48.8%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
59	PG0160	hypothetical protein	PG0161	hypothetical protein	<-<-	184176	184356	181	38.1%	0	0	0	+: 0/5/0 \| -: 0/2/0	1	0	0	0	Result
60	PG0162	RNA polymerase sigma-70 factor, ECF subfamily	PG0163	diphosphate--fructose-6-phosphate 1-phosphotransferase	<-<-	185177	185325	149	36.2%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
61	PG0163	diphosphate--fructose-6-phosphate 1-phosphotransferase	PG0164	hypothetical protein	<-<-	186976	187170	195	46.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
62	PG0166	peptidyl-tRNA hydrolase	PG0167	ribosomal protein L25	<-<-	188461	188601	141	52.5%	0	0	0	+: 0/3/0 \| -: 0/1/0	1	0	0	0	Result
63	PG0167	ribosomal protein L25	PG0170	methionyl-tRNA synthetase	<-->	189181	189791	611	41.1%	0	0	0	+: 0/4/0 \| -: 0/0/0	1	0	0	0	Result
66	PG0179	hypothetical protein	PG0180	lipoprotein, putative	->->	202898	203194	297	40.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
67	PG0181	immunoreactive 32 kDa antigen PG49	PG0182	von Willebrand factor type A domain protein	->->	205546	205691	146	31.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
68	PG0182	von Willebrand factor type A domain protein	PG0183	lipoprotein, putative	->->	209373	209568	196	29.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
71	PG0186	lipoprotein RagB	PG0188	lipoprotein, putative	->->	223058	224073	1016	39.6%	0	250	0	+: 0/6/0 \| -: 1/4/0	1	0	0	0	Result
74	PG0195	rubrerythrin	PG0196	peptidase, M16 family	->->	232765	233042	278	41.7%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
75	PG0196	peptidase, M16 family	PG0197	hypothetical protein	-><-	235869	236030	162	44.4%	0	0	0	+: 0/2/0 \| -: 0/2/0	1	0	0	0	Result
76	PG0197	hypothetical protein	PG0198	hypothetical protein	<-->	236295	237021	727	44.7%	1	0	2	+: 1/5/1 \| -: 0/10/0	13	0	0	0	Result
77	PG0205	peptide chain release factor 3	PG0209	formate/nitrite transporter	<-->	242184	243370	1187	42.8%	0	0	1	+: 1/11/1 \| -: 0/1/0	14	0	0	0	Result
78	PG0213	precorrin-3 methylase/precorrin-8X methylmutase	PG0214	RNA polymerase sigma-70 factor, ECF subfamily	<-->	250555	251102	548	46.5%	0	0	3	+: 0/6/0 \| -: 0/3/0	1	0	0	0	Result
79	PG0218	hypothetical protein	PG0219	hypothetical protein	-><-	254395	255099	705	35.9%	0	0	0	+: 1/1/1 \| -: 1/3/0	1	0	0	0	Result
80	PG0222	DNA-binding protein, histone-like family	PG0223	exonuclease	<-<-	256471	257208	738	44.9%	0	0	0	+: 0/4/0 \| -: 0/1/0	1	0	0	0	Result
83	PG0229	hypothetical protein	PG0230	transaldolase	->->	265411	265511	101	45.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
84	PG0232	zinc carboxypeptidase, putative	PG0234	immunoreactive 23 kDa antigen PG66	<-<-	270014	270850	837	41%	0	0	0	+: 0/4/0 \| -: 0/1/0	13	0	0	0	Result
85	PG0234	immunoreactive 23 kDa antigen PG66	PG0235	carboxyl-terminal protease	<-->	271475	271768	294	37.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
86	PG0237	uracil-DNA glycosylase	PG0240	hydrolase, haloacid dehalogenase-like family	-><-	275587	276484	898	49.4%	0	0	0	+: 0/0/0 \| -: 0/2/0	8	0	0	0	Result
87	PG0240	hydrolase, haloacid dehalogenase-like family	PG0241	lipoprotein, putative	<-<-	277184	277449	266	47.7%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
88	PG0243	hypothetical protein	PG0245	universal stress protein family	<-<-	279543	279862	320	43.4%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
89	PG0245	universal stress protein family	PG0246	hypothetical protein	<-<-	280976	281139	164	44.5%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
90	PG0246	hypothetical protein	PG0248	translation initation factor SUI1, putative	<-<-	281332	281599	268	40.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
91	PG0249	oxaloacetate decarboxylase, putative	PG0250	hypothetical protein	<-<-	283889	283994	106	33%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
92	PG0250	hypothetical protein	PG0253	hypothetical protein	<-->	284172	284746	575	42.3%	0	0	0	+: 1/1/0 \| -: 0/0/0	1	0	0	0	Result
95	PG0264	glycosyl transferase, group 2 family protein	PG0265	hypothetical protein	-><-	298183	298482	300	40.3%	0	0	0	+: 0/2/0 \| -: 0/1/0	2	0	0	0	Result
96	PG0265	hypothetical protein	PG0267	arginyl-tRNA synthetase	<-->	298642	299239	598	40%	0	14	0	+: 0/0/0 \| -: 0/0/0	13	0	0	0	Result
97	PG0274	hypothetical protein	PG0275	thioredoxin family protein	-><-	306842	307044	203	42.9%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
98	PG0275	thioredoxin family protein	PG0276	hypothetical protein	<-<-	307555	307691	137	40.9%	0	0	0	+: 0/0/0 \| -: 0/3/0	1	0	0	0	Result
100	PG0278	hypothetical protein	PG0279	NADP-dependent malic enzyme	-><-	310538	310764	227	43.2%	0	0	0	+: 0/3/0 \| -: 0/3/0	1	0	0	0	Result
101	PG0279	NADP-dependent malic enzyme	PG0280	ABC transporter, permease protein, putative	<-<-	313045	313386	342	47.1%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
102	PG0281	ABC transporter, permease protein, putative	PG0282	ABC transporter, ATP-binding protein	<-<-	316114	316333	220	37.7%	0	0	0	+: 0/9/0 \| -: 0/5/0	4	0	0	0	Result
103	PG0283	efflux transporter, MFP component, RND family	PG0285	hypothetical protein	<-->	318336	318598	263	47.5%	0	0	0	+: 1/1/1 \| -: 1/0/0	1	0	0	0	Result
104	PG0285	hypothetical protein	PG0286	hypothetical protein	->->	320105	320256	152	46.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
105	PG0291	hypothetical protein	PG0293	secretion activator protein, putative	-><-	326683	328182	1500	49.2%	0	0	250	+: 1/0/0 \| -: 2/4/8	1	0	0	0	Result
106	PG0293	secretion activator protein, putative	PG0294	glycosyl transferase, group 2 family protein	<-<-	328762	329360	599	38.2%	0	0	1	+: 0/0/0 \| -: 0/2/0	2	0	0	0	Result
107	PG0296	phosphoribosylformylglycinamidine synthase	PG0297	hypothetical protein	<-<-	335088	335386	299	40.1%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
108	PG0297	hypothetical protein	PG0300	TPR domain protein	<-->	335609	336709	1101	37.5%	1	0	2	+: 0/5/0 \| -: 1/5/1	1	0	0	0	Result
109	PG0300	TPR domain protein	PG0302	hypothetical protein	->->	338003	338358	356	40.4%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
110	PG0308	electron transport complex, RnfABCDGE type, A subunit	PG0309	thiamine biosynthesis lipoprotein ApbE	-><-	343888	344099	212	43.9%	0	0	0	+: 0/0/0 \| -: 0/3/0	1	0	0	0	Result
111	PG0312	hypothetical protein	PG0313	hypothetical protein	<-->	347139	347505	367	39.2%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
112	PG0317	peptidase, M49 family	PG0319	hypothetical protein	<-->	352522	353088	567	46.6%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
113	PG0320	hypothetical protein	PG0321	arginine/ornithine transport system ATPase	->->	354638	354787	150	45.3%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
114	PG0322	serine/threonine transporter	PG0323	hypothetical protein	-><-	357027	357148	122	45.9%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
115	PG0323	hypothetical protein	PG0324	histidine ammonia-lyase	<-<-	357479	357678	200	48.5%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
116	PG0328	imidazolonepropionase	PG0329	formiminotransferase-cyclodeaminase-related protein	<-<-	363517	363616	100	54%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
117	PG0330	DNA-binding protein, histone-like family	PG0332	transcription termination factor Rho	<-->	365084	365758	675	52.4%	0	0	0	+: 0/4/0 \| -: 0/3/0	2	0	0	0	Result
118	PG0332	transcription termination factor Rho	PG0333	hypothetical protein	->->	367736	367962	227	55.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
119	PG0339	hypothetical protein	PG0340	hypothetical protein	->->	375748	376205	458	43.7%	0	0	1	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
120	PG0340	hypothetical protein	PG0343	methionine gamma-lyase	-><-	376497	377270	774	45.1%	0	0	0	+: 0/10/0 \| -: 0/11/0	1	0	0	0	Result
121	PG0343	methionine gamma-lyase	PG0344	purple acid phosphatase	<-<-	378453	378632	180	46.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
122	PG0345	hypothetical protein	PG0346	GTP-binding protein	<-->	380699	380798	100	33%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
123	PG0351	hypothetical protein	PG0352	sialidase, putative	->->	387175	387326	152	38.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
124	PG0352	sialidase, putative	PG0354	hypothetical protein	-><-	388908	389220	313	45%	0	0	1	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
125	PG0354	hypothetical protein	PG0355	hypothetical protein	<-->	389374	389783	410	42.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	2	0	0	0	Result
126	PG0366	hypothetical protein	PG0368	DNA topoisomerase IV subunit B	<-->	400906	401384	479	50.1%	0	0	0	+: 1/4/3 \| -: 0/4/0	2	0	0	0	Result
127	PG0369	phosphopantetheine adenylyltransferase	PG0371	hypothetical protein	->->	403812	404182	371	35.6%	0	0	0	+: 0/2/0 \| -: 0/2/0	6	0	0	0	Result
128	PG0371	hypothetical protein	PG0373	hypothetical protein	->->	404285	404844	560	40.2%	0	0	0	+: 1/1/1 \| -: 0/1/0	2	0	0	0	Result
129	PG0374	hypothetical protein	PG0375	50S ribosomal protein L13	<-->	405655	406073	419	45.1%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
130	PG0376	30S ribosomal protein S9	PG0377	30S ribosomal protein S2	->->	406926	407059	134	38.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
131	PG0377	30S ribosomal protein S2	PG0378	elongation factor Ts	->->	407906	408043	138	39.9%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
132	PG0378	elongation factor Ts	PG0380	excinuclease ABC subunit B	->->	408869	409241	373	44%	0	0	0	+: 1/1/1 \| -: 0/0/0	1	0	0	0	Result
133	PG0381	cell volume regulation protein CvrA	PG0382	hypothetical protein	<-->	412796	413330	535	36.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
134	PG0382	hypothetical protein	PG0383	membrane-associated zinc metalloprotease, putative	->->	414804	414905	102	21.6%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
135	PG0384	MutS2 family protein	PG0385	ribosomal protein S21	->->	418758	418918	161	34.2%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
138	PG0393	ribosomal protein L7/L12	PG0394	DNA-directed RNA polymerase beta subunit	->->	425078	425188	111	37.8%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
139	PG0395	DNA-directed RNA polymerase beta' subunit	PG0396	transcriptional regulator, Crp/Fnr family	->->	433366	433652	287	38.3%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
140	PG0400	hypothetical protein	PG0401	hypothetical protein	<-<-	437619	437854	236	53.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
142	PG0404	hypothetical protein	PG0408	hypothetical protein	<-<-	440197	441041	845	39.9%	0	0	0	+: 0/3/0 \| -: 0/3/0	3	0	0	0	Result
143	PG0409	hypothetical protein	PG0410	hypothetical protein	->->	442411	442756	346	38.4%	0	0	0	+: 0/2/0 \| -: 0/2/0	1	0	0	0	Result
144	PG0411	hemagglutinin, putative	PG0412	DNA mismatch repair protein MutL	-><-	449419	449673	255	45.9%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
145	PG0418	ATP-dependent Clp protease, proteolytic subunit	PG0419	hypothetical protein	<-<-	459420	459791	372	39.8%	0	0	0	+: 0/3/0 \| -: 0/1/0	1	0	0	0	Result
146	PG0419	hypothetical protein	PG0421	hypothetical protein	<-<-	460698	460925	228	43.4%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
147	PG0421	hypothetical protein	PG0422	hypothetical protein	<-<-	461784	462020	237	43.5%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
150	PG0428	hypothetical protein	PG0429	pyruvate synthase	<-->	466068	466239	172	41.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
151	PG0431	hypothetical protein	PG0432	NOL1/NOP2/sun family protein	-><-	469235	469362	128	49.2%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
152	PG0434	hypothetical protein	PG0435	capsular polysaccharide biosythesis protein, putative	<-<-	472604	472797	194	41.8%	0	0	0	+: 1/0/0 \| -: 0/1/0	1	0	0	0	Result
153	PG0442	hypothetical protein	PG0443	hemagglutinin-related protein	<-->	481973	482160	188	29.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
154	PG0443	hemagglutinin-related protein	PG0444	oligopeptide transporter, OPT family	->->	483208	483395	188	47.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
155	PG0445	peptidase T	PG0446	thiF protein	->->	486610	486738	129	48.1%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
156	PG0451	CBS domain protein	PG0452	hypothetical protein	->->	492913	493018	106	29.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
