CDS GC%: 48.7% tRNA GC%: 54.7% rRNA GC%: 53.4%
| IGS# | Up stream Locus | Up stream Product | Down Stream Locus | Down Stream Product | Gene Dir type | Start | End | IGS Len | GC% | IS NT | IS AA | NR | PT-Pair | Intra Spp. IGS | Inter Spp. IGS | Conserved Inter-spp IGS Start | Conserved Inter-spp IGS End | Blast Result | Conserved IGS Seq |
| 4 | PG0010 | ATP-dependent Clp protease, ATP-binding subunit ClpC | PG0011 | glycosyl hydrolase, family 3 | ->-> | 11495 | 11633 | 139 | 44.6% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 5 | PG0013 | hypothetical protein | PG0016 | sigma-54 dependent DNA-binding response regulator | ->-> | 16502 | 17086 | 585 | 43.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 6 | 0 | 0 | 0 | Result | |
| 8 | PG0022 | sulfate permease family protein | PG0024 | redox-sensing transcriptional repressor Rex | <--> | 26887 | 27871 | 985 | 38% | 0 | 0 | 0 | +: 0/6/0 | -: 0/3/0 | 18 | 0 | 0 | 0 | Result | |
| 9 | PG0025 | fumarylacetoacetate hydrolase family protein | PG0026 | hypothetical protein | ->-> | 29257 | 29373 | 117 | 50.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 12 | PG0030 | cytidine deaminase | PG0031 | hypothetical protein | -><- | 36463 | 36994 | 532 | 42.9% | 0 | 0 | 3 | +: 1/1/0 | -: 0/0/0 | 4 | 0 | 0 | 0 | Result | |
| 13 | PG0033 | RmuC domain protein | PG0034 | thioredoxin | <-<- | 41631 | 42324 | 694 | 43.2% | 0 | 0 | 3 | +: 0/2/0 | -: 0/3/0 | 2 | 0 | 0 | 0 | Result | |
| 14 | PG0035 | DNA polymerase III, alpha subunit | PG0037 | 50S ribosomal protein L19 | <--> | 46375 | 46658 | 284 | 37% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 15 | PG0037 | 50S ribosomal protein L19 | PG0039 | hypothetical protein | ->-> | 47025 | 47776 | 752 | 39.1% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 18 | PG0042 | serine hydroxymethyltransferase | PG0043 | beta-hexosaminidase | ->-> | 51050 | 51205 | 156 | 44.2% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 19 | PG0043 | beta-hexosaminidase | PG0045 | heat shock protein 90 | ->-> | 53540 | 54198 | 659 | 43.2% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 3 | 0 | 0 | 0 | Result | |
| 20 | PG0045 | heat shock protein 90 | PG0046 | phosphatidate cytidylyltransferase | -><- | 56254 | 56435 | 182 | 51.1% | 0 | 0 | 0 | +: 0/3/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 21 | PG0047 | cell division protein FtsH, putative | PG0048 | conserved hypothetical protein TIGR00092 | <-<- | 59341 | 59543 | 203 | 38.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 24 | PG0052 | sensor histidine kinase | PG0053 | hypothetical protein | -><- | 64747 | 65056 | 310 | 47.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 25 | PG0055 | hypothetical protein | PG0056 | hypothetical protein | ->-> | 68012 | 68141 | 130 | 30% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 26 | PG0066 | hypothetical protein | PG0068 | hypothetical protein | <--> | 81642 | 81887 | 246 | 43.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 27 | PG0068 | hypothetical protein | PG0069 | hypothetical protein | -><- | 82140 | 82510 | 371 | 46.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 28 | PG0076 | N-acetylmuramoyl-L-alanine amidase, family 4 | PG0078 | hypothetical protein | <-<- | 91424 | 91655 | 232 | 38.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 29 | PG0084 | L-serine dehydratase, iron-sulfur-dependent, single chain form | PG0085 | alpha-galactosidase | ->-> | 99172 | 99311 | 140 | 51.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 30 | PG0086 | ATP-dependent RNA helicase, DEAD/DEAH box family | PG0087 | SIS domain protein | <-<- | 102450 | 102594 | 145 | 44.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 31 | PG0087 | SIS domain protein | PG0088 | peptidase, M16 family | <--> | 103216 | 103414 | 199 | 33.7% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 32 | PG0088 | peptidase, M16 family | PG0090 | Dps family protein | ->-> | 104633 | 105663 | 1031 | 41.9% | 0 | 0 | 2 | +: 0/2/0 | -: 0/0/0 | 15 | 0 | 0 | 0 | Result | |
| 33 | PG0090 | Dps family protein | PG0091 | transporter, putative | -><- | 106144 | 106272 | 129 | 45.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 34 | PG0094 | outer membrane efflux protein, putative | PG0095 | DNA mismatch repair protein | <-<- | 111284 | 112177 | 894 | 39.3% | 0 | 0 | 0 | +: 0/5/0 | -: 0/5/0 | 12 | 0 | 0 | 0 | Result | |
| 35 | PG0095 | DNA mismatch repair protein | PG0097 | hypothetical protein | <-<- | 114854 | 115145 | 292 | 47.3% | 0 | 0 | 0 | +: 0/2/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 36 | PG0099 | phenylalanyl-tRNA synthetase beta subunit | PG0100 | hypothetical protein | <-<- | 118377 | 119141 | 765 | 43.8% | 0 | 0 | 1 | +: 1/3/0 | -: 0/0/0 | 3 | 0 | 0 | 0 | Result | |
| 38 | PG0102 | hypothetical protein | PG0103 | hypothetical protein | ->-> | 121302 | 121429 | 128 | 49.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 4 | 0 | 0 | 0 | Result | |
| 42 | PG0104 | DNA topoisomerase III | PG0106 | glycosyl transferase, group 4 family protein | ->-> | 127509 | 128857 | 1349 | 40.4% | 0 | 0 | 7 | +: 0/4/0 | -: 1/5/0 | 1 | 0 | 0 | 0 | Result | |
| 43 | PG0106 | glycosyl transferase, group 4 family protein | PG0108 | UDP-N-acetyl-D-mannosaminuronic acid dehydrogenase | ->-> | 129995 | 130240 | 246 | 30.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 45 | PG0114 | hypothetical protein | PG0115 | hexapeptide transferase family protein | ->-> | 138059 | 138177 | 119 | 39.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 46 | PG0120 | UDP-N-acetylglucosamine 2-epimerase | PG0121 | DNA-binding protein HU | ->-> | 144305 | 144607 | 303 | 36.6% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 47 | PG0121 | DNA-binding protein HU | PG0123 | hypothetical protein | ->-> | 144875 | 145126 | 252 | 40.9% | 0 | 0 | 0 | +: 0/3/0 | -: 0/4/0 | 1 | 0 | 0 | 0 | Result | |
| 48 | PG0126 | type I phosphodiesterase/nucleotide pyrophosphatase family protein | PG0127 | ferrochelatase | <--> | 148109 | 148689 | 581 | 47.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 49 | PG0129 | mannosyltransferase | PG0130 | phosphoglyceromutase | -><- | 151850 | 152011 | 162 | 50% | 0 | 0 | 0 | +: 0/3/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 50 | PG0130 | phosphoglyceromutase | PG0132 | hypothetical protein | <--> | 152759 | 153018 | 260 | 44.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 51 | PG0132 | hypothetical protein | PG0133 | hypothetical protein | -><- | 153115 | 154348 | 1234 | 53.2% | 0 | 0 | 7 | +: 0/4/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 52 | PG0135 | dimethyladenosine transferase | PG0136 | hypothetical protein | <--> | 158034 | 158163 | 130 | 26.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 53 | PG0137 | aminoacyl-histidine dipeptidase | PG0138 | malonyl CoA-acyl carrier protein transacylase | ->-> | 160699 | 160812 | 114 | 37.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 54 | PG0138 | malonyl CoA-acyl carrier protein transacylase | PG0139 | membrane-bound lytic murein transglycosylase D, putative | -><- | 161695 | 161875 | 181 | 51.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 55 | PG0142 | SpoOJ regulator protein | PG0143 | hydrolase, carbon-nitrogen family | <-<- | 165622 | 165836 | 215 | 47.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 56 | PG0144 | hypothetical protein | PG0145 | hypothetical protein | <--> | 167759 | 167970 | 212 | 52.4% | 0 | 0 | 0 | +: 0/3/0 | -: 0/3/0 | 2 | 0 | 0 | 0 | Result | |
| 57 | PG0153 | aspartyl-tRNA synthetase | PG0155 | riboflavin biosynthesis protein RibD | <-<- | 177521 | 177950 | 430 | 45.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 58 | PG0158 | competence protein F-related protein | PG0159 | endopeptidase PepO | -><- | 181056 | 181184 | 129 | 48.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 59 | PG0160 | hypothetical protein | PG0161 | hypothetical protein | <-<- | 184176 | 184356 | 181 | 38.1% | 0 | 0 | 0 | +: 0/5/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 60 | PG0162 | RNA polymerase sigma-70 factor, ECF subfamily | PG0163 | diphosphate--fructose-6-phosphate 1-phosphotransferase | <-<- | 185177 | 185325 | 149 | 36.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 61 | PG0163 | diphosphate--fructose-6-phosphate 1-phosphotransferase | PG0164 | hypothetical protein | <-<- | 186976 | 187170 | 195 | 46.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 62 | PG0166 | peptidyl-tRNA hydrolase | PG0167 | ribosomal protein L25 | <-<- | 188461 | 188601 | 141 | 52.5% | 0 | 0 | 0 | +: 0/3/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 63 | PG0167 | ribosomal protein L25 | PG0170 | methionyl-tRNA synthetase | <--> | 189181 | 189791 | 611 | 41.1% | 0 | 0 | 0 | +: 0/4/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 66 | PG0179 | hypothetical protein | PG0180 | lipoprotein, putative | ->-> | 202898 | 203194 | 297 | 40.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 67 | PG0181 | immunoreactive 32 kDa antigen PG49 | PG0182 | von Willebrand factor type A domain protein | ->-> | 205546 | 205691 | 146 | 31.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 68 | PG0182 | von Willebrand factor type A domain protein | PG0183 | lipoprotein, putative | ->-> | 209373 | 209568 | 196 | 29.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 71 | PG0186 | lipoprotein RagB | PG0188 | lipoprotein, putative | ->-> | 223058 | 224073 | 1016 | 39.6% | 0 | 250 | 0 | +: 0/6/0 | -: 1/4/0 | 1 | 0 | 0 | 0 | Result | |