157	PG0452	hypothetical protein	PG0453	hypothetical protein	->->	495167	495455	289	47.4%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
158	PG0453	hypothetical protein	PG0456	PHP N-terminal domain protein	->->	496731	497854	1124	37.8%	0	0	0	+: 0/10/0 \| -: 0/4/0	5	2	565	747	Result	ttatgcgtatttccatcgggccggtcgttttcgtttcaagacaataaaacattaagagcttatggcaacagggtttgtggcaagaatacgacctgtaatgaaatggaagtgtggagattaaacggcttgccgtttgacctcgttgccggcagtactccgaaactgcctttgccgaagaaaacg
162	PG0466	hypothetical protein	PG0468	mannose-6-phosphate isomerase, class I	<-<-	510335	510463	129	43.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
163	PG0470	hypothetical protein	PG0471	hypothetical protein	<-->	511974	512427	454	44.3%	0	0	2	+: 0/3/0 \| -: 0/2/0	2	0	0	0	Result
164	PG0472	iron-sulfur cluster binding protein, putative	PG0474	low-specificity L-threonine aldolase	-><-	514475	515100	626	45.2%	0	0	1	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
165	PG0477	pantoate--beta-alanine ligase	PG0479	hypothetical protein	<-->	519688	519825	138	38.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
167	PG0482	hypothetical protein	PG0483	kinase, putative	<-<-	523220	523325	106	39.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
168	PG0484	hypothetical protein	PG0485	preprotein translocase, YajC subunit	<-<-	524949	525075	127	48%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
171	PG0493	hypothetical protein	PG0494	hypothetical protein	<-<-	534991	535183	193	43.5%	0	0	0	+: 0/0/0 \| -: 0/2/0	13	0	0	0	Result
172	PG0494	hypothetical protein	PG0495	hypothetical protein	<-->	535457	535586	130	42.3%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
173	PG0495	hypothetical protein	PG0496	hypothetical protein	->->	536997	537307	311	47.3%	0	0	0	+: 0/3/0 \| -: 0/3/0	1	0	0	0	Result
174	PG0498	S-ribosylhomocysteinase	PG0499	hypothetical protein	->->	538588	538848	261	46.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	6	0	0	0	Result
175	PG0499	hypothetical protein	PG0500	queuine tRNA-ribosyltransferase	->->	539203	539336	134	39.6%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
176	PG0503	dipeptidyl aminopeptidase IV	PG0504	lipoyl synthase	->->	544272	544373	102	45.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
177	PG0504	lipoyl synthase	PG0505	hypothetical protein	->->	545223	545334	112	30.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
178	PG0506	arginine-specific cysteine proteinase	PG0507	hypothetical protein	->->	547686	548055	370	42.4%	0	0	0	+: 0/3/0 \| -: 0/3/0	1	0	0	0	Result
179	PG0514	translocase	PG0515	hypothetical protein	<-<-	556343	556452	110	39.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
180	PG0517	hypothetical protein	PG0518	abortive infection protein family	<-<-	562188	562303	116	49.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
182	PG0520	chaperonin GroEL	PG0521	co-chaperonin GroES	<-<-	565346	565597	252	32.9%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
183	PG0521	co-chaperonin GroES	PG0522	tRNA delta(2)-isopentenylpyrophosphate transferase	<-<-	565868	566082	215	41.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
184	PG0523	inositol-5-monophosphate dehydrogenase	PG0524	hypothetical protein	<-->	568485	568738	254	42.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
185	PG0524	hypothetical protein	PG0525	CTP synthetase	->->	569024	569138	115	47%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
186	PG0525	CTP synthetase	PG0526	putative inner membrane protein translocase component YidC	->->	570759	570885	127	52%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
187	PG0530	carbamoyl-phosphate synthase, large subunit	PG0531	NAD(+) synthetase	-><-	579097	579285	189	47.1%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
188	PG0531	NAD(+) synthetase	PG0532	hypothetical protein	<-<-	581230	581338	109	38.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
191	PG0534	hypothetical protein	PG0535	hypothetical protein	-><-	585866	586045	180	47.8%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
192	PG0537	aminoacyl-histidine dipeptidase	PG0538	outer membrane efflux protein	->->	588455	589281	827	43.3%	0	0	0	+: 1/1/0 \| -: 0/1/0	1	0	0	0	Result
193	PG0541	hypothetical protein	PG0542	hypothetical protein	-><-	595197	595466	270	45.9%	0	0	1	+: 1/2/2 \| -: 0/1/0	1	0	0	0	Result
195	PG0546	hypothetical protein	PG0547	hypothetical protein	<-->	600482	600852	371	35.6%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
196	PG0547	hypothetical protein	PG0548	pyruvate ferredoxin/flavodoxin oxidoreductase family protein	->->	602050	602237	188	42.6%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
199	PG0553	extracellular protease, putative	PG0554	hypothetical protein	<-->	611280	611604	325	36.9%	0	0	0	+: 0/0/0 \| -: 2/0/0	1	0	0	0	Result
200	PG0555	DNA-binding protein, histone-like family	PG0556	hypothetical protein	<-->	612325	613417	1093	34.6%	0	0	0	+: 0/6/0 \| -: 0/7/0	4	0	0	0	Result
201	PG0557	hypothetical protein	PG0558	purine nucleoside phosphorylase	-><-	615068	615599	532	39.8%	0	0	0	+: 1/7/4 \| -: 0/2/0	1	0	0	0	Result
202	PG0561	peptidase, M20/M25/M40 family	PG0562	potassium uptake protein TrkA, putative	<-->	619146	619361	216	36.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
203	PG0564	hypothetical protein	PG0565	hypothetical protein	<-<-	621701	621860	160	30%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
204	PG0565	hypothetical protein	PG0566	DNA-binding protein, histone-like family	<-<-	622734	623024	291	34.7%	0	0	0	+: 0/2/0 \| -: 0/2/0	1	0	0	0	Result
205	PG0566	DNA-binding protein, histone-like family	PG0568	elongation factor P	<-<-	623532	624088	557	35.9%	0	0	0	+: 0/6/0 \| -: 0/1/0	2	0	0	0	Result
206	PG0568	elongation factor P	PG0569	hypothetical protein	<-<-	624656	624786	131	47.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
207	PG0569	hypothetical protein	PG0571	aspartate-semialdehyde dehydrogenase	<-->	626314	626538	225	36%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
208	PG0572	hypothetical protein	PG0573	S-adenosyl-methyltransferase MraW	<-->	627662	628222	561	39%	0	0	1	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
209	PG0585	YqeY family protein	PG0587	yadS protein	-><-	643862	644701	840	43.7%	0	0	1	+: 0/7/0 \| -: 0/3/0	13	0	0	0	Result
212	PG0592	50S ribosomal protein L31	PG0593	htrA protein	->->	650286	650501	216	43.1%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
213	PG0593	htrA protein	PG0594	RNA polymerase sigma-70 factor	->->	651999	652187	189	47.1%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
214	PG0597	ribosomal protein L9	PG0598	hypothetical protein	->->	654342	654616	275	46.5%	0	0	0	+: 0/2/0 \| -: 0/6/0	1	0	0	0	Result
215	PG0599	3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II	PG0602	hypothetical protein	->->	657793	658639	847	45.6%	0	0	0	+: 0/1/0 \| -: 0/9/0	18	0	0	0	Result
216	PG0608	hypothetical protein	PG0609	hypothetical protein	->->	663220	663322	103	35.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
218	PG0614	hypothetical protein	PG0615	GTP-binding protein TypA	->->	666968	667172	205	43.9%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
219	PG0615	GTP-binding protein TypA	PG0616	thioredoxin, putative	->->	668973	669074	102	33.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
220	PG0618	alkyl hydroperoxide reductase, C subunit	PG0619	alkyl hydroperoxide reductase, F subunit	->->	671079	671243	165	43.6%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
221	PG0619	alkyl hydroperoxide reductase, F subunit	PG0620	ATP-dependent protease La	->->	672792	673102	311	45%	0	0	0	+: 0/3/0 \| -: 0/2/0	1	0	0	0	Result
222	PG0625	GTP cyclohydrolase I	PG0626	hypothetical protein	->->	679310	679539	230	38.7%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
223	PG0626	hypothetical protein	PG0627	RNA-binding protein	-><-	680407	681231	825	46.9%	0	0	0	+: 0/7/0 \| -: 0/2/0	13	0	0	0	Result
224	PG0627	RNA-binding protein	PG0628	ABC transporter, ATP-binding protein	<-<-	681526	681773	248	40.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
225	PG0630	pyridoxal phosphate biosynthetic protein	PG0631	MotA/TolQ/ExbB proton channel family protein	->->	684249	684405	157	45.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
226	PG0639	signal peptide peptidase SppA, 67K type	PG0645	hypothetical protein	<-<-	693091	696972	3882	47.2%	0	5	9	+: 1/3/0 \| -: 1/17/1	14	0	0	0	Result
227	PG0645	hypothetical protein	PG0646	iron compound ABC transporter, ATP-binding protein	<-<-	698050	698159	110	37.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
228	PG0648	iron compound ABC transporter, periplasmic iron compound-binding protein, putative	PG0649	hypothetical protein	<-->	701376	701959	584	45%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
229	PG0649	hypothetical protein	PG0650	hypothetical protein	-><-	702545	702670	126	44.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
230	PG0650	hypothetical protein	PG0651	HDIG domain protein	<-<-	703055	703160	106	40.6%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
232	PG0662	hypothetical protein	PG0664	oxidoreductase, Gfo/Idh/MocA family	->->	710217	710432	216	47.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
233	PG0665	beta-galactosidase	PG0668	TonB-dependent receptor	->->	715306	717590	2285	46.8%	0	0	47	+: 2/9/7 \| -: 0/3/0	2	2	1368	1581	Result	taaagagaaacgagagaaatgcaatcggcatttctctcgttttgcaaagacgacgtactgctccggttaggacgaccttccgtccgttttaggtcgacctaatcgctctgtaaggacgacctatttgctccgcaaggtcgacctaaacgctcggttaggtcgacctgacttcttgtcagggtcgacgtatgcggtttattcccttgtagtgtgc
234	PG0669	heme-binding protein FetB	PG0670	lipoprotein, putative	->->	720775	720891	117	44.4%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
235	PG0672	iron compound ABC transporter, ATP-binding protein	PG0674	indolepyruvate ferredoxin oxidoreductase, beta subunit	-><-	723901	724298	398	47.2%	0	0	0	+: 0/2/0 \| -: 0/2/0	1	0	0	0	Result
236	PG0676	oxidoreductase, short chain dehydrogenase/reductase family	PG0677	saccharopine dehydrogenase	<-->	727366	727792	427	43.6%	0	0	1	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
237	PG0678	pyrazinamidase/nicotinamidase, putative	PG0679	outer membrane efflux protein	->->	729532	729733	202	41.6%	0	0	0	+: 1/4/4 \| -: 0/2/0	1	0	0	0	Result
238	PG0680	efflux transporter, MFP component, RND family	PG0681	hypothetical protein	-><-	732362	732500	139	36%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
239	PG0681	hypothetical protein	PG0682	ABC transporter, permease protein, putative	<-->	732810	733010	201	34.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
240	PG0685	ABC transporter, ATP-binding protein	PG0686	hypothetical protein	-><-	740916	741220	305	53.8%	0	0	0	+: 0/4/0 \| -: 0/1/0	1	0	0	0	Result
241	PG0686	hypothetical protein	PG0687	succinate-semialdehyde dehydrogenase	<-<-	742775	743257	483	39.8%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
242	PG0687	succinate-semialdehyde dehydrogenase	PG0689	NAD-dependent 4-hydroxybutyrate dehydrogenase	<-<-	744614	744807	194	37.1%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
243	PG0692	4-hydroxybutyryl-CoA dehydratase	PG0694	immunoreactive 42 kDa antigen PG33	<-<-	749093	749792	700	39%	0	0	0	+: 0/4/0 \| -: 1/1/1	1	0	0	0	Result
244	PG0695	immunoreactive 43 kDa antigen PG32	PG0698	lipoprotein, putative	<-<-	752158	752462	305	33.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
245	PG0699	maltodextrin phosphorylase	PG0700	hypothetical protein	<-<-	756049	756172	124	36.3%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
246	PG0706	hypothetical protein	PG0707	TonB-dependent receptor, putative	-><-	760943	761175	233	45.1%	0	0	0	+: 0/2/0 \| -: 0/4/0	1	0	0	0	Result
247	PG0707	TonB-dependent receptor, putative	PG0708	peptidyl-prolyl cis-trans isomerase, FKBP-type	<-<-	763723	763887	165	37.6%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
248	PG0711	hypothetical protein	PG0712	hypothetical protein	-><-	766342	766873	532	37.4%	0	0	0	+: 0/6/0 \| -: 0/7/0	4	0	0	0	Result
249	PG0713	anthranilate synthase component II	PG0714	copper homeostasis protein CutC	<-<-	767840	768014	175	46.3%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
250	PG0715	transporter	PG0717	lipoprotein, putative	<-<-	769687	770080	394	44.2%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
251	PG0718	hypothetical protein	PG0719	sensor histidine kinase	<-<-	771664	771785	122	30.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
252	PG0720	DNA-binding response regulator	PG0721	NLP/P60 family protein	<-->	773756	773986	231	40.3%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
253	PG0721	NLP/P60 family protein	PG0722	hypothetical protein	-><-	774596	774828	233	46.8%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
254	PG0722	hypothetical protein	PG0723	hypothetical protein	<-->	774982	775088	107	33.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
255	PG0729	D-alanylalanine synthetase	PG0731	hypothetical protein	<-<-	780909	782109	1201	51.9%	0	4	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
256	PG0732	hypothetical protein	PG0733	riboflavin synthase subunit alpha	->->	783079	783313	235	38.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
257	PG0740	NLP/P60 family protein	PG0741	hypothetical protein	-><-	788546	788806	261	42.9%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
258	PG0742	antigen PgaA	PG0744	RNA methyltransferase, TrmH family	<-<-	790728	791222	495	40.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	1	113	217	Result	atagttttgagtatattctttatctttgagtataatctccgaaatgcaatcatttgaaaattagcaacttgtattttctcgaaatttttgatgcggttgccctgt
259	PG0745	lactoylglutathione lyase, putative	PG0746	sensor histidine kinase	<-<-	792471	792625	155	38.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
260	PG0747	sigma-54 dependent DNA-binding response regulator	PG0749	hypothetical protein	<-<-	795385	795627	243	43.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	11	0	0	0	Result
262	PG0750	glycosyl transferase, group 2 family protein	PG0751	porT protein	<-<-	796783	796933	151	41.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
263	PG0751	porT protein	PG0752	uracil phosphoribosyltransferase	<-->	797669	797806	138	34.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
264	PG0753	protease	PG0754	DNA topoisomerase I	->->	800349	801082	734	43.3%	0	0	1	+: 0/4/0 \| -: 0/3/0	2	0	0	0	Result
265	PG0754	DNA topoisomerase I	PG0756	hypothetical protein	-><-	803450	804410	961	53.4%	0	1	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
266	PG0759	TPR domain protein	PG0762	trigger factor, putative	<-->	810876	812898	2023	45.3%	1	0	0	+: 0/3/0 \| -: 1/2/0	6	0	0	0	Result
267	PG0762	trigger factor, putative	PG0766	polyribonucleotide nucleotidyltransferase	-><-	814276	816263	1988	44.1%	1	0	0	+: 1/8/4 \| -: 0/8/0	1	0	0	0	Result
268	PG0766	polyribonucleotide nucleotidyltransferase	PG0767	4-alpha-glucanotransferase	<-<-	818496	818646	151	38.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
270	PG0768	hypothetical protein	PG0769	fibronectin type III domain protein	<-<-	822472	822644	173	43.9%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
271	PG0771	hypothetical protein	PG0772	hypothetical protein	->->	824928	825114	187	36.4%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
272	PG0773	hypothetical protein	PG0774	hypothetical protein	-><-	825409	825786	378	33.6%	0	0	0	+: 0/6/0 \| -: 0/1/0	6	0	0	0	Result
275	PG0778	hypothetical protein	PG0779	hypothetical protein	<-<-	831960	832189	230	35.7%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
277	PG0784	polyprenyl synthetase	PG0785	tonB protein, putative	<-<-	836820	836989	170	40.6%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
278	PG0792	hypoxanthine phosphoribosyltransferase	PG0793	fructose-1,6-bisphosphatase	<-->	843805	844427	623	42.5%	0	0	3	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
279	PG0793	fructose-1,6-bisphosphatase	PG0794	penicillin-binding protein 1A, putative	->->	846396	846550	155	46.5%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
282	PG0801	polyA polymerase family protein	PG0802	alpha keto acid dehydrogenase complex, E3 component, lipoamide dehydrogenase	<-<-	857805	858462	658	45%	0	0	7	+: 0/1/0 \| -: 1/1/1	1	0	0	0	Result
283	PG0807	NusB family protein	PG0809	hypothetical protein	<-<-	864815	865153	339	42.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
284	PG0811	Holliday junction DNA helicase motor protein	PG0814	hypothetical protein	<-<-	873300	875993	2694	46.4%	1	250	0	+: 0/4/0 \| -: 1/2/1	3	0	0	0	Result
285	PG0816	hypothetical protein	PG0819	integrase	<-->	876950	877465	516	40.1%	0	35	0	+: 0/0/0 \| -: 0/0/0	2	1	398	516	Result	tgaggtaatgattattggaagaatttttctcatacggtttctttttatctgtttatcaatattttgcgtatcagagaacgctttgataacgggtaattttgcccataaagttaaagcgt
286	PG0821	lipoprotein, putative	PG0822	hypothetical protein	-><-	880293	880417	125	33.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	2	1	1	125	Result	agaaaagcaggcagtaagaaaagtaatttctactgtctgctttttctaatggatttattgccactacctacttcatattctcttttttcagcgtataatggcaatctcaaaaggattctctttca
287	PG0822	hypothetical protein	PG0823	hypothetical protein	<-->	880826	880957	132	25.8%	0	0	0	+: 0/0/0 \| -: 1/0/0	2	2	1	132	Result	aaaatgtattttaaattgttgaaatcactgcaaaattatacctttgcactacaatacacaagtacatacaaaaatgtatgatacacactatattgttagttttactgaatatcaacaagaaaaaagttcgct
290	PG0827	MATE efflux family protein	PG0829	hypothetical protein	-><-	885665	886359	695	40.9%	0	0	11	+: 0/1/0 \| -: 0/2/0	2	2	1	240	Result	acataaaagatatgattatgctaagacttactcaaactgaagactttaagacaataatctctttatgctctacaaaaggacagatacaaaaagcgtcagacaactttattctgaagattattgccctatgtgatgcagaaagagatttagtctcattgtttcggaccctccgttatacacgcttttgcctgcaacctttgcaaaggggagattcaatggacggagaggggaaaaaatgta
291	PG0829	hypothetical protein	PG0831	hypothetical protein	<-->	886837	887542	706	40.5%	0	0	0	+: 0/1/0 \| -: 0/1/0	2	2	1	695	Result	ttgaaatccattagagagcgttcacgataaaatagccaatcaagacaacgaaaacttctatccaagaacaccgacttcggaggtgttctgccctctgcaagagcaagggttttgagttaccgaaataatttcgggtaacgcaagacataccttgctatttgcactgacgcaaataaattcgttccgaagaacgatatgttattctctcgaaatgtatgtttcccaagccatgaaataccgacttatcgcttactgcaaagttacgatctcttgtacccaaagctattaggtagaacgaagccacaattatccaaatcgatgccacaagtacgcactaaaggaaatcacgctgattacagcatcaccgaaccatatatttgcactgtcgaatatgtcggtgatggtatgtgtcttcgataacatcacgtttcgatgagcgatataggcgagggtgtatgtcaaagaacatgtccttgattctttcactcgaacgtgggaatgtgcgaaggcagatacaatcgaacgattgtattgatggacactaatgaacatctccacagaaagggtatgaatgaaaggatgtagccctactggtacaagccgattattgggcatatcttcgatagcggatgtattcatcttcatcggtaaatatactggcaacgaaatgaacaatgaattgtgtaataataaaa
292	PG0831	hypothetical protein	PG0832	hypothetical protein	-><-	887972	888769	798	42%	0	0	0	+: 0/2/0 \| -: 0/4/0	2	3	121	651	Result	tgctcatgaaagaaagtagcggtggacaaatctgccgaccgctttactctgtctgttcttcttgaacggttacttgttccgtccttacttcggaataaatcatcttgtctgattttatgcggattccagaggtgagggagttgagtttcaaccttttcttttttccctgcttcttgcatatccaacattttttatgcgttttttccgtcggggcggtcgttctcgtttcaggggcgaaaaaaggtagggcttaggacaaacaaggttttacggtgagaatactacctgcaataaaatggaagtgtggagattgtcgtctaaacggcttgctgccccgaccttttttgtccgtagaagcctggaactaccttcgccgctgacaacgaacaaccgatcccgacatgatacacggcataagttgaggaagtgcagggagagaagcagggcgaacacaaaaaacgcagtctttaaagactgcatttaccataagaatagaatacacagaaaacaaaaagccgccctaacggacgg
293	PG0833	hypothetical protein	PG0834	hypothetical protein	<-<-	891664	892087	424	31.1%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
295	PG0835	hypothetical protein	PG0838	integrase	->->	893858	895616	1759	40.6%	0	44	0	+: 0/1/0 \| -: 1/3/1	1	0	0	0	Result
296	PG0838	integrase	PG0839	hypothetical protein	->->	896916	897352	437	40.7%	0	0	0	+: 0/2/0 \| -: 3/0/0	1	0	0	0	Result
297	PG0840	hypothetical protein	PG0841	mobilizable transposon, excision protein, putative	-><-	902544	902870	327	45.3%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
298	PG0841	mobilizable transposon, excision protein, putative	PG0842	mobilizable transposon, hypothetical protein, putative	<-<-	903765	903899	135	50.4%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
299	PG0843	hypothetical protein	PG0844	hypothetical protein	<-->	905273	905428	156	44.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
301	PG0847	hypothetical protein	PG0848	hypothetical protein	-><-	909475	909578	104	38.5%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
302	PG0851	hypothetical protein	PG0853	DNA-binding protein, histone-like family	<-->	912823	914523	1701	44.9%	1	0	1	+: 1/3/0 \| -: 0/6/0	1	0	0	0	Result
303	PG0854	hypothetical protein	PG0855	hypothetical protein	-><-	915829	916049	221	34.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
304	PG0855	hypothetical protein	PG0856	hypothetical protein	<-->	916146	916329	184	29.3%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
305	PG0856	hypothetical protein	PG0857	transcriptional regulator, putative	->->	917236	917458	223	39%	0	0	0	+: 0/3/0 \| -: 0/3/0	1	1	10	210	Result	aatatccccgaaaaggggtataatacatttatattccttatatttgccactgataaggtatataatgactttctcggagtgagccgtgcatagtgatatgccttgaatatgtacccaaaagagacaaaatgggtacatatccttgggacgtgtacccgaaaacggcatttggggtacatattcggaatatggaacttcaag
308	PG0869	mobilization protein	PG0870	hypothetical protein	<-<-	932294	932393	100	43%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
309	PG0872	mobilizable transposon, xis protein	PG0873	mobilizable transposon, tnpC protein	<-<-	935296	936199	904	35%	0	0	0	+: 0/0/0 \| -: 1/2/2	1	0	0	0	Result
310	PG0873	mobilizable transposon, tnpC protein	PG0874	mobilizable transposon, int protein	<-<-	936899	936999	101	35.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
311	PG0875	mobilizable transposon, tnpA protein	PG0876	tRNA modification GTPase	<-<-	939095	939339	245	43.7%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
312	PG0877	hypothetical protein	PG0879	hypothetical protein	<-<-	941636	942020	385	44.7%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
313	PG0881	recombinase A	PG0882	hypothetical protein	->->	944226	944334	109	55%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
314	PG0886	hypothetical protein	PG0888	hypothetical protein	->->	949747	950049	303	45.2%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
315	PG0890	alkaline phosphatase, putative	PG0893	hydroxylamine reductase	-><-	953164	954290	1127	46.4%	0	0	0	+: 0/7/0 \| -: 0/8/0	7	0	0	0	Result
316	PG0893	hydroxylamine reductase	PG0894	DNA repair protein RadC	<-<-	955944	956167	224	42%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
319	PG0896	beta-galactosidase	PG0897	alpha-amylase family protein	-><-	960443	960957	515	38.4%	0	0	0	+: 1/4/0 \| -: 0/3/0	1	0	0	0	Result
320	PG0898	hypothetical protein	PG0899	cytochrome d ubiquinol oxidase, subunit II	<-<-	963441	963586	146	39.7%	0	0	0	+: 0/0/0 \| -: 1/1/0	1	0	0	0	Result
321	PG0901	hypothetical protein	PG0902	alpha-1,2-mannosidase family protein	<-<-	966654	966835	182	36.3%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
322	PG0902	alpha-1,2-mannosidase family protein	PG0903	hypothetical protein	<-<-	969062	969187	126	43.7%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
323	PG0903	hypothetical protein	PG0906	lipoprotein, putative	<-->	969731	970755	1025	38.5%	0	0	0	+: 0/4/0 \| -: 0/2/0	10	0	0	0	Result
324	PG0906	lipoprotein, putative	PG0908	G/U mismatch-specific DNA glycosylase, putative	-><-	971209	971319	111	41.4%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
325	PG0910	FHA domain protein	PG0912	polysaccharide transport protein, putative	<-<-	973757	973880	124	41.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
326	PG0912	polysaccharide transport protein, putative	PG0914	hypothetical protein	<-<-	975447	975793	347	42.7%	0	0	0	+: 0/5/0 \| -: 0/2/0	1	0	0	0	Result
327	PG0914	hypothetical protein	PG0915	hypothetical protein	<-->	976508	976724	217	37.8%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
329	PG0918	hypothetical protein	PG0919	dihydroorotase	<-<-	978909	979074	166	42.2%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
330	PG0920	glycosyl transferase, group 2 family protein	PG0922	hypothetical protein	<-<-	981116	981317	202	44.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
331	PG0925	thymidine kinase	PG0926	hypothetical protein	<-<-	984370	984496	127	43.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
332	PG0930	hypothetical protein	PG0932	DNA polymerase III, delta prime subunit, putative	<-->	987633	988642	1010	45.5%	0	0	9	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
333	PG0932	DNA polymerase III, delta prime subunit, putative	PG0933	translation elongation factor G, putative	->->	989894	990136	243	44.9%	0	0	0	+: 0/3/0 \| -: 0/0/0	1	0	0	0	Result
334	PG0933	translation elongation factor G, putative	PG0934	hypothetical protein	-><-	992297	992503	207	48.3%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
337	PG0949	hypothetical protein	PG0950	glycine cleavage system protein H	->->	1009834	1010000	167	32.3%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