| 74 | PG0195 | rubrerythrin | PG0196 | peptidase, M16 family | ->-> | 232765 | 233042 | 278 | 41.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 75 | PG0196 | peptidase, M16 family | PG0197 | hypothetical protein | -><- | 235869 | 236030 | 162 | 44.4% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 76 | PG0197 | hypothetical protein | PG0198 | hypothetical protein | <--> | 236295 | 237021 | 727 | 44.7% | 1 | 0 | 2 | +: 1/5/1 | -: 0/10/0 | 13 | 0 | 0 | 0 | Result | |
| 77 | PG0205 | peptide chain release factor 3 | PG0209 | formate/nitrite transporter | <--> | 242184 | 243370 | 1187 | 42.8% | 0 | 0 | 1 | +: 1/11/1 | -: 0/1/0 | 14 | 0 | 0 | 0 | Result | |
| 78 | PG0213 | precorrin-3 methylase/precorrin-8X methylmutase | PG0214 | RNA polymerase sigma-70 factor, ECF subfamily | <--> | 250555 | 251102 | 548 | 46.5% | 0 | 0 | 3 | +: 0/6/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 79 | PG0218 | hypothetical protein | PG0219 | hypothetical protein | -><- | 254395 | 255099 | 705 | 35.9% | 0 | 0 | 0 | +: 1/1/1 | -: 1/3/0 | 1 | 0 | 0 | 0 | Result | |
| 80 | PG0222 | DNA-binding protein, histone-like family | PG0223 | exonuclease | <-<- | 256471 | 257208 | 738 | 44.9% | 0 | 0 | 0 | +: 0/4/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 83 | PG0229 | hypothetical protein | PG0230 | transaldolase | ->-> | 265411 | 265511 | 101 | 45.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 84 | PG0232 | zinc carboxypeptidase, putative | PG0234 | immunoreactive 23 kDa antigen PG66 | <-<- | 270014 | 270850 | 837 | 41% | 0 | 0 | 0 | +: 0/4/0 | -: 0/1/0 | 13 | 0 | 0 | 0 | Result | |
| 85 | PG0234 | immunoreactive 23 kDa antigen PG66 | PG0235 | carboxyl-terminal protease | <--> | 271475 | 271768 | 294 | 37.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 86 | PG0237 | uracil-DNA glycosylase | PG0240 | hydrolase, haloacid dehalogenase-like family | -><- | 275587 | 276484 | 898 | 49.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 8 | 0 | 0 | 0 | Result | |
| 87 | PG0240 | hydrolase, haloacid dehalogenase-like family | PG0241 | lipoprotein, putative | <-<- | 277184 | 277449 | 266 | 47.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 88 | PG0243 | hypothetical protein | PG0245 | universal stress protein family | <-<- | 279543 | 279862 | 320 | 43.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 89 | PG0245 | universal stress protein family | PG0246 | hypothetical protein | <-<- | 280976 | 281139 | 164 | 44.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 90 | PG0246 | hypothetical protein | PG0248 | translation initation factor SUI1, putative | <-<- | 281332 | 281599 | 268 | 40.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 91 | PG0249 | oxaloacetate decarboxylase, putative | PG0250 | hypothetical protein | <-<- | 283889 | 283994 | 106 | 33% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 92 | PG0250 | hypothetical protein | PG0253 | hypothetical protein | <--> | 284172 | 284746 | 575 | 42.3% | 0 | 0 | 0 | +: 1/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 95 | PG0264 | glycosyl transferase, group 2 family protein | PG0265 | hypothetical protein | -><- | 298183 | 298482 | 300 | 40.3% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 2 | 0 | 0 | 0 | Result | |
| 96 | PG0265 | hypothetical protein | PG0267 | arginyl-tRNA synthetase | <--> | 298642 | 299239 | 598 | 40% | 0 | 14 | 0 | +: 0/0/0 | -: 0/0/0 | 13 | 0 | 0 | 0 | Result | |
| 97 | PG0274 | hypothetical protein | PG0275 | thioredoxin family protein | -><- | 306842 | 307044 | 203 | 42.9% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 98 | PG0275 | thioredoxin family protein | PG0276 | hypothetical protein | <-<- | 307555 | 307691 | 137 | 40.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 100 | PG0278 | hypothetical protein | PG0279 | NADP-dependent malic enzyme | -><- | 310538 | 310764 | 227 | 43.2% | 0 | 0 | 0 | +: 0/3/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 101 | PG0279 | NADP-dependent malic enzyme | PG0280 | ABC transporter, permease protein, putative | <-<- | 313045 | 313386 | 342 | 47.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 102 | PG0281 | ABC transporter, permease protein, putative | PG0282 | ABC transporter, ATP-binding protein | <-<- | 316114 | 316333 | 220 | 37.7% | 0 | 0 | 0 | +: 0/9/0 | -: 0/5/0 | 4 | 0 | 0 | 0 | Result | |
| 103 | PG0283 | efflux transporter, MFP component, RND family | PG0285 | hypothetical protein | <--> | 318336 | 318598 | 263 | 47.5% | 0 | 0 | 0 | +: 1/1/1 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 104 | PG0285 | hypothetical protein | PG0286 | hypothetical protein | ->-> | 320105 | 320256 | 152 | 46.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 105 | PG0291 | hypothetical protein | PG0293 | secretion activator protein, putative | -><- | 326683 | 328182 | 1500 | 49.2% | 0 | 0 | 250 | +: 1/0/0 | -: 2/4/8 | 1 | 0 | 0 | 0 | Result | |
| 106 | PG0293 | secretion activator protein, putative | PG0294 | glycosyl transferase, group 2 family protein | <-<- | 328762 | 329360 | 599 | 38.2% | 0 | 0 | 1 | +: 0/0/0 | -: 0/2/0 | 2 | 0 | 0 | 0 | Result | |
| 107 | PG0296 | phosphoribosylformylglycinamidine synthase | PG0297 | hypothetical protein | <-<- | 335088 | 335386 | 299 | 40.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 108 | PG0297 | hypothetical protein | PG0300 | TPR domain protein | <--> | 335609 | 336709 | 1101 | 37.5% | 1 | 0 | 2 | +: 0/5/0 | -: 1/5/1 | 1 | 0 | 0 | 0 | Result | |
| 109 | PG0300 | TPR domain protein | PG0302 | hypothetical protein | ->-> | 338003 | 338358 | 356 | 40.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 110 | PG0308 | electron transport complex, RnfABCDGE type, A subunit | PG0309 | thiamine biosynthesis lipoprotein ApbE | -><- | 343888 | 344099 | 212 | 43.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 111 | PG0312 | hypothetical protein | PG0313 | hypothetical protein | <--> | 347139 | 347505 | 367 | 39.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 112 | PG0317 | peptidase, M49 family | PG0319 | hypothetical protein | <--> | 352522 | 353088 | 567 | 46.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 113 | PG0320 | hypothetical protein | PG0321 | arginine/ornithine transport system ATPase | ->-> | 354638 | 354787 | 150 | 45.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 114 | PG0322 | serine/threonine transporter | PG0323 | hypothetical protein | -><- | 357027 | 357148 | 122 | 45.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 115 | PG0323 | hypothetical protein | PG0324 | histidine ammonia-lyase | <-<- | 357479 | 357678 | 200 | 48.5% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 116 | PG0328 | imidazolonepropionase | PG0329 | formiminotransferase-cyclodeaminase-related protein | <-<- | 363517 | 363616 | 100 | 54% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 117 | PG0330 | DNA-binding protein, histone-like family | PG0332 | transcription termination factor Rho | <--> | 365084 | 365758 | 675 | 52.4% | 0 | 0 | 0 | +: 0/4/0 | -: 0/3/0 | 2 | 0 | 0 | 0 | Result | |
| 118 | PG0332 | transcription termination factor Rho | PG0333 | hypothetical protein | ->-> | 367736 | 367962 | 227 | 55.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 119 | PG0339 | hypothetical protein | PG0340 | hypothetical protein | ->-> | 375748 | 376205 | 458 | 43.7% | 0 | 0 | 1 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 120 | PG0340 | hypothetical protein | PG0343 | methionine gamma-lyase | -><- | 376497 | 377270 | 774 | 45.1% | 0 | 0 | 0 | +: 0/10/0 | -: 0/11/0 | 1 | 0 | 0 | 0 | Result | |
| 121 | PG0343 | methionine gamma-lyase | PG0344 | purple acid phosphatase | <-<- | 378453 | 378632 | 180 | 46.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 122 | PG0345 | hypothetical protein | PG0346 | GTP-binding protein | <--> | 380699 | 380798 | 100 | 33% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 123 | PG0351 | hypothetical protein | PG0352 | sialidase, putative | ->-> | 387175 | 387326 | 152 | 38.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 124 | PG0352 | sialidase, putative | PG0354 | hypothetical protein | -><- | 388908 | 389220 | 313 | 45% | 0 | 0 | 1 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 125 | PG0354 | hypothetical protein | PG0355 | hypothetical protein | <--> | 389374 | 389783 | 410 | 42.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
| 126 | PG0366 | hypothetical protein | PG0368 | DNA topoisomerase IV subunit B | <--> | 400906 | 401384 | 479 | 50.1% | 0 | 0 | 0 | +: 1/4/3 | -: 0/4/0 | 2 | 0 | 0 | 0 | Result | |
| 127 | PG0369 | phosphopantetheine adenylyltransferase | PG0371 | hypothetical protein | ->-> | 403812 | 404182 | 371 | 35.6% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 6 | 0 | 0 | 0 | Result | |
| 128 | PG0371 | hypothetical protein | PG0373 | hypothetical protein | ->-> | 404285 | 404844 | 560 | 40.2% | 0 | 0 | 0 | +: 1/1/1 | -: 0/1/0 | 2 | 0 | 0 | 0 | Result | |