338	PG0951	phosphoribosylaminoimidazole carboxylase, PurE protein	PG0952	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase	->->	1010889	1011061	173	47.4%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
339	PG0958	ribonuclease BN, putative	PG0959	ATP-binding protein, Mrp/Nbp35 family	<-<-	1019461	1020112	652	51.2%	0	0	1	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
340	PG0962	prolyl-tRNA synthetase	PG0963	hypothetical protein	<-<-	1023899	1024176	278	43.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
342	PG0965	phosphatidylserine decarboxylase	PG0968	Mrr restriction system protein	<-->	1025867	1026967	1101	37.2%	0	0	0	+: 0/3/0 \| -: 0/2/0	9	0	0	0	Result
347	PG0972	hypothetical protein	PG0973	alpha-1,2-mannosidase family protein	->->	1034104	1034306	203	40.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
348	PG0973	alpha-1,2-mannosidase family protein	PG0975	PhoH family protein	->->	1036623	1037423	801	44.8%	0	0	0	+: 0/9/0 \| -: 0/0/0	14	0	0	0	Result
351	PG0982	TPR domain protein	PG0984	hypothetical protein	-><-	1046703	1046802	100	35%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
352	PG0987	hypothetical protein	PG0989	50S ribosomal protein L20	-><-	1048919	1050788	1870	47.3%	1	250	0	+: 0/6/0 \| -: 1/2/2	3	0	0	0	Result
353	PG0989	50S ribosomal protein L20	PG0990	ribosomal protein L35	<-<-	1051137	1051248	112	36.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
354	PG0991	translation initiation factor IF-3	PG0992	threonyl-tRNA synthetase	<-<-	1052130	1052232	103	31.1%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
355	PG0992	threonyl-tRNA synthetase	PG0994	hypothetical protein	<-->	1054195	1055060	866	40.8%	0	160	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
356	PG0994	hypothetical protein	PG0995	hypothetical protein	-><-	1055160	1055558	399	36.8%	0	0	0	+: 0/2/0 \| -: 0/2/0	1	0	0	0	Result
357	PG0996	conserved hypothetical protein TIGR01777	PG0997	transcriptional regulator, putative	->->	1056641	1056805	165	30.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
358	PG1003	hypothetical protein	PG1004	prolyl oligopeptidase family protein	-><-	1060365	1060522	158	50%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
359	PG1004	prolyl oligopeptidase family protein	PG1005	lipoprotein, putative	<-<-	1062803	1063112	310	47.1%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
360	PG1010	ABC transporter, ATP-binding protein	PG1012	tRNA-i(6)A37 modification enzyme MiaB	<-<-	1069427	1070178	752	40.8%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
361	PG1012	tRNA-i(6)A37 modification enzyme MiaB	PG1013	acetyl-CoA hydrolase/transferase family protein	<-->	1071571	1071873	303	33.7%	0	0	0	+: 2/1/0 \| -: 0/0/0	1	0	0	0	Result
362	PG1013	acetyl-CoA hydrolase/transferase family protein	PG1014	TPR domain protein	->->	1073371	1073902	532	37.8%	0	0	0	+: 0/3/0 \| -: 1/2/0	2	0	0	0	Result
363	PG1015	hypothetical protein	PG1017	pyruvate phosphate dikinase	<-->	1076111	1076277	167	40.7%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
364	PG1019	lipoprotein, putative	PG1020	hypothetical protein	->->	1080537	1080707	171	45%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
365	PG1022	hypothetical protein	PG1024	hypothetical protein	->->	1085159	1086837	1679	50.9%	0	3	24	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
366	PG1024	hypothetical protein	PG1025	hypothetical protein	->->	1086937	1087280	344	41.6%	0	0	3	+: 1/2/2 \| -: 0/2/0	1	0	0	0	Result
367	PG1026	hypothetical protein	PG1027	hypothetical protein	-><-	1089049	1089286	238	35.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
369	PG1029	hypothetical protein	PG1030	hypothetical protein	->->	1091397	1091539	143	32.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
373	PG1038	ATP-dependent DNA helicase UvrD/PcrA/Rep Family	PG1039	integral membrane protein	-><-	1105182	1105414	233	42.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
374	PG1039	integral membrane protein	PG1040	transcriptional regulator, putative	<-<-	1107143	1107574	432	38.7%	0	0	0	+: 1/1/0 \| -: 0/0/0	1	0	0	0	Result
377	PG1053	transcriptional regulator, putative	PG1055	thiol protease	-><-	1120892	1121291	400	41.2%	0	0	0	+: 0/2/0 \| -: 0/3/0	1	0	0	0	Result
378	PG1055	thiol protease	PG1056	hypothetical protein	<-->	1122738	1123119	382	34%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
382	PG1065	dihydroorotate dehydrogenase	PG1066	butyrate-acetoacetate CoA-transferase, subunit A	->->	1133391	1133660	270	33%	0	0	0	+: 2/1/1 \| -: 0/1/0	1	0	0	0	Result
384	PG1078	electron transfer flavoprotein, alpha subunit	PG1079	enoyl-CoA hydratase/isomerase family protein	->->	1146586	1146688	103	48.5%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
385	PG1080	3-hydroxyacyl-CoA dehydrogenase family protein	PG1081	acetate kinase	-><-	1148352	1148520	169	41.4%	0	0	0	+: 0/4/0 \| -: 0/1/0	1	0	0	0	Result
386	PG1082	phosphotransacetylase	PG1083	hypothetical protein	<-<-	1150774	1150982	209	35.4%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
387	PG1084	thioredoxin family protein	PG1085	hypothetical protein	<-->	1153049	1153342	294	28.9%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
388	PG1085	hypothetical protein	PG1087	radical SAM protein, TIGR01212 family	->->	1153592	1153944	353	43.1%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
389	PG1089	DNA-binding response regulator RprY	PG1091	DHH subfamily 1 protein	<-->	1156351	1157156	806	38.7%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
390	PG1091	DHH subfamily 1 protein	PG1093	hypothetical protein	->->	1158153	1158260	108	42.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
391	PG1095	RNA methyltransferase, TrmA family	PG1096	hypothetical protein	->->	1161763	1161978	216	41.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
392	PG1097	Mur ligase domain protein/alanine racemase	PG1098	hypothetical protein	-><-	1165569	1165875	307	31.9%	0	0	0	+: 0/1/0 \| -: 1/2/0	1	0	0	0	Result
393	PG1101	sodium:solute symporter family protein	PG1102	hypothetical protein	<-<-	1170560	1170949	390	45.9%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
394	PG1106	UDP-N-acetylmuramoylalanyl-D-glutamyl-2, 6-diaminopimelate--D-alanyl-D-alanyl ligase	PG1107	hypothetical protein	<-->	1178520	1178899	380	40%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
396	PG1108	hypothetical protein	PG1109	mobilization protein	<-<-	1181199	1181514	316	40.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
397	PG1110	hypothetical protein	PG1112	hypothetical protein	->->	1183298	1185142	1845	49.4%	0	0	6	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
398	PG1113	integrase	PG1114	aspartate 1-decarboxylase precursor	<-->	1186837	1187176	340	40.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
399	PG1115	signal recognition particle protein	PG1116	methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	->->	1188948	1189070	123	48%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
400	PG1116	methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	PG1117	MATE efflux family protein	->->	1189962	1190149	188	47.9%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
401	PG1117	MATE efflux family protein	PG1118	clpB protein	-><-	1191602	1192172	571	44.5%	0	0	0	+: 1/2/2 \| -: 0/2/0	13	0	0	0	Result
402	PG1118	clpB protein	PG1119	flavodoxin, putative	<-->	1194765	1194982	218	35.3%	0	0	0	+: 0/0/0 \| -: 2/0/0	1	0	0	0	Result
403	PG1119	flavodoxin, putative	PG1121	asparaginyl-tRNA synthetase	-><-	1195544	1196235	692	36.7%	0	0	0	+: 0/2/0 \| -: 1/4/1	14	0	0	0	Result
404	PG1121	asparaginyl-tRNA synthetase	PG1123	adenylosuccinate lyase	<-<-	1197646	1199096	1451	45.3%	0	4	0	+: 0/2/0 \| -: 1/0/0	1	0	0	0	Result
405	PG1123	adenylosuccinate lyase	PG1124	ATP:cob(I)alamin adenosyltransferase, putative	<-<-	1200441	1200574	134	35.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
406	PG1126	uracil permease	PG1127	transcriptional regulator, AsnC Family	<-->	1203024	1203362	339	33%	0	0	0	+: 0/0/0 \| -: 0/2/0	2	0	0	0	Result
407	PG1128	exodeoxyribonuclease VII large subunit	PG1129	ribonucleotide reductase	->->	1205260	1205537	278	36.3%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
408	PG1129	ribonucleotide reductase	PG1130	TPR domain protein	->->	1208091	1208192	102	48%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
409	PG1130	TPR domain protein	PG1132	valyl-tRNA synthetase	->->	1210191	1211051	861	40.8%	0	0	0	+: 0/2/0 \| -: 0/3/0	14	0	0	0	Result
411	PG1134	thioredoxin reductase	PG1135	bacterial sugar transferase	->->	1215432	1215999	568	33.3%	0	0	0	+: 0/2/0 \| -: 0/3/0	1	0	0	0	Result
412	PG1135	bacterial sugar transferase	PG1136	hypothetical protein	-><-	1216615	1216788	174	42%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
413	PG1138	pigmentation and extracellular proteinase regulator	PG1139	hypothetical protein	<-<-	1220839	1221017	179	40.8%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
414	PG1139	hypothetical protein	PG1140	glycosyl transferase, group 2 family protein	<-<-	1222155	1222264	110	31.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
415	PG1141	glycosyl transferase, group 1 family protein	PG1142	exopolysaccharide synthesis-related protein	<-<-	1224325	1224660	336	37.5%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
416	PG1142	exopolysaccharide synthesis-related protein	PG1143	sugar dehydrogenase, UDP-glucose/GDP-mannose dehydrogenase family	<-<-	1225570	1225719	150	36%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
417	PG1143	sugar dehydrogenase, UDP-glucose/GDP-mannose dehydrogenase family	PG1145	long-chain-fatty-acid--CoA ligase, putative	<-<-	1227289	1228571	1283	50.7%	0	2	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
418	PG1145	long-chain-fatty-acid--CoA ligase, putative	PG1148	hypothetical protein	<-->	1230396	1231343	948	36.6%	0	0	0	+: 0/2/0 \| -: 0/2/0	8	0	0	0	Result
419	PG1148	hypothetical protein	PG1149	glycosyl transferase, group 1 family protein	->->	1231437	1231781	345	34.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
420	PG1149	glycosyl transferase, group 1 family protein	PG1150	hypothetical protein	->->	1232910	1233045	136	34.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
421	PG1151	alcohol dehydrogenase, iron-containing	PG1152	hypothetical protein	-><-	1234439	1234763	325	40.9%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
422	PG1156	S4 domain protein	PG1159	cobalamin biosynthesis protein CbiB	-><-	1237328	1238046	719	46.9%	0	0	0	+: 0/12/0 \| -: 0/1/0	14	0	0	0	Result
424	PG1163	cobyrinic acid a,c-diamide synthase	PG1164	hypothetical protein	<-<-	1243472	1244196	725	44.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
425	PG1167	hypothetical protein	PG1169	hypothetical protein	-><-	1248705	1249172	468	40%	0	0	0	+: 0/4/0 \| -: 0/4/0	2	0	0	0	Result
426	PG1170	SerB family protein	PG1171	oxidoreductase, putative	->->	1250176	1250494	319	42.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
427	PG1173	YkgG family protein	PG1174	thioesterase family protein	-><-	1253190	1253299	110	50.9%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
428	PG1174	thioesterase family protein	PG1175	ABC transporter, ATP-binding protein, putative	<-<-	1253798	1254259	462	40.5%	0	0	2	+: 0/5/0 \| -: 0/5/0	5	0	0	0	Result
431	PG1181	transcriptional regulator, tetR family	PG1184	alginate O-acetyltransferase, putative	<-<-	1264346	1265424	1079	45.2%	0	0	0	+: 0/0/0 \| -: 0/9/0	14	0	0	0	Result
432	PG1186	hypothetical protein	PG1189	hypothetical protein	<-->	1269242	1270131	890	40.9%	1	0	0	+: 0/1/0 \| -: 0/0/0	6	0	0	0	Result
433	PG1189	hypothetical protein	PG1190	glycerate dehydrogenase	->->	1272013	1272251	239	41.4%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
434	PG1190	glycerate dehydrogenase	PG1195	8-amino-7-oxononanoate synthase	->->	1273206	1274118	913	47.8%	0	0	0	+: 0/4/0 \| -: 0/2/0	8	0	0	0	Result
437	PG1199	hypothetical protein	PG1200	hypothetical protein	-><-	1277459	1277569	111	29.7%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
438	PG1200	hypothetical protein	PG1202	hypothetical protein	<-<-	1278083	1279681	1599	41.8%	0	0	123	+: 0/0/0 \| -: 1/1/1	1	0	0	0	Result
439	PG1202	hypothetical protein	PG1203	transcriptional regulator, putative	<-<-	1283105	1283326	222	27.9%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
440	PG1203	transcriptional regulator, putative	PG1205	DNA-binding protein, histone-like family	<-->	1283537	1284092	556	36.7%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	1	22	130	Result	tgttcttttgatagcgcaaagatatgaaatgaaatagcatagaaaaagggaatgaggtttattttccattcccttaaatcgtcttaattggtgcaggaaagaaacttta
441	PG1208	molecular chaperone DnaK	PG1209	hypothetical protein	<-->	1287006	1287584	579	38.9%	0	0	1	+: 0/2/0 \| -: 2/2/2	1	0	0	0	Result
442	PG1214	hypothetical protein	PG1215	lipoprotein protein, putative	->->	1294411	1294760	350	38.3%	0	0	0	+: 0/1/0 \| -: 0/1/0	2	0	0	0	Result
443	PG1218	hypothetical protein	PG1219	hypothetical protein	->->	1296536	1296810	275	42.9%	0	0	0	+: 0/3/0 \| -: 0/0/0	1	0	0	0	Result
444	PG1221	oxidoreductase, short chain dehydrogenase/reductase family	PG1222	hypothetical protein	-><-	1298995	1299164	170	37.1%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
445	PG1222	hypothetical protein	PG1223	hypothetical protein	<-->	1299483	1299600	118	28%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
446	PG1223	hypothetical protein	PG1225	ABC transporter, ATP-binding protein	->->	1299805	1301524	1720	52.5%	0	1	0	+: 0/0/0 \| -: 1/2/0	1	0	0	0	Result
447	PG1226	peptidyl-prolyl cis-trans isomerase, cyclophilin-type	PG1229	hypothetical protein	-><-	1304109	1305648	1540	48.3%	1	0	0	+: 0/3/0 \| -: 0/4/0	1	0	0	0	Result
448	PG1229	hypothetical protein	PG1230	hypothetical protein	<-<-	1305943	1306049	107	43.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
449	PG1230	hypothetical protein	PG1232	glutamate dehydrogenase	<-<-	1308159	1308363	205	39%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
450	PG1232	glutamate dehydrogenase	PG1233	hypothetical protein	<-->	1309702	1310024	323	36.8%	0	14	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
451	PG1233	hypothetical protein	PG1234	hypothetical protein	->->	1310136	1310251	116	35.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
452	PG1235	epimerase/reductase, putative	PG1236	hypothetical protein	<-->	1311347	1311661	315	36.2%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
459	PG1251	hypothetical protein	PG1252	hypothetical protein	-><-	1328273	1328438	166	43.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
460	PG1256	ribonuclease, Rne/Rng family	PG1257	hypothetical protein	<-<-	1334353	1334550	198	42.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
461	PG1258	DNA-binding protein HU	PG1259	anaerobic ribonucleoside-triphosphate reductase activating protein	<-<-	1334953	1335063	111	30.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
467	PG1264	hypothetical protein	PG1265	hypothetical protein	<-<-	1344986	1345113	128	49.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	4	0	0	0	Result
470	PG1271	acetylornithine aminotransferase, putative	PG1273	hypothetical protein	<-<-	1351534	1351771	238	38.2%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
471	PG1274	elongation factor P	PG1276	DNA-binding protein, histone-like family	->->	1352550	1353084	535	37.2%	0	0	0	+: 0/2/0 \| -: 1/3/0	2	0	0	0	Result
472	PG1276	DNA-binding protein, histone-like family	PG1277	UDP-glucose-6 dehydrogenase, putative	->->	1353592	1353893	302	38.4%	0	0	0	+: 0/3/0 \| -: 0/1/0	1	0	0	0	Result
473	PG1277	UDP-glucose-6 dehydrogenase, putative	PG1278	phosphoserine aminotransferase	->->	1355160	1355491	332	38.9%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
474	PG1278	phosphoserine aminotransferase	PG1279	D-isomer specific 2-hydroxyacid dehydrogenase family protein	->->	1356575	1356674	100	34%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
475	PG1280	hypothetical protein	PG1281	hypothetical protein	->->	1358862	1358987	126	38.1%	0	0	0	+: 0/2/0 \| -: 0/2/0	1	0	0	0	Result
476	PG1283	hypothetical protein	PG1285	glucosamine-6-phosphate deaminase	->->	1362856	1363033	178	49.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
477	PG1285	glucosamine-6-phosphate deaminase	PG1286	ferritin	-><-	1365002	1365108	107	49.5%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
478	PG1286	ferritin	PG1288	GDP-mannose 4,6-dehydratase	<-->	1365592	1366102	511	45.2%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
479	PG1289	GDP-fucose synthetase	PG1290	branched-chain amino acid aminotransferase	->->	1368255	1368392	138	31.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
480	PG1290	branched-chain amino acid aminotransferase	PG1291	hypothetical protein	-><-	1369413	1369540	128	41.4%	0	0	0	+: 0/2/0 \| -: 0/2/0	1	0	0	0	Result
481	PG1291	hypothetical protein	PG1294	ferrous iron transport protein B	<-->	1371269	1372186	918	44.3%	0	0	0	+: 0/13/0 \| -: 0/0/0	13	0	0	0	Result
482	PG1294	ferrous iron transport protein B	PG1296	hypothetical protein	->->	1374722	1374933	212	44.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
483	PG1296	hypothetical protein	PG1297	ribosomal protein S1	->->	1375390	1375970	581	43.4%	0	0	0	+: 0/2/0 \| -: 0/3/0	2	0	0	0	Result
484	PG1297	ribosomal protein S1	PG1300	hypothetical protein	-><-	1377771	1378619	849	50.1%	0	0	0	+: 0/3/0 \| -: 0/4/0	7	0	0	0	Result
485	PG1304	hypothetical protein	PG1305	glycine dehydrogenase	<-<-	1383565	1383760	196	33.2%	0	0	0	+: 0/3/0 \| -: 0/2/0	1	0	0	0	Result
486	PG1308	hypothetical protein	PG1310	exsB protein	<-->	1388819	1389223	405	40%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
487	PG1312	capA protein, putative	PG1313	dipeptidase-related protein	->->	1391614	1392421	808	38%	0	0	0	+: 1/0/0 \| -: 0/0/0	15	0	0	0	Result
489	PG1314	chorismate synthase	PG1315	peptidyl-prolyl cis-trans isomerase SlyD, FKBP-type	<-<-	1395559	1395707	149	38.3%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
492	PG1321	formate--tetrahydrofolate ligase	PG1323	PhoH family protein	<-->	1401414	1401569	156	28.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
493	PG1325	hypothetical protein	PG1326	hemagglutinin, putative	<-->	1403969	1404172	204	30.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
494	PG1326	hemagglutinin, putative	PG1327	aminotransferase, putative	-><-	1405232	1405359	128	43%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
495	PG1328	CoA ligase family protein	PG1330	large conductance mechanosensitive channel protein	<-->	1408771	1409805	1035	42.6%	0	18	1	+: 0/0/0 \| -: 0/4/0	1	0	0	0	Result
496	PG1330	large conductance mechanosensitive channel protein	PG1332	NAD(P) transhydrogenase, beta subunit	->->	1410226	1412181	1956	49.9%	0	1	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
497	PG1332	NAD(P) transhydrogenase, beta subunit	PG1333	hypothetical protein	-><-	1414171	1414315	145	43.4%	0	0	0	+: 0/3/0 \| -: 1/1/0	1	0	0	0	Result
498	PG1335	hypothetical protein	PG1337	umuD protein	<-->	1416985	1417952	968	42.3%	0	0	0	+: 0/4/0 \| -: 0/2/0	5	0	0	0	Result
499	PG1338	umuC protein	PG1340	L-lactate permease	-><-	1419685	1420387	703	44.8%	0	0	0	+: 0/3/0 \| -: 0/0/0	17	0	0	0	Result
500	PG1340	L-lactate permease	PG1341	hypothetical protein	<-->	1421939	1422170	232	37.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
501	PG1343	lipoate-protein ligase B	PG1345	glycosyl transferase, group 1 family protein	->->	1425247	1425729	483	41.4%	0	0	1	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
502	PG1346	glycosyl transferase, group 1 family protein	PG1347	hypothetical protein	->->	1428120	1428255	136	37.5%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
505	PG1353	orotate phosphoribosyltransferase	PG1354	hydrolase, carbon-nitrogen family	<-<-	1433924	1434033	110	35.5%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
506	PG1356	hypothetical protein	PG1357	hypothetical protein	<-<-	1435940	1436416	477	37.1%	0	0	0	+: 0/3/0 \| -: 0/3/0	7	0	0	0	Result
507	PG1357	hypothetical protein	PG1358	acetyltransferase, GNAT family	<-<-	1436549	1436742	194	37.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
508	PG1358	acetyltransferase, GNAT family	PG1359	hypothetical protein	<-<-	1437424	1437733	310	37.1%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
509	PG1362	hypothetical protein	PG1363	hypothetical protein	<-->	1443685	1443943	259	42.9%	0	0	1	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
510	PG1363	hypothetical protein	PG1364	1-deoxy-D-xylulose 5-phosphate reductoisomerase	-><-	1444220	1444477	258	37.6%	0	0	1	+: 0/0/0 \| -: 0/0/0	2	0	0	0	Result
511	PG1370	lysyl-tRNA synthetase	PG1371	phosphorylase family protein	<-<-	1452320	1452441	122	45.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
512	PG1373	hypothetical protein	PG1374	immunoreactive 47 kDa antigen PG97	-><-	1455166	1455343	178	39.9%	0	0	0	+: 0/3/0 \| -: 1/1/0	1	0	0	0	Result
513	PG1375	hypothetical protein	PG1378	A/G-specific adenine glycosylase	-><-	1456804	1457804	1001	34.7%	0	0	0	+: 0/6/0 \| -: 2/6/5	11	0	0	0	Result
514	PG1382	hypothetical protein	PG1383	amino acid exporter, putative	->->	1462611	1462808	198	42.4%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
515	PG1383	amino acid exporter, putative	PG1385	TPR domain protein	-><-	1463448	1465222	1775	46.4%	1	0	0	+: 1/3/0 \| -: 0/7/0	1	0	0	0	Result
516	PG1386	DNA gyrase, A subunit	PG1387	hypothetical protein	<-<-	1469039	1469221	183	41%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
517	PG1389	DNA-binding protein, histone-like family	PG1391	hypothetical protein	<-->	1471419	1471809	391	39.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	13	0	0	0	Result
518	PG1396	cell shape-determining protein MreB	PG1397	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	<-<-	1478817	1478918	102	45.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
519	PG1397	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	PG1398	hypothetical protein	<-->	1480446	1480833	388	44.8%	0	0	1	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
520	PG1398	hypothetical protein	PG1401	beta-eliminating lyase	-><-	1481008	1483488	2481	46.6%	1	42	1	+: 0/5/0 \| -: 2/10/15	7	0	0	0	Result
521	PG1401	beta-eliminating lyase	PG1402	AP endonuclease domain protein	<-<-	1484869	1485120	252	38.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
522	PG1402	AP endonuclease domain protein	PG1403	rhomboid family protein	<-<-	1486054	1486262	209	45.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
523	PG1405	hypothetical protein	PG1407	nitroimidazole resistance protein, putative	<-<-	1490760	1491201	442	42.5%	0	0	4	+: 0/0/0 \| -: 0/0/0	2	0	0	0	Result
524	PG1407	nitroimidazole resistance protein, putative	PG1408	heavy metal efflux pump, CzcD family	<-->	1491739	1492000	262	38.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
525	PG1411	potassium uptake protein TrkA, putative	PG1414	hypothetical protein	<-->	1495257	1497148	1892	42.1%	0	0	0	+: 0/7/0 \| -: 1/4/0	19	0	0	0	Result
526	PG1414	hypothetical protein	PG1416	enoyl-(acyl-carrier-protein) reductase II	->->	1499765	1500196	432	38.4%	0	0	0	+: 1/3/0 \| -: 0/1/0	1	0	0	0	Result
527	PG1416	enoyl-(acyl-carrier-protein) reductase II	PG1417	fumarate hydratase class I, anaerobic	->->	1501139	1501434	296	46.3%	0	0	2	+: 0/3/0 \| -: 0/2/0	1	0	0	0	Result
528	PG1417	fumarate hydratase class I, anaerobic	PG1418	DNA polymerase III, gamma and tau subunits	->->	1503082	1503203	122	45.9%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
531	PG1421	ferredoxin, 4Fe-4S	PG1422	D-alanyl-D-alanine carboxypeptidase	<-<-	1507135	1507469	335	34.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
532	PG1424	peptidylarginine deiminase	PG1426	hypothetical protein	<-<-	1510898	1511241	344	36.6%	0	0	0	+: 1/1/1 \| -: 0/0/0	3	0	0	0	Result
533	PG1426	hypothetical protein	PG1427	thiol protease/hemagglutinin PrtT precursor, putative	<-<-	1511401	1511954	554	41.7%	0	0	0	+: 0/5/0 \| -: 0/2/0	19	0	0	0	Result
534	PG1427	thiol protease/hemagglutinin PrtT precursor, putative	PG1428	riboflavin synthase subunit beta	<-<-	1514487	1514626	140	39.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
535	PG1430	TPR domain protein	PG1431	DNA-binding response regulator, LuxR family	<-<-	1515891	1516075	185	38.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
536	PG1432	sensor histidine kinase	PG1433	hydrolase	<-->	1518690	1518970	281	38.1%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
539	PG1435	integrase	PG1436	ATPase, putative	->->	1521670	1521795	126	24.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