| 129 | PG0374 | hypothetical protein | PG0375 | 50S ribosomal protein L13 | <--> | 405655 | 406073 | 419 | 45.1% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 130 | PG0376 | 30S ribosomal protein S9 | PG0377 | 30S ribosomal protein S2 | ->-> | 406926 | 407059 | 134 | 38.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 131 | PG0377 | 30S ribosomal protein S2 | PG0378 | elongation factor Ts | ->-> | 407906 | 408043 | 138 | 39.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 132 | PG0378 | elongation factor Ts | PG0380 | excinuclease ABC subunit B | ->-> | 408869 | 409241 | 373 | 44% | 0 | 0 | 0 | +: 1/1/1 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 133 | PG0381 | cell volume regulation protein CvrA | PG0382 | hypothetical protein | <--> | 412796 | 413330 | 535 | 36.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 134 | PG0382 | hypothetical protein | PG0383 | membrane-associated zinc metalloprotease, putative | ->-> | 414804 | 414905 | 102 | 21.6% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 135 | PG0384 | MutS2 family protein | PG0385 | ribosomal protein S21 | ->-> | 418758 | 418918 | 161 | 34.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 138 | PG0393 | ribosomal protein L7/L12 | PG0394 | DNA-directed RNA polymerase beta subunit | ->-> | 425078 | 425188 | 111 | 37.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 139 | PG0395 | DNA-directed RNA polymerase beta' subunit | PG0396 | transcriptional regulator, Crp/Fnr family | ->-> | 433366 | 433652 | 287 | 38.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 140 | PG0400 | hypothetical protein | PG0401 | hypothetical protein | <-<- | 437619 | 437854 | 236 | 53.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 142 | PG0404 | hypothetical protein | PG0408 | hypothetical protein | <-<- | 440197 | 441041 | 845 | 39.9% | 0 | 0 | 0 | +: 0/3/0 | -: 0/3/0 | 3 | 0 | 0 | 0 | Result | |
| 143 | PG0409 | hypothetical protein | PG0410 | hypothetical protein | ->-> | 442411 | 442756 | 346 | 38.4% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 144 | PG0411 | hemagglutinin, putative | PG0412 | DNA mismatch repair protein MutL | -><- | 449419 | 449673 | 255 | 45.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 145 | PG0418 | ATP-dependent Clp protease, proteolytic subunit | PG0419 | hypothetical protein | <-<- | 459420 | 459791 | 372 | 39.8% | 0 | 0 | 0 | +: 0/3/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 146 | PG0419 | hypothetical protein | PG0421 | hypothetical protein | <-<- | 460698 | 460925 | 228 | 43.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 147 | PG0421 | hypothetical protein | PG0422 | hypothetical protein | <-<- | 461784 | 462020 | 237 | 43.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 150 | PG0428 | hypothetical protein | PG0429 | pyruvate synthase | <--> | 466068 | 466239 | 172 | 41.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 151 | PG0431 | hypothetical protein | PG0432 | NOL1/NOP2/sun family protein | -><- | 469235 | 469362 | 128 | 49.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 152 | PG0434 | hypothetical protein | PG0435 | capsular polysaccharide biosythesis protein, putative | <-<- | 472604 | 472797 | 194 | 41.8% | 0 | 0 | 0 | +: 1/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 153 | PG0442 | hypothetical protein | PG0443 | hemagglutinin-related protein | <--> | 481973 | 482160 | 188 | 29.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 154 | PG0443 | hemagglutinin-related protein | PG0444 | oligopeptide transporter, OPT family | ->-> | 483208 | 483395 | 188 | 47.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 155 | PG0445 | peptidase T | PG0446 | thiF protein | ->-> | 486610 | 486738 | 129 | 48.1% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 156 | PG0451 | CBS domain protein | PG0452 | hypothetical protein | ->-> | 492913 | 493018 | 106 | 29.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 157 | PG0452 | hypothetical protein | PG0453 | hypothetical protein | ->-> | 495167 | 495455 | 289 | 47.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 158 | PG0453 | hypothetical protein | PG0456 | PHP N-terminal domain protein | ->-> | 496731 | 497854 | 1124 | 37.8% | 0 | 0 | 0 | +: 0/10/0 | -: 0/4/0 | 5 | 2 | 565 | 747 | Result | ttatgcgtatttccatcgggccggtcgttttcgtttcaagacaataaaacattaagagcttatggcaacagggtttgtggcaagaatacgacctgtaatgaaatggaagtgtggagattaaacggcttgccgtttgacctcgttgccggcagtactccgaaactgcctttgccgaagaaaacg |
| 162 | PG0466 | hypothetical protein | PG0468 | mannose-6-phosphate isomerase, class I | <-<- | 510335 | 510463 | 129 | 43.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 163 | PG0470 | hypothetical protein | PG0471 | hypothetical protein | <--> | 511974 | 512427 | 454 | 44.3% | 0 | 0 | 2 | +: 0/3/0 | -: 0/2/0 | 2 | 0 | 0 | 0 | Result | |
| 164 | PG0472 | iron-sulfur cluster binding protein, putative | PG0474 | low-specificity L-threonine aldolase | -><- | 514475 | 515100 | 626 | 45.2% | 0 | 0 | 1 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 165 | PG0477 | pantoate--beta-alanine ligase | PG0479 | hypothetical protein | <--> | 519688 | 519825 | 138 | 38.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 167 | PG0482 | hypothetical protein | PG0483 | kinase, putative | <-<- | 523220 | 523325 | 106 | 39.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 168 | PG0484 | hypothetical protein | PG0485 | preprotein translocase, YajC subunit | <-<- | 524949 | 525075 | 127 | 48% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 171 | PG0493 | hypothetical protein | PG0494 | hypothetical protein | <-<- | 534991 | 535183 | 193 | 43.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 13 | 0 | 0 | 0 | Result | |
| 172 | PG0494 | hypothetical protein | PG0495 | hypothetical protein | <--> | 535457 | 535586 | 130 | 42.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 173 | PG0495 | hypothetical protein | PG0496 | hypothetical protein | ->-> | 536997 | 537307 | 311 | 47.3% | 0 | 0 | 0 | +: 0/3/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 174 | PG0498 | S-ribosylhomocysteinase | PG0499 | hypothetical protein | ->-> | 538588 | 538848 | 261 | 46.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 6 | 0 | 0 | 0 | Result | |
| 175 | PG0499 | hypothetical protein | PG0500 | queuine tRNA-ribosyltransferase | ->-> | 539203 | 539336 | 134 | 39.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 176 | PG0503 | dipeptidyl aminopeptidase IV | PG0504 | lipoyl synthase | ->-> | 544272 | 544373 | 102 | 45.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 177 | PG0504 | lipoyl synthase | PG0505 | hypothetical protein | ->-> | 545223 | 545334 | 112 | 30.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 178 | PG0506 | arginine-specific cysteine proteinase | PG0507 | hypothetical protein | ->-> | 547686 | 548055 | 370 | 42.4% | 0 | 0 | 0 | +: 0/3/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 179 | PG0514 | translocase | PG0515 | hypothetical protein | <-<- | 556343 | 556452 | 110 | 39.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 180 | PG0517 | hypothetical protein | PG0518 | abortive infection protein family | <-<- | 562188 | 562303 | 116 | 49.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 182 | PG0520 | chaperonin GroEL | PG0521 | co-chaperonin GroES | <-<- | 565346 | 565597 | 252 | 32.9% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 183 | PG0521 | co-chaperonin GroES | PG0522 | tRNA delta(2)-isopentenylpyrophosphate transferase | <-<- | 565868 | 566082 | 215 | 41.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 184 | PG0523 | inositol-5-monophosphate dehydrogenase | PG0524 | hypothetical protein | <--> | 568485 | 568738 | 254 | 42.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 185 | PG0524 | hypothetical protein | PG0525 | CTP synthetase | ->-> | 569024 | 569138 | 115 | 47% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 186 | PG0525 | CTP synthetase | PG0526 | putative inner membrane protein translocase component YidC | ->-> | 570759 | 570885 | 127 | 52% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 187 | PG0530 | carbamoyl-phosphate synthase, large subunit | PG0531 | NAD(+) synthetase | -><- | 579097 | 579285 | 189 | 47.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 188 | PG0531 | NAD(+) synthetase | PG0532 | hypothetical protein | <-<- | 581230 | 581338 | 109 | 38.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 191 | PG0534 | hypothetical protein | PG0535 | hypothetical protein | -><- | 585866 | 586045 | 180 | 47.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 192 | PG0537 | aminoacyl-histidine dipeptidase | PG0538 | outer membrane efflux protein | ->-> | 588455 | 589281 | 827 | 43.3% | 0 | 0 | 0 | +: 1/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 193 | PG0541 | hypothetical protein | PG0542 | hypothetical protein | -><- | 595197 | 595466 | 270 | 45.9% | 0 | 0 | 1 | +: 1/2/2 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 195 | PG0546 | hypothetical protein | PG0547 | hypothetical protein | <--> | 600482 | 600852 | 371 | 35.6% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 196 | PG0547 | hypothetical protein | PG0548 | pyruvate ferredoxin/flavodoxin oxidoreductase family protein | ->-> | 602050 | 602237 | 188 | 42.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 199 | PG0553 | extracellular protease, putative | PG0554 | hypothetical protein | <--> | 611280 | 611604 | 325 | 36.9% | 0 | 0 | 0 | +: 0/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
| 200 | PG0555 | DNA-binding protein, histone-like family | PG0556 | hypothetical protein | <--> | 612325 | 613417 | 1093 | 34.6% | 0 | 0 | 0 | +: 0/6/0 | -: 0/7/0 | 4 | 0 | 0 | 0 | Result | |