540	PG1436	ATPase, putative	PG1439	hypothetical protein	-><-	1523815	1524674	860	42.9%	0	0	0	+: 1/3/0 \| -: 0/7/0	3	3	1	860	Result	tataggtgtgtaagtagaactgtttcagactacaataaaagtagtttaacacaattctgtttacattctattcctcacattctattatatgttttcgcatcgaatcattcgtatcgttttcttcggcaaaggtagtttcgttgtactgcgggcaacaaggtcaagcgacaagccgttagggcaacaatctccacacttcattcttcaggtagtattcttgccctaaaccttgttgtcctagccacctaacctttttattgcctcgaaacgaaaacgaccgacccgacggaaagacgcataaaaaaaggtcggatatgcgagaagcaggtaaaaagaaaatggaaactcaactccctctcctctggaatccgcataaaatcaaaaaaaaatcagacaagatgaaacagagatacaaaatatcaatttgggtggcacttgcactctcaggctctctcctttggggcggaagcgtctggctttagctggcagggatatgtgtggaaaatttcctcattcggctgctccttaccatcgctttggctatcgcagtgtacattctgacttatgccctcgttatggttgcactttatgcccctatttcatgtataaagaatgaacccaattggaacgtaaattgggctttctccactcaccccgaagtaaggacgggacggataactgttcaagataaacagacggagtaaagcggtcggcggatttgccgaccgctcctctctttcgtgagcatcgggcggacaaagaaaggagcaaagaaaccccaatgaaaaacacttcgttacttttgacagtgagttgagacagctcaaaagtaacaaaaagccaaaattagagatataaaa
541	PG1442	hypothetical protein	PG1444	hypothetical protein	<-->	1528121	1528885	765	39.9%	0	0	0	+: 1/1/0 \| -: 0/1/0	2	3	1	765	Result	acttacttaattttattgttatacaattcactgttcatttctttgccggtatatttacctgcaaagatgaatacatccactatctaagatatgcccgataatggggttgtaccagcagggctacatcctttcgttcataccctttttgtggagatgttcattgatgtccatcaatacaatcgttcgattgtatctgctttcacacatttccacgttcaagtgaaagaatcaaggacgtgttcttcgatataccccctcgcttatatcgctcatcgaatcgtgatatcatcgaagacacattcctccaccgacatattcgacggtgcaaatatatggctcggtgatgctgtaatcagcgtgatttactttagtgcgtacttgtggcttcgatttggatagttgtggcttcgtatgaggtaagggatttaggcacaacgcttagtaactttgcagtaagcgataagtcggtatttcatggctttgaaaacatacatttcgagagaataacatatcgttcttcggaacgaatttatttgcgtcagtgcaaatagcaaggtatgtcttgcgttacccgaaattatttcggtaactcaaaacccttgctcctgcagagggcagaacacctccgaagtcggtgttcttggatagaagttttcgttgtcttgattggctattttatcgtgaacgctctctaatggatttcaattatgtttagcacgttctatttccagaagagagaattacaaaccattaaaatccaaagta
542	PG1444	hypothetical protein	PG1446	MATE efflux family protein	-><-	1529303	1529997	695	40.9%	0	0	11	+: 0/2/0 \| -: 0/1/0	2	2	456	695	Result	tacattttttcccctctccgtccattgaatctcccctttgcaaaggttgcaggcaaaagcgtgtataacggagggtccgaaacaatgagactaaatctctttctgcatcacatagggcaataatcttcagaataaagttgtctgacgctttttgtatctgtccttttgtagagcataaagagattattgtcttaaagtcttcagtttgagtaagtcttagcataatcatatcttttatgt
543	PG1446	MATE efflux family protein	PG1447	transcriptional regulator, AraC family	<-<-	1531318	1531452	135	37%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	1	1	135	Result	catacttccttcttgcaaaatattcacagcgttgttcatccttataatctgtatcttcttaagtaaataaattctgctgcaaaggtacagggggatacaggtcgtcacaatagacaaacaacggtgataatagca
546	PG1450	hypothetical protein	PG1451	hypothetical protein	<-->	1534705	1534836	132	25.8%	0	0	0	+: 1/0/0 \| -: 0/0/0	2	2	1	132	Result	agcgaacttttttcttgttgatattcagtaaaactaacaatatagtgtgtatcatacatttttgtatgtacttgtgtattgtagtgcaaaggtataattttgcagtgatttcaacaatttaaaatacatttt
547	PG1451	hypothetical protein	PG1452	lipoprotein, putative	-><-	1535245	1535369	125	33.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	2	1	1	125	Result	tgaaagagaatccttttgagattgccattatacgctgaaaaaagagaatatgaagtaggtagtggcaataaatccattagaaaaagcagacagtagaaattacttttcttactgcctgcttttct
548	PG1454	integrase	PG1457	hypothetical protein	<-->	1538197	1538789	593	39%	0	35	0	+: 0/0/0 \| -: 0/0/0	2	1	1	119	Result	acgctttaactttatgggcaaaattacccgttatcaaagcgttctctgatacgcaaaatattgataaacagataaaaagaaaccgtatgagaaaaattcttccaataatcattacctca
549	PG1459	hypothetical protein	PG1460	hypothetical protein	<-->	1539860	1540099	240	50%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
550	PG1463	hypothetical protein	PG1465	hypothetical protein	->->	1541532	1542121	590	43.4%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	2	102	590	Result	tttcgggagtatcttttccgtctccaaatctttcatctgttgtcttcgatcccggactgccgataatgcaatgtatcacagtccgtattgaaggctgacgatgtgcaaaaagacctcggcagaaagtcaggtcgtccttacacgaatgttaggtcgaccttacgggccgtttaggtcgtccttacagaccgtttacgtcgaccttacagaccgtttaggtcgacctaactgaacgattaggtcgacctaaaacaaacaacaggtcgtcccgacacatcaaaatcccttcgtgcgatgggtcgcaatccggcagagagccaatgccaaacagattattaaaggttgaattttgaggatatgagttactgattgacgaatcgacaaaccctaagaaatagggattccgggctgtgaaaatagccactattggcgattgcaaacgatattctacttgtatatttttgcgaactcaaataataagaaaaaggt
551	PG1467	methlytransferase, UbiE/COQ5 family	PG1469	type I restriction-modification system, M subunit, putative	-><-	1543962	1545079	1118	35.5%	0	0	1	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
552	PG1469	type I restriction-modification system, M subunit, putative	PG1470	hypothetical protein	<-->	1548089	1548260	172	33.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
553	PG1470	hypothetical protein	PG1471	hypothetical protein	->->	1548492	1548670	179	38%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
554	PG1483	conjugative transposon protein TraE	PG1484	hypothetical protein	<-<-	1559176	1559364	189	46%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
555	PG1486	conjugative transposon protein TraA	PG1487	hypothetical protein	<-->	1561257	1561607	351	43.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
556	PG1490	TraG family protein	PG1491	hypothetical protein	->->	1565565	1565880	316	38.9%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
557	PG1493	hypothetical protein	PG1494	hypothetical protein	->->	1569599	1569980	382	45.3%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
558	PG1496	hypothetical protein	PG1497	DNA-binding protein, histone-like family	->->	1573758	1574224	467	48.4%	0	0	0	+: 0/2/0 \| -: 0/4/0	3	2	117	272	Result	gcacactacgagggaataaaccgcatacgtcgaccctgacagaaagtcaggtcgacataaccggccgtttaggtcgaccttacggagcaaataggtcgtccttacagagcgtttaggtcgacctaaaacggacggaaggtcgacctaaccggagcg
559	PG1497	DNA-binding protein, histone-like family	PG1498	hypothetical protein	->->	1574696	1574795	100	35%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
560	PG1501	transcriptional regulator, tetR family	PG1503	LytB-related protein	<-->	1579190	1580364	1175	32.8%	0	0	3	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
561	PG1505	radical SAM domain protein	PG1507	hypothetical protein	->->	1583262	1583759	498	29.9%	0	0	0	+: 1/1/1 \| -: 0/1/0	1	0	0	0	Result
562	PG1510	hypothetical protein	PG1511	hypothetical protein	<-->	1587627	1587748	122	40.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	2	0	0	0	Result
563	PG1516	hypothetical protein	PG1519	hypothetical protein	->->	1593258	1595844	2587	39.7%	0	250	0	+: 0/4/0 \| -: 0/0/0	1	0	0	0	Result
564	PG1519	hypothetical protein	PG1521	O-succinylbenzoic acid--CoA ligase	-><-	1597486	1598143	658	39.5%	0	0	0	+: 0/2/0 \| -: 0/0/0	3	1	535	646	Result	ttttgccggggacgacgtatcgttccggttaggacgaccctccgtctgttttaggtcgacctgactttctgtcagggtcggcgtgtgtggtttattgtctcgtaatgtgcag
565	PG1526	hypothetical protein	PG1527	hypothetical protein	<-<-	1605462	1605656	195	24.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	1	1	195	Result	gtgcctatttatatcggcaaatatactccaaataaatgaaaatattttttgcgataggatttattataatataaattccgatttgtcaatccgataatctttatttcgatagatatatatctataattttcttatttgtgtacgataatccaaataaacaaagatgtgcttttaaccgttttgtttctatttcat
566	PG1528	hypothetical protein	PG1529	hypothetical protein	->->	1607249	1607374	126	24.6%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
568	PG1535	transcriptional regulator, putative	PG1536	cell division protein FtsX, putative	<-->	1614582	1616501	1920	38.4%	0	0	0	+: 2/3/0 \| -: 0/7/0	3	0	0	0	Result
569	PG1537	hypothetical protein	PG1538	undecaprenol kinase, putative	->->	1617664	1617770	107	54.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
570	PG1538	undecaprenol kinase, putative	PG1540	S-adenosylmethionine:tRNA ribosyltransferase-isomerase	->->	1618614	1619416	803	50.9%	0	1	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
571	PG1544	hypothetical protein	PG1545	superoxide dismutase, Fe-Mn	->->	1623503	1623639	137	31.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
573	PG1549	hypothetical protein	PG1551	hmuY protein	<-->	1628038	1628577	540	38.5%	0	0	1	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
574	PG1556	hypothetical protein	PG1559	aminomethyltransferase	-><-	1637062	1637993	932	42.6%	0	0	2	+: 0/2/0 \| -: 0/2/0	13	0	0	0	Result
575	PG1563	glucose-1-phosphate thymidylyltransferase	PG1564	hypothetical protein	<-<-	1642557	1642670	114	32.5%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
576	PG1566	glutamyl-tRNA synthetase	PG1570	rhodanese-like domain protein	<-<-	1647492	1648671	1180	39.7%	1	0	0	+: 0/0/0 \| -: 0/3/0	6	0	0	0	Result
577	PG1573	transcriptional regulator, Crp family	PG1574	hypothetical protein	<-<-	1652259	1652550	292	43.2%	0	0	0	+: 0/0/0 \| -: 1/0/0	2	0	0	0	Result
578	PG1574	hypothetical protein	PG1576	L-aspartate oxidase	<-->	1652704	1653155	452	36.3%	0	0	0	+: 0/1/0 \| -: 1/1/0	8	0	0	0	Result
579	PG1578	quinolinate synthetase	PG1579	ATPase, MoxR family	->->	1656533	1656632	100	35%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
580	PG1584	batC protein	PG1585	batD protein	->->	1662215	1662394	180	39.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
581	PG1589	dihydropteroate synthase	PG1591	hypothetical protein	<-->	1667529	1668056	528	38.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
583	PG1595	ribulose-phosphate 3-epimerase	PG1596	isoleucyl-tRNA synthetase, putative	<-->	1674341	1674682	342	38%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
584	PG1604	immunoreactive 84 kDa antigen PG93	PG1605	aminopeptidase C	->->	1685208	1685318	111	40.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
585	PG1605	aminopeptidase C	PG1606	ion transporter	-><-	1686663	1686992	330	39.7%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
586	PG1606	ion transporter	PG1608	methylmalonyl-CoA decarboxylase, beta subunit	<-<-	1687716	1688774	1059	39.8%	0	0	0	+: 1/8/4 \| -: 0/4/0	2	0	0	0	Result
587	PG1613	glyoxalase family protein	PG1614	succinate dehydrogenase	<-<-	1693659	1693889	231	38.1%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
588	PG1617	hypothetical protein	PG1618	hypothetical protein	<-->	1697846	1698042	197	49.2%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
591	PG1625	hypothetical protein	PG1626	hypothetical protein	->->	1708779	1708881	103	41.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
592	PG1626	hypothetical protein	PG1630	hypothetical protein	->->	1710547	1711911	1365	46.3%	2	0	1	+: 0/3/0 \| -: 0/10/0	15	0	0	0	Result
593	PG1630	hypothetical protein	PG1632	aldose 1-epimerase	->->	1712203	1712407	205	46.3%	0	0	0	+: 0/1/0 \| -: 0/3/0	1	0	0	0	Result
594	PG1633	galactokinase	PG1634	hypothetical protein	-><-	1714680	1714812	133	51.9%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
595	PG1636	FtsK/SpoIIIE family protein	PG1638	thioredoxin family protein	<-<-	1718551	1718753	203	47.8%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
596	PG1638	thioredoxin family protein	PG1639	hypothetical protein	<-<-	1719741	1719865	125	48%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
599	PG1649	hypothetical protein	PG1651	TPR domain protein	<-->	1730243	1730465	223	41.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
600	PG1655	hypothetical protein	PG1656	methylmalonyl-CoA mutase, small subunit	->->	1737445	1737598	154	33.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
603	PG1660	RNA polymerase sigma-70 factor, ECF subfamily	PG1661	hypothetical protein	<-->	1744359	1744607	249	41.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
607	PG1669	hypothetical protein	PG1670	hypothetical protein	<-<-	1755657	1755784	128	49.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	4	0	0	0	Result
611	PG1675	hypothetical protein	PG1676	phosphoenolpyruvate carboxykinase	-><-	1760421	1760578	158	55.7%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
612	PG1676	phosphoenolpyruvate carboxykinase	PG1677	phosphoglycerate kinase	<-->	1762187	1762481	295	45.1%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
613	PG1677	phosphoglycerate kinase	PG1678	hypothetical protein	-><-	1763739	1763844	106	43.4%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
614	PG1679	hypothetical protein	PG1681	glycogen debranching enzyme, archaeal type, putative	->->	1765331	1766551	1221	48.2%	0	64	0	+: 0/6/0 \| -: 1/2/2	1	0	0	0	Result
615	PG1684	hypothetical protein	PG1685	hypothetical protein	-><-	1771544	1772305	762	44.2%	0	0	1	+: 0/4/0 \| -: 0/2/0	14	0	0	0	Result
616	PG1685	hypothetical protein	PG1687	HIT family protein	<-<-	1773089	1773901	813	40.8%	0	0	17	+: 0/2/0 \| -: 0/4/0	1	0	0	0	Result
617	PG1688	transcription elongation factor GreA	PG1690	Sua5/YciO/YrdC/YwlC family protein	<-<-	1774777	1775260	484	43.4%	0	0	0	+: 0/1/0 \| -: 1/3/0	2	0	0	0	Result
618	PG1694	hypothetical protein	PG1695	hypothetical protein	<-->	1779101	1779579	479	37.8%	0	0	0	+: 0/1/0 \| -: 0/1/0	6	0	0	0	Result
619	PG1695	hypothetical protein	PG1696	type II DNA modification methyltransferase, putative	->->	1779772	1780112	341	42.8%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
620	PG1697	type II restriction endonuclease, putative	PG1701	glutamine amidotransferase, class II/dipeptidase	-><-	1785135	1786234	1100	45.6%	0	0	0	+: 1/0/0 \| -: 1/10/0	14	0	0	0	Result
621	PG1704	thiol:disulfide interchange protein dsbD, putative	PG1706	hypothetical protein	<-<-	1792910	1793938	1029	50.6%	0	4	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
624	PG1714	pyridoxamine-phosphate oxidase	PG1715	hypothetical protein	<-<-	1802583	1803482	900	42.6%	0	0	3	+: 0/0/0 \| -: 0/2/0	14	0	0	0	Result
625	PG1715	hypothetical protein	PG1718	hypothetical protein	<-<-	1806147	1806621	475	42.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
626	PG1720	hypothetical protein	PG1721	ribonuclease R	->->	1810285	1810423	139	49.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
627	PG1721	ribonuclease R	PG1722	hypothetical protein	-><-	1812533	1812722	190	51.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
629	PG1728	cytidine/deoxycytidylate deaminase family protein	PG1729	thiol peroxidase	-><-	1818237	1818431	195	42.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
630	PG1730	O-methyltransferase family protein	PG1731	3-dehydroquinate dehydratase	<-<-	1819668	1819767	100	41%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
631	PG1731	3-dehydroquinate dehydratase	PG1732	integrase/recombinase XerD	<-->	1820194	1820310	117	45.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
633	PG1739	hypothetical protein	PG1741	aspartate ammonia-lyase	<-<-	1825800	1825945	146	49.3%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
634	PG1743	2-dehydro-3-deoxyphosphooctonate aldolase	PG1745	phosphoribulokinase family protein	<-<-	1828439	1829524	1086	38.6%	0	0	0	+: 0/2/0 \| -: 1/5/5	1	0	0	0	Result
636	PG1748	transketolase	PG1750	alpha-1,3/4-fucosidase, putative	<-->	1835020	1835462	443	41.5%	0	0	0	+: 0/0/0 \| -: 0/1/0	2	0	0	0	Result
637	PG1750	alpha-1,3/4-fucosidase, putative	PG1751	aminotransferase, class V	->->	1837284	1837419	136	46.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
638	PG1754	hypothetical protein	PG1755	fructose-bisphosphate aldolase	-><-	1842345	1842486	142	50%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
639	PG1755	fructose-bisphosphate aldolase	PG1757	hypothetical protein	<-<-	1843369	1844020	652	45.6%	0	0	2	+: 0/0/0 \| -: 1/3/3	1	0	0	0	Result
640	PG1757	hypothetical protein	PG1758	ribosomal protein S15	<-->	1845053	1845324	272	41.5%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
641	PG1758	ribosomal protein S15	PG1759	adhesion protein, putative	->->	1845595	1845709	115	42.6%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
642	PG1761	acetyltransferase, GNAT family	PG1762	protein-export membrane protein SecD/protein-export membrane protein SecF	->->	1847800	1848127	328	40.2%	0	0	0	+: 0/2/0 \| -: 1/0/0	1	0	0	0	Result
643	PG1762	protein-export membrane protein SecD/protein-export membrane protein SecF	PG1763	ribonuclease III	-><-	1850963	1851088	126	40.5%	0	0	0	+: 0/2/0 \| -: 0/3/0	1	0	0	0	Result
644	PG1765	acyl carrier protein	PG1766	phosphoribosylglycinamide formyltransferase	<-->	1853389	1853556	168	33.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
645	PG1769	hypothetical protein	PG1770	hypothetical protein	->->	1857071	1857423	353	37.1%	0	0	0	+: 0/0/0 \| -: 0/2/0	2	0	0	0	Result
646	PG1774	transcription-repair coupling factor	PG1775	grpE protein	<-->	1864638	1864983	346	39%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
647	PG1779	hypothetical protein	PG1780	8-amino-7-oxononanoate synthase	->->	1868559	1868925	367	52.6%	0	0	0	+: 0/0/0 \| -: 0/1/0	2	0	0	0	Result
649	PG1786	hypothetical protein	PG1787	hypothetical protein	-><-	1875383	1875530	148	41.9%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
650	PG1787	hypothetical protein	PG1788	cysteine peptidase, putative	<-->	1875999	1876115	117	47.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
651	PG1788	cysteine peptidase, putative	PG1789	peptidyl-dipeptidase Dcp	-><-	1877388	1877506	119	44.5%	0	0	0	+: 0/1/0 \| -: 0/2/0	1	0	0	0	Result
652	PG1791	hypothetical protein	PG1792	sodium/hydrogen antiporter	<-->	1881257	1881761	505	42.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	2	0	0	0	Result
653	PG1794	DNA polymerase type I	PG1795	hypothetical protein	-><-	1888899	1889044	146	41.8%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
654	PG1795	hypothetical protein	PG1797	DNA-binding response regulator/sensor histidine kinase	<-->	1889867	1890152	286	34.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
655	PG1798	immunoreactive 46 kDa antigen PG99	PG1799	hypothetical protein	<-->	1894336	1894638	303	38.6%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
656	PG1799	hypothetical protein	PG1801	v-type ATPase, subunit E, putative	->->	1894849	1895085	237	37.1%	0	0	0	+: 1/0/0 \| -: 0/0/0	1	0	0	0	Result
657	PG1807	v-type ATPase, subunit K	PG1808	guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	-><-	1902686	1903044	359	44%	0	0	0	+: 0/2/0 \| -: 0/5/0	1	0	0	0	Result
658	PG1808	guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	PG1809	2-oxoglutarate oxidoreductase, gamma subunit	<-<-	1905334	1905580	247	40.1%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
659	PG1811	hypothetical protein	PG1812	2-oxoglutarate ferredoxin oxidoreductase	-><-	1907036	1907135	100	42%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
660	PG1813	ferredoxin, 4Fe-4S	PG1814	DNA primase	<-<-	1908465	1908695	231	38.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
661	PG1816	NAD(P)H dehydrogenase, quinone family, putative	PG1817	hypothetical protein	<-<-	1912042	1912309	268	38.4%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
664	PG1823	hypothetical protein	PG1824	phosphopyruvate hydratase	-><-	1918111	1918242	132	43.9%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
665	PG1827	RNA polymerase sigma-70 factor, ECF subfamily	PG1828	lipoprotein, putative	-><-	1920796	1921013	218	43.6%	0	0	0	+: 0/1/0 \| -: 0/3/0	1	0	0	0	Result
666	PG1828	lipoprotein, putative	PG1829	long-chain-fatty-acid--CoA ligase, putative	<-<-	1921227	1921396	170	42.4%	0	0	0	+: 0/0/0 \| -: 0/3/0	1	0	0	0	Result
667	PG1829	long-chain-fatty-acid--CoA ligase, putative	PG1831	ATP-dependent DNA helicase RecQ	<-<-	1923071	1923544	474	45.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
668	PG1831	ATP-dependent DNA helicase RecQ	PG1834	glycogen synthase-related protein	<-->	1925513	1926294	782	46.2%	0	0	0	+: 0/5/0 \| -: 0/0/0	1	0	0	0	Result
669	PG1834	glycogen synthase-related protein	PG1835	lipoprotein, putative	->->	1927111	1927212	102	44.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
670	PG1835	lipoprotein, putative	PG1836	nucleoside permease NupG	->->	1928581	1928682	102	43.1%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
671	PG1836	nucleoside permease NupG	PG1837	hemagglutinin protein HagA	->->	1929919	1930476	558	42.5%	0	0	1	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
672	PG1837	hemagglutinin protein HagA	PG1840	hypothetical protein	->->	1936795	1937241	447	56.6%	0	0	0	+: 0/3/0 \| -: 0/1/0	7	0	0	0	Result
673	PG1842	acetyltransferase, GNAT family	PG1846	hypothetical protein	->->	1939374	1946176	6803	46.1%	1	0	20	+: 4/9/16 \| -: 1/7/5	1	0	0	0	Result
674	PG1853	DNA polymerase III, beta subunit	PG1854	5-formyltetrahydrofolate cyclo-ligase family protein	<-<-	1953210	1953414	205	46.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
675	PG1857	hypothetical protein	PG1858	flavodoxin	<-<-	1956464	1956627	164	45.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
676	PG1858	flavodoxin	PG1859	glycerate kinase family protein	<-<-	1957126	1957263	138	39.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
677	PG1859	glycerate kinase family protein	PG1860	hypothetical protein	<-<-	1958425	1958663	239	38.9%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
678	PG1860	hypothetical protein	PG1861	hypothetical protein	<-<-	1959849	1959976	128	31.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
679	PG1864	leucine-rich protein	PG1866	hypothetical protein	<-->	1964400	1964670	271	39.1%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
680	PG1866	hypothetical protein	PG1868	hypothetical protein	-><-	1964797	1965187	391	38.9%	0	0	0	+: 0/7/0 \| -: 0/3/0	7	0	0	0	Result
681	PG1872	urocanate hydratase	PG1874	hypothetical protein	<-<-	1969002	1969342	341	45.2%	0	0	0	+: 0/1/0 \| -: 1/2/2	1	0	0	0	Result
682	PG1877	Na+/H+ antiporter	PG1878	cysteinyl-tRNA synthetase	<-->	1972938	1973067	130	30.8%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
683	PG1881	hypothetical protein	PG1884	alpha-L-fucosidase precursor, putative	-><-	1978107	1979057	951	50.1%	0	0	0	+: 0/0/0 \| -: 1/2/0	7	0	0	0	Result
684	PG1885	polyphosphate kinase	PG1886	GTP-binding protein HflX	<-<-	1983243	1983405	163	40.5%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
685	PG1888	hypothetical protein	PG1889	hypothetical protein	->->	1986351	1986490	140	40.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
686	PG1889	hypothetical protein	PG1890	lipoprotein, putative	->->	1987151	1987704	554	36.8%	0	0	0	+: 0/7/0 \| -: 0/4/0	1	0	0	0	Result
687	PG1891	hypothetical protein	PG1892	hypothetical protein	->->	1988506	1989564	1059	47.3%	0	0	143	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
688	PG1892	hypothetical protein	PG1893	hypothetical protein	->->	1989952	1991099	1148	32.9%	0	0	0	+: 0/1/0 \| -: 0/8/0	1	0	0	0	Result
689	PG1893	hypothetical protein	PG1894	hypothetical protein	->->	1991874	1992416	543	34.3%	0	0	0	+: 0/2/0 \| -: 0/3/0	1	0	0	0	Result
690	PG1894	hypothetical protein	PG1895	hypothetical protein	->->	1992996	1993601	606	37.6%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
691	PG1895	hypothetical protein	PG1896	S-adenosylmethionine synthetase	->->	1994301	1994725	425	40%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
692	PG1896	S-adenosylmethionine synthetase	PG1897	thiamin pyrophosphokinase catalytic domain protein	-><-	1996016	1996142	127	45.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
693	PG1903	hypothetical protein	PG1904	hypothetical protein	<-<-	2004312	2004521	210	40%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
696	PG1908	hypothetical protein	PG1910	ribosomal protein L17	-><-	2008781	2010371	1591	45.8%	1	0	0	+: 0/5/0 \| -: 1/4/1	1	0	0	0	Result
697	PG1912	30S ribosomal protein S4	PG1913	30S ribosomal protein S11	<-<-	2012471	2012629	159	39.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
698	PG1933	ribosomal protein L22	PG1934	30S ribosomal protein S19	<-<-	2022058	2022165	108	38%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
699	PG1941	30S ribosomal protein S7	PG1942	30S ribosomal protein S12	<-<-	2027800	2028035	236	47.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
700	PG1942	30S ribosomal protein S12	PG1943	hypothetical protein	<-<-	2028441	2029063	623	44.6%	0	0	3	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
701	PG1943	hypothetical protein	PG1944	3-phosphoshikimate 1-carboxyvinyltransferase	<-->	2030351	2030555	205	47.8%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
702	PG1948	lipoprotein, putative	PG1949	malate dehydrogenase	-><-	2038001	2038273	273	46.2%	0	0	0	+: 0/1/0 \| -: 0/3/0	1	0	0	0	Result
703	PG1949	malate dehydrogenase	PG1950	hypothetical protein	<-->	2039279	2039739	461	42.3%	0	0	3	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
704	PG1950	hypothetical protein	PG1951	glutaminyl-tRNA synthetase	->->	2040901	2041281	381	44.6%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
705	PG1954	NAD dependent epimerase/reductase-related protein	PG1956	4-hydroxybutyrate CoA-transferase	-><-	2045673	2046304	632	48.7%	0	0	0	+: 0/2/0 \| -: 0/4/0	7	0	0	0	Result
706	PG1956	4-hydroxybutyrate CoA-transferase	PG1959	ribosomal protein L33	<-<-	2047601	2048306	706	39.9%	0	0	4	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
707	PG1960	ribosomal protein L28	PG1961	hypothetical protein	<-<-	2048754	2048975	222	39.2%	0	0	0	+: 0/0/0 \| -: 1/0/0	1	0	0	0	Result
708	PG1961	hypothetical protein	PG1963	Sua5/YciO/YrdC/YwlC family protein	<-->	2051244	2052477	1234	49.7%	0	0	5	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