| 201 | PG0557 | hypothetical protein | PG0558 | purine nucleoside phosphorylase | -><- | 615068 | 615599 | 532 | 39.8% | 0 | 0 | 0 | +: 1/7/4 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 202 | PG0561 | peptidase, M20/M25/M40 family | PG0562 | potassium uptake protein TrkA, putative | <--> | 619146 | 619361 | 216 | 36.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 203 | PG0564 | hypothetical protein | PG0565 | hypothetical protein | <-<- | 621701 | 621860 | 160 | 30% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 204 | PG0565 | hypothetical protein | PG0566 | DNA-binding protein, histone-like family | <-<- | 622734 | 623024 | 291 | 34.7% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 205 | PG0566 | DNA-binding protein, histone-like family | PG0568 | elongation factor P | <-<- | 623532 | 624088 | 557 | 35.9% | 0 | 0 | 0 | +: 0/6/0 | -: 0/1/0 | 2 | 0 | 0 | 0 | Result | |
| 206 | PG0568 | elongation factor P | PG0569 | hypothetical protein | <-<- | 624656 | 624786 | 131 | 47.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 207 | PG0569 | hypothetical protein | PG0571 | aspartate-semialdehyde dehydrogenase | <--> | 626314 | 626538 | 225 | 36% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 208 | PG0572 | hypothetical protein | PG0573 | S-adenosyl-methyltransferase MraW | <--> | 627662 | 628222 | 561 | 39% | 0 | 0 | 1 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 209 | PG0585 | YqeY family protein | PG0587 | yadS protein | -><- | 643862 | 644701 | 840 | 43.7% | 0 | 0 | 1 | +: 0/7/0 | -: 0/3/0 | 13 | 0 | 0 | 0 | Result | |
| 212 | PG0592 | 50S ribosomal protein L31 | PG0593 | htrA protein | ->-> | 650286 | 650501 | 216 | 43.1% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 213 | PG0593 | htrA protein | PG0594 | RNA polymerase sigma-70 factor | ->-> | 651999 | 652187 | 189 | 47.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 214 | PG0597 | ribosomal protein L9 | PG0598 | hypothetical protein | ->-> | 654342 | 654616 | 275 | 46.5% | 0 | 0 | 0 | +: 0/2/0 | -: 0/6/0 | 1 | 0 | 0 | 0 | Result | |
| 215 | PG0599 | 3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II | PG0602 | hypothetical protein | ->-> | 657793 | 658639 | 847 | 45.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/9/0 | 18 | 0 | 0 | 0 | Result | |
| 216 | PG0608 | hypothetical protein | PG0609 | hypothetical protein | ->-> | 663220 | 663322 | 103 | 35.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 218 | PG0614 | hypothetical protein | PG0615 | GTP-binding protein TypA | ->-> | 666968 | 667172 | 205 | 43.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 219 | PG0615 | GTP-binding protein TypA | PG0616 | thioredoxin, putative | ->-> | 668973 | 669074 | 102 | 33.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 220 | PG0618 | alkyl hydroperoxide reductase, C subunit | PG0619 | alkyl hydroperoxide reductase, F subunit | ->-> | 671079 | 671243 | 165 | 43.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 221 | PG0619 | alkyl hydroperoxide reductase, F subunit | PG0620 | ATP-dependent protease La | ->-> | 672792 | 673102 | 311 | 45% | 0 | 0 | 0 | +: 0/3/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 222 | PG0625 | GTP cyclohydrolase I | PG0626 | hypothetical protein | ->-> | 679310 | 679539 | 230 | 38.7% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 223 | PG0626 | hypothetical protein | PG0627 | RNA-binding protein | -><- | 680407 | 681231 | 825 | 46.9% | 0 | 0 | 0 | +: 0/7/0 | -: 0/2/0 | 13 | 0 | 0 | 0 | Result | |
| 224 | PG0627 | RNA-binding protein | PG0628 | ABC transporter, ATP-binding protein | <-<- | 681526 | 681773 | 248 | 40.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 225 | PG0630 | pyridoxal phosphate biosynthetic protein | PG0631 | MotA/TolQ/ExbB proton channel family protein | ->-> | 684249 | 684405 | 157 | 45.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 226 | PG0639 | signal peptide peptidase SppA, 67K type | PG0645 | hypothetical protein | <-<- | 693091 | 696972 | 3882 | 47.2% | 0 | 5 | 9 | +: 1/3/0 | -: 1/17/1 | 14 | 0 | 0 | 0 | Result | |
| 227 | PG0645 | hypothetical protein | PG0646 | iron compound ABC transporter, ATP-binding protein | <-<- | 698050 | 698159 | 110 | 37.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 228 | PG0648 | iron compound ABC transporter, periplasmic iron compound-binding protein, putative | PG0649 | hypothetical protein | <--> | 701376 | 701959 | 584 | 45% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 229 | PG0649 | hypothetical protein | PG0650 | hypothetical protein | -><- | 702545 | 702670 | 126 | 44.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 230 | PG0650 | hypothetical protein | PG0651 | HDIG domain protein | <-<- | 703055 | 703160 | 106 | 40.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 232 | PG0662 | hypothetical protein | PG0664 | oxidoreductase, Gfo/Idh/MocA family | ->-> | 710217 | 710432 | 216 | 47.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 233 | PG0665 | beta-galactosidase | PG0668 | TonB-dependent receptor | ->-> | 715306 | 717590 | 2285 | 46.8% | 0 | 0 | 47 | +: 2/9/7 | -: 0/3/0 | 2 | 2 | 1368 | 1581 | Result | taaagagaaacgagagaaatgcaatcggcatttctctcgttttgcaaagacgacgtactgctccggttaggacgaccttccgtccgttttaggtcgacctaatcgctctgtaaggacgacctatttgctccgcaaggtcgacctaaacgctcggttaggtcgacctgacttcttgtcagggtcgacgtatgcggtttattcccttgtagtgtgc |
| 234 | PG0669 | heme-binding protein FetB | PG0670 | lipoprotein, putative | ->-> | 720775 | 720891 | 117 | 44.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 235 | PG0672 | iron compound ABC transporter, ATP-binding protein | PG0674 | indolepyruvate ferredoxin oxidoreductase, beta subunit | -><- | 723901 | 724298 | 398 | 47.2% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 236 | PG0676 | oxidoreductase, short chain dehydrogenase/reductase family | PG0677 | saccharopine dehydrogenase | <--> | 727366 | 727792 | 427 | 43.6% | 0 | 0 | 1 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 237 | PG0678 | pyrazinamidase/nicotinamidase, putative | PG0679 | outer membrane efflux protein | ->-> | 729532 | 729733 | 202 | 41.6% | 0 | 0 | 0 | +: 1/4/4 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 238 | PG0680 | efflux transporter, MFP component, RND family | PG0681 | hypothetical protein | -><- | 732362 | 732500 | 139 | 36% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 239 | PG0681 | hypothetical protein | PG0682 | ABC transporter, permease protein, putative | <--> | 732810 | 733010 | 201 | 34.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 240 | PG0685 | ABC transporter, ATP-binding protein | PG0686 | hypothetical protein | -><- | 740916 | 741220 | 305 | 53.8% | 0 | 0 | 0 | +: 0/4/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 241 | PG0686 | hypothetical protein | PG0687 | succinate-semialdehyde dehydrogenase | <-<- | 742775 | 743257 | 483 | 39.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 242 | PG0687 | succinate-semialdehyde dehydrogenase | PG0689 | NAD-dependent 4-hydroxybutyrate dehydrogenase | <-<- | 744614 | 744807 | 194 | 37.1% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 243 | PG0692 | 4-hydroxybutyryl-CoA dehydratase | PG0694 | immunoreactive 42 kDa antigen PG33 | <-<- | 749093 | 749792 | 700 | 39% | 0 | 0 | 0 | +: 0/4/0 | -: 1/1/1 | 1 | 0 | 0 | 0 | Result | |
| 244 | PG0695 | immunoreactive 43 kDa antigen PG32 | PG0698 | lipoprotein, putative | <-<- | 752158 | 752462 | 305 | 33.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 245 | PG0699 | maltodextrin phosphorylase | PG0700 | hypothetical protein | <-<- | 756049 | 756172 | 124 | 36.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 246 | PG0706 | hypothetical protein | PG0707 | TonB-dependent receptor, putative | -><- | 760943 | 761175 | 233 | 45.1% | 0 | 0 | 0 | +: 0/2/0 | -: 0/4/0 | 1 | 0 | 0 | 0 | Result | |
| 247 | PG0707 | TonB-dependent receptor, putative | PG0708 | peptidyl-prolyl cis-trans isomerase, FKBP-type | <-<- | 763723 | 763887 | 165 | 37.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 248 | PG0711 | hypothetical protein | PG0712 | hypothetical protein | -><- | 766342 | 766873 | 532 | 37.4% | 0 | 0 | 0 | +: 0/6/0 | -: 0/7/0 | 4 | 0 | 0 | 0 | Result | |
| 249 | PG0713 | anthranilate synthase component II | PG0714 | copper homeostasis protein CutC | <-<- | 767840 | 768014 | 175 | 46.3% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 250 | PG0715 | transporter | PG0717 | lipoprotein, putative | <-<- | 769687 | 770080 | 394 | 44.2% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 251 | PG0718 | hypothetical protein | PG0719 | sensor histidine kinase | <-<- | 771664 | 771785 | 122 | 30.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 252 | PG0720 | DNA-binding response regulator | PG0721 | NLP/P60 family protein | <--> | 773756 | 773986 | 231 | 40.3% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 253 | PG0721 | NLP/P60 family protein | PG0722 | hypothetical protein | -><- | 774596 | 774828 | 233 | 46.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 254 | PG0722 | hypothetical protein | PG0723 | hypothetical protein | <--> | 774982 | 775088 | 107 | 33.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 255 | PG0729 | D-alanylalanine synthetase | PG0731 | hypothetical protein | <-<- | 780909 | 782109 | 1201 | 51.9% | 0 | 4 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 256 | PG0732 | hypothetical protein | PG0733 | riboflavin synthase subunit alpha | ->-> | 783079 | 783313 | 235 | 38.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 257 | PG0740 | NLP/P60 family protein | PG0741 | hypothetical protein | -><- | 788546 | 788806 | 261 | 42.9% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 258 | PG0742 | antigen PgaA | PG0744 | RNA methyltransferase, TrmH family | <-<- | 790728 | 791222 | 495 | 40.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 1 | 113 | 217 | Result | atagttttgagtatattctttatctttgagtataatctccgaaatgcaatcatttgaaaattagcaacttgtattttctcgaaatttttgatgcggttgccctgt |
| 259 | PG0745 | lactoylglutathione lyase, putative | PG0746 | sensor histidine kinase | <-<- | 792471 | 792625 | 155 | 38.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 260 | PG0747 | sigma-54 dependent DNA-binding response regulator | PG0749 | hypothetical protein | <-<- | 795385 | 795627 | 243 | 43.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 11 | 0 | 0 | 0 | Result | |
| 262 | PG0750 | glycosyl transferase, group 2 family protein | PG0751 | porT protein | <-<- | 796783 | 796933 | 151 | 41.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 263 | PG0751 | porT protein | PG0752 | uracil phosphoribosyltransferase | <--> | 797669 | 797806 | 138 | 34.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 264 | PG0753 | protease | PG0754 | DNA topoisomerase I | ->-> | 800349 | 801082 | 734 | 43.3% | 0 | 0 | 1 | +: 0/4/0 | -: 0/3/0 | 2 | 0 | 0 | 0 | Result | |
| 265 | PG0754 | DNA topoisomerase I | PG0756 | hypothetical protein | -><- | 803450 | 804410 | 961 | 53.4% | 0 | 1 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 266 | PG0759 | TPR domain protein | PG0762 | trigger factor, putative | <--> | 810876 | 812898 | 2023 | 45.3% | 1 | 0 | 0 | +: 0/3/0 | -: 1/2/0 | 6 | 0 | 0 | 0 | Result | |
| 267 | PG0762 | trigger factor, putative | PG0766 | polyribonucleotide nucleotidyltransferase | -><- | 814276 | 816263 | 1988 | 44.1% | 1 | 0 | 0 | +: 1/8/4 | -: 0/8/0 | 1 | 0 | 0 | 0 | Result | |
| 268 | PG0766 | polyribonucleotide nucleotidyltransferase | PG0767 | 4-alpha-glucanotransferase | <-<- | 818496 | 818646 | 151 | 38.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 270 | PG0768 | hypothetical protein | PG0769 | fibronectin type III domain protein | <-<- | 822472 | 822644 | 173 | 43.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 271 | PG0771 | hypothetical protein | PG0772 | hypothetical protein | ->-> | 824928 | 825114 | 187 | 36.4% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 272 | PG0773 | hypothetical protein | PG0774 | hypothetical protein | -><- | 825409 | 825786 | 378 | 33.6% | 0 | 0 | 0 | +: 0/6/0 | -: 0/1/0 | 6 | 0 | 0 | 0 | Result | |
| 275 | PG0778 | hypothetical protein | PG0779 | hypothetical protein | <-<- | 831960 | 832189 | 230 | 35.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 277 | PG0784 | polyprenyl synthetase | PG0785 | tonB protein, putative | <-<- | 836820 | 836989 | 170 | 40.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 278 | PG0792 | hypoxanthine phosphoribosyltransferase | PG0793 | fructose-1,6-bisphosphatase | <--> | 843805 | 844427 | 623 | 42.5% | 0 | 0 | 3 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 279 | PG0793 | fructose-1,6-bisphosphatase | PG0794 | penicillin-binding protein 1A, putative | ->-> | 846396 | 846550 | 155 | 46.5% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 282 | PG0801 | polyA polymerase family protein | PG0802 | alpha keto acid dehydrogenase complex, E3 component, lipoamide dehydrogenase | <-<- | 857805 | 858462 | 658 | 45% | 0 | 0 | 7 | +: 0/1/0 | -: 1/1/1 | 1 | 0 | 0 | 0 | Result | |
| 283 | PG0807 | NusB family protein | PG0809 | hypothetical protein | <-<- | 864815 | 865153 | 339 | 42.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 284 | PG0811 | Holliday junction DNA helicase motor protein | PG0814 | hypothetical protein | <-<- | 873300 | 875993 | 2694 | 46.4% | 1 | 250 | 0 | +: 0/4/0 | -: 1/2/1 | 3 | 0 | 0 | 0 | Result | |
| 285 | PG0816 | hypothetical protein | PG0819 | integrase | <--> | 876950 | 877465 | 516 | 40.1% | 0 | 35 | 0 | +: 0/0/0 | -: 0/0/0 | 2 | 1 | 398 | 516 | Result | tgaggtaatgattattggaagaatttttctcatacggtttctttttatctgtttatcaatattttgcgtatcagagaacgctttgataacgggtaattttgcccataaagttaaagcgt |
| 286 | PG0821 | lipoprotein, putative | PG0822 | hypothetical protein | -><- | 880293 | 880417 | 125 | 33.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 2 | 1 | 1 | 125 | Result | agaaaagcaggcagtaagaaaagtaatttctactgtctgctttttctaatggatttattgccactacctacttcatattctcttttttcagcgtataatggcaatctcaaaaggattctctttca |
| 287 | PG0822 | hypothetical protein | PG0823 | hypothetical protein | <--> | 880826 | 880957 | 132 | 25.8% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 2 | 2 | 1 | 132 | Result | aaaatgtattttaaattgttgaaatcactgcaaaattatacctttgcactacaatacacaagtacatacaaaaatgtatgatacacactatattgttagttttactgaatatcaacaagaaaaaagttcgct |
| 290 | PG0827 | MATE efflux family protein | PG0829 | hypothetical protein | -><- | 885665 | 886359 | 695 | 40.9% | 0 | 0 | 11 | +: 0/1/0 | -: 0/2/0 | 2 | 2 | 1 | 240 | Result | acataaaagatatgattatgctaagacttactcaaactgaagactttaagacaataatctctttatgctctacaaaaggacagatacaaaaagcgtcagacaactttattctgaagattattgccctatgtgatgcagaaagagatttagtctcattgtttcggaccctccgttatacacgcttttgcctgcaacctttgcaaaggggagattcaatggacggagaggggaaaaaatgta |
| 291 | PG0829 | hypothetical protein | PG0831 | hypothetical protein | <--> | 886837 | 887542 | 706 | 40.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 2 | 2 | 1 | 695 | Result | ttgaaatccattagagagcgttcacgataaaatagccaatcaagacaacgaaaacttctatccaagaacaccgacttcggaggtgttctgccctctgcaagagcaagggttttgagttaccgaaataatttcgggtaacgcaagacataccttgctatttgcactgacgcaaataaattcgttccgaagaacgatatgttattctctcgaaatgtatgtttcccaagccatgaaataccgacttatcgcttactgcaaagttacgatctcttgtacccaaagctattaggtagaacgaagccacaattatccaaatcgatgccacaagtacgcactaaaggaaatcacgctgattacagcatcaccgaaccatatatttgcactgtcgaatatgtcggtgatggtatgtgtcttcgataacatcacgtttcgatgagcgatataggcgagggtgtatgtcaaagaacatgtccttgattctttcactcgaacgtgggaatgtgcgaaggcagatacaatcgaacgattgtattgatggacactaatgaacatctccacagaaagggtatgaatgaaaggatgtagccctactggtacaagccgattattgggcatatcttcgatagcggatgtattcatcttcatcggtaaatatactggcaacgaaatgaacaatgaattgtgtaataataaaa |
| 292 | PG0831 | hypothetical protein | PG0832 | hypothetical protein | -><- | 887972 | 888769 | 798 | 42% | 0 | 0 | 0 | +: 0/2/0 | -: 0/4/0 | 2 | 3 | 121 | 651 | Result | tgctcatgaaagaaagtagcggtggacaaatctgccgaccgctttactctgtctgttcttcttgaacggttacttgttccgtccttacttcggaataaatcatcttgtctgattttatgcggattccagaggtgagggagttgagtttcaaccttttcttttttccctgcttcttgcatatccaacattttttatgcgttttttccgtcggggcggtcgttctcgtttcaggggcgaaaaaaggtagggcttaggacaaacaaggttttacggtgagaatactacctgcaataaaatggaagtgtggagattgtcgtctaaacggcttgctgccccgaccttttttgtccgtagaagcctggaactaccttcgccgctgacaacgaacaaccgatcccgacatgatacacggcataagttgaggaagtgcagggagagaagcagggcgaacacaaaaaacgcagtctttaaagactgcatttaccataagaatagaatacacagaaaacaaaaagccgccctaacggacgg |
| 293 | PG0833 | hypothetical protein | PG0834 | hypothetical protein | <-<- | 891664 | 892087 | 424 | 31.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 295 | PG0835 | hypothetical protein | PG0838 | integrase | ->-> | 893858 | 895616 | 1759 | 40.6% | 0 | 44 | 0 | +: 0/1/0 | -: 1/3/1 | 1 | 0 | 0 | 0 | Result | |
| 296 | PG0838 | integrase | PG0839 | hypothetical protein | ->-> | 896916 | 897352 | 437 | 40.7% | 0 | 0 | 0 | +: 0/2/0 | -: 3/0/0 | 1 | 0 | 0 | 0 | Result | |
| 297 | PG0840 | hypothetical protein | PG0841 | mobilizable transposon, excision protein, putative | -><- | 902544 | 902870 | 327 | 45.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 298 | PG0841 | mobilizable transposon, excision protein, putative | PG0842 | mobilizable transposon, hypothetical protein, putative | <-<- | 903765 | 903899 | 135 | 50.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 299 | PG0843 | hypothetical protein | PG0844 | hypothetical protein | <--> | 905273 | 905428 | 156 | 44.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 301 | PG0847 | hypothetical protein | PG0848 | hypothetical protein | -><- | 909475 | 909578 | 104 | 38.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 302 | PG0851 | hypothetical protein | PG0853 | DNA-binding protein, histone-like family | <--> | 912823 | 914523 | 1701 | 44.9% | 1 | 0 | 1 | +: 1/3/0 | -: 0/6/0 | 1 | 0 | 0 | 0 | Result | |
| 303 | PG0854 | hypothetical protein | PG0855 | hypothetical protein | -><- | 915829 | 916049 | 221 | 34.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 304 | PG0855 | hypothetical protein | PG0856 | hypothetical protein | <--> | 916146 | 916329 | 184 | 29.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 305 | PG0856 | hypothetical protein | PG0857 | transcriptional regulator, putative | ->-> | 917236 | 917458 | 223 | 39% | 0 | 0 | 0 | +: 0/3/0 | -: 0/3/0 | 1 | 1 | 10 | 210 | Result | aatatccccgaaaaggggtataatacatttatattccttatatttgccactgataaggtatataatgactttctcggagtgagccgtgcatagtgatatgccttgaatatgtacccaaaagagacaaaatgggtacatatccttgggacgtgtacccgaaaacggcatttggggtacatattcggaatatggaacttcaag |
| 308 | PG0869 | mobilization protein | PG0870 | hypothetical protein | <-<- | 932294 | 932393 | 100 | 43% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 309 | PG0872 | mobilizable transposon, xis protein | PG0873 | mobilizable transposon, tnpC protein | <-<- | 935296 | 936199 | 904 | 35% | 0 | 0 | 0 | +: 0/0/0 | -: 1/2/2 | 1 | 0 | 0 | 0 | Result | |