709	PG1964	bacterial sugar transferase	PG1966	hypothetical protein	-><-	2054457	2056207	1751	53.9%	0	8	14	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
710	PG1966	hypothetical protein	PG1967	TPR domain protein	<-->	2057015	2057307	293	48.8%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
711	PG1967	TPR domain protein	PG1968	hypothetical protein	-><-	2058196	2058549	354	39%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
712	PG1970	hypothetical protein	PG1972	hemagglutinin protein HagB	<-->	2059874	2060141	268	52.2%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
713	PG1972	hemagglutinin protein HagB	PG1974	hypothetical protein	-><-	2061264	2062053	790	42.4%	0	0	0	+: 0/2/0 \| -: 1/2/0	1	0	0	0	Result
714	PG1974	hypothetical protein	PG1975	hemagglutinin protein HagC	<-->	2063146	2063357	212	41%	0	0	0	+: 0/1/0 \| -: 1/0/0	1	0	0	0	Result
715	PG1975	hemagglutinin protein HagC	PG1977	hypothetical protein	-><-	2064411	2064776	366	50.5%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
716	PG1979	hypothetical protein	PG1980	hypothetical protein	-><-	2067580	2067849	270	37%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
717	PG1980	hypothetical protein	PG1981	CRISPR-associated protein Cas2	<-<-	2068021	2069304	1284	39%	0	0	0	+: 0/5/0 \| -: 0/1/0	1	0	0	0	Result
718	PG1989	hypothetical protein	PG1992	glucose-inhibited division protein A	<-->	2079192	2081549	2358	42.9%	0	0	5	+: 1/1/1 \| -: 0/1/0	1	0	0	0	Result
719	PG1997	hypothetical protein	PG1998	polyprenyl synthetase	-><-	2087133	2087240	108	41.7%	0	0	0	+: 0/1/0 \| -: 0/3/0	1	0	0	0	Result
720	PG1998	polyprenyl synthetase	PG1999	hypothetical protein	<-<-	2088120	2088272	153	38.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
721	PG2003	deoxyguanosinetriphosphate triphosphohydrolase	PG2004	hypothetical protein	<-<-	2093082	2093224	143	45.5%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
722	PG2004	hypothetical protein	PG2006	hypothetical protein	<-->	2094218	2094726	509	37.1%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
723	PG2006	hypothetical protein	PG2008	TonB-dependent receptor, putative	->->	2095087	2095382	296	42.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
724	PG2008	TonB-dependent receptor, putative	PG2009	DNA repair protein RecO, putative	->->	2097885	2098453	569	36.7%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
725	PG2009	DNA repair protein RecO, putative	PG2010	phosphomannomutase, putative	->->	2099192	2099359	168	41.1%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
726	PG2010	phosphomannomutase, putative	PG2013	CRISPR-associated protein Cas2	-><-	2101013	2104315	3303	41%	1	0	0	+: 1/8/8 \| -: 1/5/0	1	0	0	0	Result
727	PG2020	CRISPR-associated TM1814 family protein	PG2021	hypothetical protein	<-<-	2112364	2113010	647	41.3%	0	0	4	+: 0/3/0 \| -: 0/3/0	1	0	0	0	Result
728	PG2022	hypothetical protein	PG2023	methionyl-tRNA formyltransferase	<-<-	2117490	2117654	165	44.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
731	PG2024	hemagglutinin protein HagE	PG2026	phosphoglycerate mutase family protein	<-->	2124294	2125071	778	40.2%	0	0	4	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
732	PG2029	hypothetical protein	PG2030	hypothetical protein	->->	2129263	2129886	624	39.7%	0	0	0	+: 0/3/0 \| -: 0/4/0	2	0	0	0	Result
733	PG2033	glutamate synthase, small subunit	PG2034	oxidoreductase, FAD-binding, putative	<-<-	2134894	2134999	106	47.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
734	PG2034	oxidoreductase, FAD-binding, putative	PG2035	tRNA (guanine-N(1)-)-methyltransferase	<-->	2135792	2135991	200	47.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
735	PG2038	N-acetylmuramoyl-L-alanine amidase, putative	PG2040	DNA-binding protein, histone-like family	<-<-	2138298	2138487	190	40.5%	0	0	0	+: 1/1/0 \| -: 0/1/0	1	0	0	0	Result
736	PG2040	DNA-binding protein, histone-like family	PG2041	hypothetical protein	<-<-	2138965	2139324	360	46.7%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
737	PG2041	hypothetical protein	PG2042	thioredoxin family protein	<-<-	2140057	2140188	132	37.9%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
738	PG2042	thioredoxin family protein	PG2043	conserved hypothetical protein TIGR00486	<-->	2141200	2142357	1158	45.6%	0	13	0	+: 0/3/0 \| -: 1/2/2	1	0	0	0	Result
739	PG2044	hypothetical protein	PG2046	hypothetical protein	->->	2144226	2144488	263	49.8%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
740	PG2049	hypothetical protein	PG2050	hypothetical protein	<-<-	2148995	2149248	254	45.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
741	PG2050	hypothetical protein	PG2052	dihydrodipicolinate synthase	<-->	2149525	2149775	251	33.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
742	PG2053	dithiobiotin synthetase	PG2054	lipoprotein PG3	-><-	2151328	2151432	105	44.8%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
749	PG2073	hypothetical protein	PG2074	hypothetical protein	<-<-	2174465	2174592	128	49.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	4	0	0	0	Result
751	PG2078	hypothetical protein	PG2079	hypothetical protein	<-<-	2178691	2178979	289	41.9%	0	0	0	+: 0/2/0 \| -: 0/1/0	1	0	0	0	Result
752	PG2081	biotin synthetase	PG2082	POT family protein	<-<-	2181752	2181932	181	50.8%	0	0	0	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
753	PG2083	hypothetical protein	PG2085	tryptophanyl-tRNA synthetase	<-->	2184598	2185671	1074	39.9%	0	0	0	+: 1/3/3 \| -: 1/5/0	10	0	0	0	Result
754	PG2089	hypothetical protein	PG2090	cation efflux family protein	->->	2189965	2190369	405	45.2%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
755	PG2092	hypothetical protein	PG2094	hypothetical protein	<-<-	2193001	2193410	410	44.4%	0	0	0	+: 0/0/0 \| -: 0/0/0	5	0	0	0	Result
756	PG2094	hypothetical protein	PG2095	lipoprotein, putative	<-<-	2197959	2198379	421	41.1%	0	0	0	+: 0/1/0 \| -: 0/3/0	1	0	0	0	Result
757	PG2096	hypothetical protein	PG2097	ribose-phosphate pyrophosphokinase	<-<-	2205506	2205610	105	46.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
758	PG2099	ATP-dependent RNA helicase, DEAD/DEAH box family	PG2100	immunoreactive 63 kDa antigen PG102	<-<-	2208023	2208616	594	48.8%	0	0	3	+: 0/1/0 \| -: 0/3/0	1	0	0	0	Result
759	PG2101	hypothetical protein	PG2102	immunoreactive 61 kDa antigen PG91	<-<-	2211364	2211513	150	54.7%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
760	PG2102	immunoreactive 61 kDa antigen PG91	PG2103	hypothetical protein	<-<-	2213137	2213315	179	38.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
761	PG2103	hypothetical protein	PG2104	hypothetical protein	<-<-	2213451	2213574	124	33.1%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
763	PG2105	lipoprotein, putative	PG2106	hypothetical protein	->->	2214640	2214833	194	36.1%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
764	PG2106	hypothetical protein	PG2107	thiamine biosynthesis protein ThiH	-><-	2215518	2215635	118	46.6%	0	0	0	+: 0/1/0 \| -: 0/3/0	1	0	0	0	Result
765	PG2112	hypothetical protein	PG2114	hypothetical protein	-><-	2222724	2224071	1348	45%	0	0	0	+: 0/4/0 \| -: 1/3/0	1	0	0	0	Result
766	PG2114	hypothetical protein	PG2116	hypothetical protein	<-->	2224249	2224774	526	44.7%	0	12	2	+: 0/0/0 \| -: 0/2/0	1	0	0	0	Result
767	PG2116	hypothetical protein	PG2117	30S ribosomal protein S16	-><-	2224928	2225324	397	40.1%	0	0	0	+: 1/1/0 \| -: 1/1/1	4	0	0	0	Result
768	PG2117	30S ribosomal protein S16	PG2119	oxidoreductase, Gfo/Idh/MocA family	<-->	2225904	2226686	783	45.7%	0	0	0	+: 0/4/0 \| -: 0/1/0	1	3	416	559	Result	ctaatctactattcttcgattacgcagcgagagcgtagttattttcgccaattaaacttttgatgtctgagattatagtgcaagccacccacgcactacatgcttacataccgcttcatcacgctgtcaaagccggtcagcccc
769	PG2119	oxidoreductase, Gfo/Idh/MocA family	PG2120	metallo-beta-lactamase superfamily protein	-><-	2227659	2227772	114	43%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
770	PG2121	L-asparaginase	PG2123	hypothetical protein	<-->	2229715	2230030	316	45.3%	1	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
771	PG2124	glyceraldehyde 3-phosphate dehydrogenase, type I	PG2125	transcriptional regulator, AraC family	-><-	2231325	2231465	141	50.4%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
772	PG2125	transcriptional regulator, AraC family	PG2126	conserved hypothetical protein TIGR00044	<-<-	2232345	2232527	183	47%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
775	PG2132	fimbrilin	PG2133	lipoprotein, putative	->->	2239004	2239141	138	40.6%	0	0	0	+: 0/3/0 \| -: 0/2/0	1	0	0	0	Result
776	PG2136	hypothetical protein	PG2139	hypothetical protein	->->	2245165	2245787	623	46.7%	0	0	0	+: 0/4/0 \| -: 0/2/0	1	0	0	0	Result
777	PG2140	ribosomal protein L32	PG2141	3-oxoacyl-(acyl carrier protein) synthase	->->	2246460	2246638	179	46.9%	0	0	0	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
778	PG2146	hypothetical protein	PG2147	xanthine phosphoribosyltransferase	-><-	2254711	2254908	198	47.5%	0	0	0	+: 0/3/0 \| -: 0/0/0	1	0	0	0	Result
779	PG2148	xanthine/uracil permease family protein	PG2149	hypothetical protein	<-<-	2256865	2257025	161	41%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
780	PG2150	LysM domain protein	PG2152	DNA-binding protein, histone-like family	<-->	2259263	2259889	627	40.7%	0	0	7	+: 0/0/0 \| -: 0/5/0	1	0	0	0	Result
783	PG2156	conserved hypothetical protein TIGR00046	PG2157	glutamine cyclotransferase-related protein	<-->	2262736	2263082	347	40.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
784	PG2159	protoporphyrinogen oxidase	PG2161	transcriptional regulator, AraC family	-><-	2265935	2266806	872	43.9%	0	0	4	+: 0/1/0 \| -: 1/0/0	14	0	0	0	Result
785	PG2165	glycyl-tRNA synthetase	PG2166	hypothetical protein	<-->	2271760	2271948	189	34.9%	0	0	0	+: 0/1/0 \| -: 0/0/0	1	0	0	0	Result
786	PG2166	hypothetical protein	PG2167	immunoreactive 53 kDa antigen PG123	-><-	2272060	2272193	134	41%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
787	PG2168	hypothetical protein	PG2170	sugar transporter	<-<-	2274248	2276774	2527	44.5%	1	0	1	+: 1/3/1 \| -: 0/7/0	5	0	0	0	Result
788	PG2171	D-isomer specific 2-hydroxyacid dehydrogenase family protein	PG2172	hypothetical protein	<-<-	2279063	2279280	218	43.6%	0	0	0	+: 0/1/0 \| -: 0/3/0	1	0	0	0	Result
791	PG2182	Na(+)-translocating NADH-quinone reductase subunit A	PG2185	transporter, putative	<-<-	2291246	2292022	777	43.2%	0	0	0	+: 0/1/0 \| -: 0/3/0	1	0	0	0	Result
792	PG2186	transcriptional regulator, putative	PG2187	1,4-dihydroxy-2-naphthoate octaprenyltransferase	<-<-	2293710	2293845	136	35.3%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
793	PG2190	cell-division ATP-binding protein	PG2192	peptidase, M23/M37 family	<-->	2298000	2298380	381	38.8%	0	0	0	+: 0/0/0 \| -: 0/1/0	1	0	0	0	Result
796	PG2197	hypothetical protein	PG2199	ABC transporter, ATP-binding protein, putative	-><-	2303543	2304875	1333	45.9%	0	0	12	+: 1/2/0 \| -: 0/1/0	1	0	0	0	Result
797	PG2201	peptide deformylase	PG2202	Holliday junction resolvase-like protein	<-<-	2309503	2309606	104	46.2%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
798	PG2202	Holliday junction resolvase-like protein	PG2204	hypothetical protein	<-->	2310024	2310520	497	43.5%	0	0	1	+: 0/7/0 \| -: 0/4/0	1	0	0	0	Result
799	PG2205	2-dehydropantoate 2-reductase	PG2206	ABC transporter, ATP-binding protein	-><-	2317206	2317339	134	51.5%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
800	PG2206	ABC transporter, ATP-binding protein	PG2207	hypothetical protein	<-<-	2318957	2319231	275	45.1%	0	0	0	+: 0/0/0 \| -: 0/4/0	1	0	0	0	Result
801	PG2207	hypothetical protein	PG2208	hypothetical protein	<-<-	2320252	2320421	170	43.5%	0	0	0	+: 0/1/0 \| -: 1/1/0	1	0	0	0	Result
804	PG2213	nitrite reductase-related protein	PG2214	hypothetical protein	<-<-	2325121	2325390	270	40%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
805	PG2216	hypothetical protein	PG2217	1-deoxy-D-xylulose-5-phosphate synthase	->->	2329591	2329762	172	41.9%	0	0	0	+: 0/2/0 \| -: 0/0/0	1	0	0	0	Result
808	PG2220	hypothetical protein	PG2221	MiaB-like tRNA modifying enzyme	->->	2335429	2335565	137	41.6%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
809	PG2223	glycosyl transferase, group 2 family protein	PG2224	hypothetical protein	->->	2338822	2339002	181	37%	0	0	0	+: 0/0/0 \| -: 0/0/0	1	0	0	0	Result
810	PG2227	hypothetical protein	PG0001	chromosomal replication initiation protein	->->	2342805	2343476	672	40.3%	0	0	4	+: 0/1/0 \| -: 0/1/0	1	0	0	0	Result
Total:										18	29	0/84		649	23