| 310 | PG0873 | mobilizable transposon, tnpC protein | PG0874 | mobilizable transposon, int protein | <-<- | 936899 | 936999 | 101 | 35.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 311 | PG0875 | mobilizable transposon, tnpA protein | PG0876 | tRNA modification GTPase | <-<- | 939095 | 939339 | 245 | 43.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 312 | PG0877 | hypothetical protein | PG0879 | hypothetical protein | <-<- | 941636 | 942020 | 385 | 44.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 313 | PG0881 | recombinase A | PG0882 | hypothetical protein | ->-> | 944226 | 944334 | 109 | 55% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 314 | PG0886 | hypothetical protein | PG0888 | hypothetical protein | ->-> | 949747 | 950049 | 303 | 45.2% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 315 | PG0890 | alkaline phosphatase, putative | PG0893 | hydroxylamine reductase | -><- | 953164 | 954290 | 1127 | 46.4% | 0 | 0 | 0 | +: 0/7/0 | -: 0/8/0 | 7 | 0 | 0 | 0 | Result | |
| 316 | PG0893 | hydroxylamine reductase | PG0894 | DNA repair protein RadC | <-<- | 955944 | 956167 | 224 | 42% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 319 | PG0896 | beta-galactosidase | PG0897 | alpha-amylase family protein | -><- | 960443 | 960957 | 515 | 38.4% | 0 | 0 | 0 | +: 1/4/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 320 | PG0898 | hypothetical protein | PG0899 | cytochrome d ubiquinol oxidase, subunit II | <-<- | 963441 | 963586 | 146 | 39.7% | 0 | 0 | 0 | +: 0/0/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
| 321 | PG0901 | hypothetical protein | PG0902 | alpha-1,2-mannosidase family protein | <-<- | 966654 | 966835 | 182 | 36.3% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 322 | PG0902 | alpha-1,2-mannosidase family protein | PG0903 | hypothetical protein | <-<- | 969062 | 969187 | 126 | 43.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 323 | PG0903 | hypothetical protein | PG0906 | lipoprotein, putative | <--> | 969731 | 970755 | 1025 | 38.5% | 0 | 0 | 0 | +: 0/4/0 | -: 0/2/0 | 10 | 0 | 0 | 0 | Result | |
| 324 | PG0906 | lipoprotein, putative | PG0908 | G/U mismatch-specific DNA glycosylase, putative | -><- | 971209 | 971319 | 111 | 41.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 325 | PG0910 | FHA domain protein | PG0912 | polysaccharide transport protein, putative | <-<- | 973757 | 973880 | 124 | 41.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 326 | PG0912 | polysaccharide transport protein, putative | PG0914 | hypothetical protein | <-<- | 975447 | 975793 | 347 | 42.7% | 0 | 0 | 0 | +: 0/5/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 327 | PG0914 | hypothetical protein | PG0915 | hypothetical protein | <--> | 976508 | 976724 | 217 | 37.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 329 | PG0918 | hypothetical protein | PG0919 | dihydroorotase | <-<- | 978909 | 979074 | 166 | 42.2% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 330 | PG0920 | glycosyl transferase, group 2 family protein | PG0922 | hypothetical protein | <-<- | 981116 | 981317 | 202 | 44.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 331 | PG0925 | thymidine kinase | PG0926 | hypothetical protein | <-<- | 984370 | 984496 | 127 | 43.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 332 | PG0930 | hypothetical protein | PG0932 | DNA polymerase III, delta prime subunit, putative | <--> | 987633 | 988642 | 1010 | 45.5% | 0 | 0 | 9 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 333 | PG0932 | DNA polymerase III, delta prime subunit, putative | PG0933 | translation elongation factor G, putative | ->-> | 989894 | 990136 | 243 | 44.9% | 0 | 0 | 0 | +: 0/3/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 334 | PG0933 | translation elongation factor G, putative | PG0934 | hypothetical protein | -><- | 992297 | 992503 | 207 | 48.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 337 | PG0949 | hypothetical protein | PG0950 | glycine cleavage system protein H | ->-> | 1009834 | 1010000 | 167 | 32.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 338 | PG0951 | phosphoribosylaminoimidazole carboxylase, PurE protein | PG0952 | 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase | ->-> | 1010889 | 1011061 | 173 | 47.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 339 | PG0958 | ribonuclease BN, putative | PG0959 | ATP-binding protein, Mrp/Nbp35 family | <-<- | 1019461 | 1020112 | 652 | 51.2% | 0 | 0 | 1 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 340 | PG0962 | prolyl-tRNA synthetase | PG0963 | hypothetical protein | <-<- | 1023899 | 1024176 | 278 | 43.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 342 | PG0965 | phosphatidylserine decarboxylase | PG0968 | Mrr restriction system protein | <--> | 1025867 | 1026967 | 1101 | 37.2% | 0 | 0 | 0 | +: 0/3/0 | -: 0/2/0 | 9 | 0 | 0 | 0 | Result | |
| 347 | PG0972 | hypothetical protein | PG0973 | alpha-1,2-mannosidase family protein | ->-> | 1034104 | 1034306 | 203 | 40.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 348 | PG0973 | alpha-1,2-mannosidase family protein | PG0975 | PhoH family protein | ->-> | 1036623 | 1037423 | 801 | 44.8% | 0 | 0 | 0 | +: 0/9/0 | -: 0/0/0 | 14 | 0 | 0 | 0 | Result | |
| 351 | PG0982 | TPR domain protein | PG0984 | hypothetical protein | -><- | 1046703 | 1046802 | 100 | 35% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 352 | PG0987 | hypothetical protein | PG0989 | 50S ribosomal protein L20 | -><- | 1048919 | 1050788 | 1870 | 47.3% | 1 | 250 | 0 | +: 0/6/0 | -: 1/2/2 | 3 | 0 | 0 | 0 | Result | |
| 353 | PG0989 | 50S ribosomal protein L20 | PG0990 | ribosomal protein L35 | <-<- | 1051137 | 1051248 | 112 | 36.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 354 | PG0991 | translation initiation factor IF-3 | PG0992 | threonyl-tRNA synthetase | <-<- | 1052130 | 1052232 | 103 | 31.1% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 355 | PG0992 | threonyl-tRNA synthetase | PG0994 | hypothetical protein | <--> | 1054195 | 1055060 | 866 | 40.8% | 0 | 160 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 356 | PG0994 | hypothetical protein | PG0995 | hypothetical protein | -><- | 1055160 | 1055558 | 399 | 36.8% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 357 | PG0996 | conserved hypothetical protein TIGR01777 | PG0997 | transcriptional regulator, putative | ->-> | 1056641 | 1056805 | 165 | 30.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 358 | PG1003 | hypothetical protein | PG1004 | prolyl oligopeptidase family protein | -><- | 1060365 | 1060522 | 158 | 50% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 359 | PG1004 | prolyl oligopeptidase family protein | PG1005 | lipoprotein, putative | <-<- | 1062803 | 1063112 | 310 | 47.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 360 | PG1010 | ABC transporter, ATP-binding protein | PG1012 | tRNA-i(6)A37 modification enzyme MiaB | <-<- | 1069427 | 1070178 | 752 | 40.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 361 | PG1012 | tRNA-i(6)A37 modification enzyme MiaB | PG1013 | acetyl-CoA hydrolase/transferase family protein | <--> | 1071571 | 1071873 | 303 | 33.7% | 0 | 0 | 0 | +: 2/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 362 | PG1013 | acetyl-CoA hydrolase/transferase family protein | PG1014 | TPR domain protein | ->-> | 1073371 | 1073902 | 532 | 37.8% | 0 | 0 | 0 | +: 0/3/0 | -: 1/2/0 | 2 | 0 | 0 | 0 | Result | |
| 363 | PG1015 | hypothetical protein | PG1017 | pyruvate phosphate dikinase | <--> | 1076111 | 1076277 | 167 | 40.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 364 | PG1019 | lipoprotein, putative | PG1020 | hypothetical protein | ->-> | 1080537 | 1080707 | 171 | 45% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 365 | PG1022 | hypothetical protein | PG1024 | hypothetical protein | ->-> | 1085159 | 1086837 | 1679 | 50.9% | 0 | 3 | 24 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 366 | PG1024 | hypothetical protein | PG1025 | hypothetical protein | ->-> | 1086937 | 1087280 | 344 | 41.6% | 0 | 0 | 3 | +: 1/2/2 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 367 | PG1026 | hypothetical protein | PG1027 | hypothetical protein | -><- | 1089049 | 1089286 | 238 | 35.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 369 | PG1029 | hypothetical protein | PG1030 | hypothetical protein | ->-> | 1091397 | 1091539 | 143 | 32.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 373 | PG1038 | ATP-dependent DNA helicase UvrD/PcrA/Rep Family | PG1039 | integral membrane protein | -><- | 1105182 | 1105414 | 233 | 42.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 374 | PG1039 | integral membrane protein | PG1040 | transcriptional regulator, putative | <-<- | 1107143 | 1107574 | 432 | 38.7% | 0 | 0 | 0 | +: 1/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 377 | PG1053 | transcriptional regulator, putative | PG1055 | thiol protease | -><- | 1120892 | 1121291 | 400 | 41.2% | 0 | 0 | 0 | +: 0/2/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 378 | PG1055 | thiol protease | PG1056 | hypothetical protein | <--> | 1122738 | 1123119 | 382 | 34% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 382 | PG1065 | dihydroorotate dehydrogenase | PG1066 | butyrate-acetoacetate CoA-transferase, subunit A | ->-> | 1133391 | 1133660 | 270 | 33% | 0 | 0 | 0 | +: 2/1/1 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 384 | PG1078 | electron transfer flavoprotein, alpha subunit | PG1079 | enoyl-CoA hydratase/isomerase family protein | ->-> | 1146586 | 1146688 | 103 | 48.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 385 | PG1080 | 3-hydroxyacyl-CoA dehydrogenase family protein | PG1081 | acetate kinase | -><- | 1148352 | 1148520 | 169 | 41.4% | 0 | 0 | 0 | +: 0/4/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 386 | PG1082 | phosphotransacetylase | PG1083 | hypothetical protein | <-<- | 1150774 | 1150982 | 209 | 35.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 387 | PG1084 | thioredoxin family protein | PG1085 | hypothetical protein | <--> | 1153049 | 1153342 | 294 | 28.9% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 388 | PG1085 | hypothetical protein | PG1087 | radical SAM protein, TIGR01212 family | ->-> | 1153592 | 1153944 | 353 | 43.1% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 389 | PG1089 | DNA-binding response regulator RprY | PG1091 | DHH subfamily 1 protein | <--> | 1156351 | 1157156 | 806 | 38.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 390 | PG1091 | DHH subfamily 1 protein | PG1093 | hypothetical protein | ->-> | 1158153 | 1158260 | 108 | 42.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 391 | PG1095 | RNA methyltransferase, TrmA family | PG1096 | hypothetical protein | ->-> | 1161763 | 1161978 | 216 | 41.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 392 | PG1097 | Mur ligase domain protein/alanine racemase | PG1098 | hypothetical protein | -><- | 1165569 | 1165875 | 307 | 31.9% | 0 | 0 | 0 | +: 0/1/0 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
| 393 | PG1101 | sodium:solute symporter family protein | PG1102 | hypothetical protein | <-<- | 1170560 | 1170949 | 390 | 45.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 394 | PG1106 | UDP-N-acetylmuramoylalanyl-D-glutamyl-2, 6-diaminopimelate--D-alanyl-D-alanyl ligase | PG1107 | hypothetical protein | <--> | 1178520 | 1178899 | 380 | 40% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 396 | PG1108 | hypothetical protein | PG1109 | mobilization protein | <-<- | 1181199 | 1181514 | 316 | 40.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 397 | PG1110 | hypothetical protein | PG1112 | hypothetical protein | ->-> | 1183298 | 1185142 | 1845 | 49.4% | 0 | 0 | 6 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 398 | PG1113 | integrase | PG1114 | aspartate 1-decarboxylase precursor | <--> | 1186837 | 1187176 | 340 | 40.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 399 | PG1115 | signal recognition particle protein | PG1116 | methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase | ->-> | 1188948 | 1189070 | 123 | 48% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 400 | PG1116 | methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase | PG1117 | MATE efflux family protein | ->-> | 1189962 | 1190149 | 188 | 47.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 401 | PG1117 | MATE efflux family protein | PG1118 | clpB protein | -><- | 1191602 | 1192172 | 571 | 44.5% | 0 | 0 | 0 | +: 1/2/2 | -: 0/2/0 | 13 | 0 | 0 | 0 | Result | |
| 402 | PG1118 | clpB protein | PG1119 | flavodoxin, putative | <--> | 1194765 | 1194982 | 218 | 35.3% | 0 | 0 | 0 | +: 0/0/0 | -: 2/0/0 | 1 | 0 | 0 | 0 | Result | |
| 403 | PG1119 | flavodoxin, putative | PG1121 | asparaginyl-tRNA synthetase | -><- | 1195544 | 1196235 | 692 | 36.7% | 0 | 0 | 0 | +: 0/2/0 | -: 1/4/1 | 14 | 0 | 0 | 0 | Result | |
| 404 | PG1121 | asparaginyl-tRNA synthetase | PG1123 | adenylosuccinate lyase | <-<- | 1197646 | 1199096 | 1451 | 45.3% | 0 | 4 | 0 | +: 0/2/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 405 | PG1123 | adenylosuccinate lyase | PG1124 | ATP:cob(I)alamin adenosyltransferase, putative | <-<- | 1200441 | 1200574 | 134 | 35.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 406 | PG1126 | uracil permease | PG1127 | transcriptional regulator, AsnC Family | <--> | 1203024 | 1203362 | 339 | 33% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 2 | 0 | 0 | 0 | Result | |
| 407 | PG1128 | exodeoxyribonuclease VII large subunit | PG1129 | ribonucleotide reductase | ->-> | 1205260 | 1205537 | 278 | 36.3% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 408 | PG1129 | ribonucleotide reductase | PG1130 | TPR domain protein | ->-> | 1208091 | 1208192 | 102 | 48% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 409 | PG1130 | TPR domain protein | PG1132 | valyl-tRNA synthetase | ->-> | 1210191 | 1211051 | 861 | 40.8% | 0 | 0 | 0 | +: 0/2/0 | -: 0/3/0 | 14 | 0 | 0 | 0 | Result | |
| 411 | PG1134 | thioredoxin reductase | PG1135 | bacterial sugar transferase | ->-> | 1215432 | 1215999 | 568 | 33.3% | 0 | 0 | 0 | +: 0/2/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 412 | PG1135 | bacterial sugar transferase | PG1136 | hypothetical protein | -><- | 1216615 | 1216788 | 174 | 42% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 413 | PG1138 | pigmentation and extracellular proteinase regulator | PG1139 | hypothetical protein | <-<- | 1220839 | 1221017 | 179 | 40.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 414 | PG1139 | hypothetical protein | PG1140 | glycosyl transferase, group 2 family protein | <-<- | 1222155 | 1222264 | 110 | 31.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 415 | PG1141 | glycosyl transferase, group 1 family protein | PG1142 | exopolysaccharide synthesis-related protein | <-<- | 1224325 | 1224660 | 336 | 37.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 416 | PG1142 | exopolysaccharide synthesis-related protein | PG1143 | sugar dehydrogenase, UDP-glucose/GDP-mannose dehydrogenase family | <-<- | 1225570 | 1225719 | 150 | 36% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 417 | PG1143 | sugar dehydrogenase, UDP-glucose/GDP-mannose dehydrogenase family | PG1145 | long-chain-fatty-acid--CoA ligase, putative | <-<- | 1227289 | 1228571 | 1283 | 50.7% | 0 | 2 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 418 | PG1145 | long-chain-fatty-acid--CoA ligase, putative | PG1148 | hypothetical protein | <--> | 1230396 | 1231343 | 948 | 36.6% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 8 | 0 | 0 | 0 | Result | |
| 419 | PG1148 | hypothetical protein | PG1149 | glycosyl transferase, group 1 family protein | ->-> | 1231437 | 1231781 | 345 | 34.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 420 | PG1149 | glycosyl transferase, group 1 family protein | PG1150 | hypothetical protein | ->-> | 1232910 | 1233045 | 136 | 34.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 421 | PG1151 | alcohol dehydrogenase, iron-containing | PG1152 | hypothetical protein | -><- | 1234439 | 1234763 | 325 | 40.9% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 422 | PG1156 | S4 domain protein | PG1159 | cobalamin biosynthesis protein CbiB | -><- | 1237328 | 1238046 | 719 | 46.9% | 0 | 0 | 0 | +: 0/12/0 | -: 0/1/0 | 14 | 0 | 0 | 0 | Result | |
| 424 | PG1163 | cobyrinic acid a,c-diamide synthase | PG1164 | hypothetical protein | <-<- | 1243472 | 1244196 | 725 | 44.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 425 | PG1167 | hypothetical protein | PG1169 | hypothetical protein | -><- | 1248705 | 1249172 | 468 | 40% | 0 | 0 | 0 | +: 0/4/0 | -: 0/4/0 | 2 | 0 | 0 | 0 | Result | |
| 426 | PG1170 | SerB family protein | PG1171 | oxidoreductase, putative | ->-> | 1250176 | 1250494 | 319 | 42.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 427 | PG1173 | YkgG family protein | PG1174 | thioesterase family protein | -><- | 1253190 | 1253299 | 110 | 50.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 428 | PG1174 | thioesterase family protein | PG1175 | ABC transporter, ATP-binding protein, putative | <-<- | 1253798 | 1254259 | 462 | 40.5% | 0 | 0 | 2 | +: 0/5/0 | -: 0/5/0 | 5 | 0 | 0 | 0 | Result | |
| 431 | PG1181 | transcriptional regulator, tetR family | PG1184 | alginate O-acetyltransferase, putative | <-<- | 1264346 | 1265424 | 1079 | 45.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/9/0 | 14 | 0 | 0 | 0 | Result | |
| 432 | PG1186 | hypothetical protein | PG1189 | hypothetical protein | <--> | 1269242 | 1270131 | 890 | 40.9% | 1 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 6 | 0 | 0 | 0 | Result | |
| 433 | PG1189 | hypothetical protein | PG1190 | glycerate dehydrogenase | ->-> | 1272013 | 1272251 | 239 | 41.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 434 | PG1190 | glycerate dehydrogenase | PG1195 | 8-amino-7-oxononanoate synthase | ->-> | 1273206 | 1274118 | 913 | 47.8% | 0 | 0 | 0 | +: 0/4/0 | -: 0/2/0 | 8 | 0 | 0 | 0 | Result | |
| 437 | PG1199 | hypothetical protein | PG1200 | hypothetical protein | -><- | 1277459 | 1277569 | 111 | 29.7% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 438 | PG1200 | hypothetical protein | PG1202 | hypothetical protein | <-<- | 1278083 | 1279681 | 1599 | 41.8% | 0 | 0 | 123 | +: 0/0/0 | -: 1/1/1 | 1 | 0 | 0 | 0 | Result | |
| 439 | PG1202 | hypothetical protein | PG1203 | transcriptional regulator, putative | <-<- | 1283105 | 1283326 | 222 | 27.9% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 440 | PG1203 | transcriptional regulator, putative | PG1205 | DNA-binding protein, histone-like family | <--> | 1283537 | 1284092 | 556 | 36.7% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 1 | 22 | 130 | Result | tgttcttttgatagcgcaaagatatgaaatgaaatagcatagaaaaagggaatgaggtttattttccattcccttaaatcgtcttaattggtgcaggaaagaaacttta |
| 441 | PG1208 | molecular chaperone DnaK | PG1209 | hypothetical protein | <--> | 1287006 | 1287584 | 579 | 38.9% | 0 | 0 | 1 | +: 0/2/0 | -: 2/2/2 | 1 | 0 | 0 | 0 | Result | |
| 442 | PG1214 | hypothetical protein | PG1215 | lipoprotein protein, putative | ->-> | 1294411 | 1294760 | 350 | 38.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 2 | 0 | 0 | 0 | Result | |
| 443 | PG1218 | hypothetical protein | PG1219 | hypothetical protein | ->-> | 1296536 | 1296810 | 275 | 42.9% | 0 | 0 | 0 | +: 0/3/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 444 | PG1221 | oxidoreductase, short chain dehydrogenase/reductase family | PG1222 | hypothetical protein | -><- | 1298995 | 1299164 | 170 | 37.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 445 | PG1222 | hypothetical protein | PG1223 | hypothetical protein | <--> | 1299483 | 1299600 | 118 | 28% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 446 | PG1223 | hypothetical protein | PG1225 | ABC transporter, ATP-binding protein | ->-> | 1299805 | 1301524 | 1720 | 52.5% | 0 | 1 | 0 | +: 0/0/0 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
| 447 | PG1226 | peptidyl-prolyl cis-trans isomerase, cyclophilin-type | PG1229 | hypothetical protein | -><- | 1304109 | 1305648 | 1540 | 48.3% | 1 | 0 | 0 | +: 0/3/0 | -: 0/4/0 | 1 | 0 | 0 | 0 | Result | |
| 448 | PG1229 | hypothetical protein | PG1230 | hypothetical protein | <-<- | 1305943 | 1306049 | 107 | 43.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 449 | PG1230 | hypothetical protein | PG1232 | glutamate dehydrogenase | <-<- | 1308159 | 1308363 | 205 | 39% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 450 | PG1232 | glutamate dehydrogenase | PG1233 | hypothetical protein | <--> | 1309702 | 1310024 | 323 | 36.8% | 0 | 14 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 451 | PG1233 | hypothetical protein | PG1234 | hypothetical protein | ->-> | 1310136 | 1310251 | 116 | 35.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 452 | PG1235 | epimerase/reductase, putative | PG1236 | hypothetical protein | <--> | 1311347 | 1311661 | 315 | 36.2% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 459 | PG1251 | hypothetical protein | PG1252 | hypothetical protein | -><- | 1328273 | 1328438 | 166 | 43.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 460 | PG1256 | ribonuclease, Rne/Rng family | PG1257 | hypothetical protein | <-<- | 1334353 | 1334550 | 198 | 42.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 461 | PG1258 | DNA-binding protein HU | PG1259 | anaerobic ribonucleoside-triphosphate reductase activating protein | <-<- | 1334953 | 1335063 | 111 | 30.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 467 | PG1264 | hypothetical protein | PG1265 | hypothetical protein | <-<- | 1344986 | 1345113 | 128 | 49.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 4 | 0 | 0 | 0 | Result | |
| 470 | PG1271 | acetylornithine aminotransferase, putative | PG1273 | hypothetical protein | <-<- | 1351534 | 1351771 | 238 | 38.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 471 | PG1274 | elongation factor P | PG1276 | DNA-binding protein, histone-like family | ->-> | 1352550 | 1353084 | 535 | 37.2% | 0 | 0 | 0 | +: 0/2/0 | -: 1/3/0 | 2 | 0 | 0 | 0 | Result | |
| 472 | PG1276 | DNA-binding protein, histone-like family | PG1277 | UDP-glucose-6 dehydrogenase, putative | ->-> | 1353592 | 1353893 | 302 | 38.4% | 0 | 0 | 0 | +: 0/3/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 473 | PG1277 | UDP-glucose-6 dehydrogenase, putative | PG1278 | phosphoserine aminotransferase | ->-> | 1355160 | 1355491 | 332 | 38.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 474 | PG1278 | phosphoserine aminotransferase | PG1279 | D-isomer specific 2-hydroxyacid dehydrogenase family protein | ->-> | 1356575 | 1356674 | 100 | 34% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 475 | PG1280 | hypothetical protein | PG1281 | hypothetical protein | ->-> | 1358862 | 1358987 | 126 | 38.1% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 476 | PG1283 | hypothetical protein | PG1285 | glucosamine-6-phosphate deaminase | ->-> | 1362856 | 1363033 | 178 | 49.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 477 | PG1285 | glucosamine-6-phosphate deaminase | PG1286 | ferritin | -><- | 1365002 | 1365108 | 107 | 49.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 478 | PG1286 | ferritin | PG1288 | GDP-mannose 4,6-dehydratase | <--> | 1365592 | 1366102 | 511 | 45.2% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 479 | PG1289 | GDP-fucose synthetase | PG1290 | branched-chain amino acid aminotransferase | ->-> | 1368255 | 1368392 | 138 | 31.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 480 | PG1290 | branched-chain amino acid aminotransferase | PG1291 | hypothetical protein | -><- | 1369413 | 1369540 | 128 | 41.4% | 0 | 0 | 0 | +: 0/2/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 481 | PG1291 | hypothetical protein | PG1294 | ferrous iron transport protein B | <--> | 1371269 | 1372186 | 918 | 44.3% | 0 | 0 | 0 | +: 0/13/0 | -: 0/0/0 | 13 | 0 | 0 | 0 | Result | |
| 482 | PG1294 | ferrous iron transport protein B | PG1296 | hypothetical protein | ->-> | 1374722 | 1374933 | 212 | 44.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 483 | PG1296 | hypothetical protein | PG1297 | ribosomal protein S1 | ->-> | 1375390 | 1375970 | 581 | 43.4% | 0 | 0 | 0 | +: 0/2/0 | -: 0/3/0 | 2 | 0 | 0 | 0 | Result | |
| 484 | PG1297 | ribosomal protein S1 | PG1300 | hypothetical protein | -><- | 1377771 | 1378619 | 849 | 50.1% | 0 | 0 | 0 | +: 0/3/0 | -: 0/4/0 | 7 | 0 | 0 | 0 | Result | |
| 485 | PG1304 | hypothetical protein | PG1305 | glycine dehydrogenase | <-<- | 1383565 | 1383760 | 196 | 33.2% | 0 | 0 | 0 | +: 0/3/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 486 | PG1308 | hypothetical protein | PG1310 | exsB protein | <--> | 1388819 | 1389223 | 405 | 40% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 487 | PG1312 | capA protein, putative | PG1313 | dipeptidase-related protein | ->-> | 1391614 | 1392421 | 808 | 38% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 15 | 0 | 0 | 0 | Result | |
| 489 | PG1314 | chorismate synthase | PG1315 | peptidyl-prolyl cis-trans isomerase SlyD, FKBP-type | <-<- | 1395559 | 1395707 | 149 | 38.3% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 492 | PG1321 | formate--tetrahydrofolate ligase | PG1323 | PhoH family protein | <--> | 1401414 | 1401569 | 156 | 28.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 493 | PG1325 | hypothetical protein | PG1326 | hemagglutinin, putative | <--> | 1403969 | 1404172 | 204 | 30.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 494 | PG1326 | hemagglutinin, putative | PG1327 | aminotransferase, putative | -><- | 1405232 | 1405359 | 128 | 43% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 495 | PG1328 | CoA ligase family protein | PG1330 | large conductance mechanosensitive channel protein | <--> | 1408771 | 1409805 | 1035 | 42.6% | 0 | 18 | 1 | +: 0/0/0 | -: 0/4/0 | 1 | 0 | 0 | 0 | Result | |
| 496 | PG1330 | large conductance mechanosensitive channel protein | PG1332 | NAD(P) transhydrogenase, beta subunit | ->-> | 1410226 | 1412181 | 1956 | 49.9% | 0 | 1 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 497 | PG1332 | NAD(P) transhydrogenase, beta subunit | PG1333 | hypothetical protein | -><- | 1414171 | 1414315 | 145 | 43.4% | 0 | 0 | 0 | +: 0/3/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
| 498 | PG1335 | hypothetical protein | PG1337 | umuD protein | <--> | 1416985 | 1417952 | 968 | 42.3% | 0 | 0 | 0 | +: 0/4/0 | -: 0/2/0 | 5 | 0 | 0 | 0 | Result | |
| 499 | PG1338 | umuC protein | PG1340 | L-lactate permease | -><- | 1419685 | 1420387 | 703 | 44.8% | 0 | 0 | 0 | +: 0/3/0 | -: 0/0/0 | 17 | 0 | 0 | 0 | Result | |
| 500 | PG1340 | L-lactate permease | PG1341 | hypothetical protein | <--> | 1421939 | 1422170 | 232 | 37.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 501 | PG1343 | lipoate-protein ligase B | PG1345 | glycosyl transferase, group 1 family protein | ->-> | 1425247 | 1425729 | 483 | 41.4% | 0 | 0 | 1 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 502 | PG1346 | glycosyl transferase, group 1 family protein | PG1347 | hypothetical protein | ->-> | 1428120 | 1428255 | 136 | 37.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 505 | PG1353 | orotate phosphoribosyltransferase | PG1354 | hydrolase, carbon-nitrogen family | <-<- | 1433924 | 1434033 | 110 | 35.5% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 506 | PG1356 | hypothetical protein | PG1357 | hypothetical protein | <-<- | 1435940 | 1436416 | 477 | 37.1% | 0 | 0 | 0 | +: 0/3/0 | -: 0/3/0 | 7 | 0 | 0 | 0 | Result | |
| 507 | PG1357 | hypothetical protein | PG1358 | acetyltransferase, GNAT family | <-<- | 1436549 | 1436742 | 194 | 37.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 508 | PG1358 | acetyltransferase, GNAT family | PG1359 | hypothetical protein | <-<- | 1437424 | 1437733 | 310 | 37.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 509 | PG1362 | hypothetical protein | PG1363 | hypothetical protein | <--> | 1443685 | 1443943 | 259 | 42.9% | 0 | 0 | 1 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 510 | PG1363 | hypothetical protein | PG1364 | 1-deoxy-D-xylulose 5-phosphate reductoisomerase | -><- | 1444220 | 1444477 | 258 | 37.6% | 0 | 0 | 1 | +: 0/0/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
| 511 | PG1370 | lysyl-tRNA synthetase | PG1371 | phosphorylase family protein | <-<- | 1452320 | 1452441 | 122 | 45.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 512 | PG1373 | hypothetical protein | PG1374 | immunoreactive 47 kDa antigen PG97 | -><- | 1455166 | 1455343 | 178 | 39.9% | 0 | 0 | 0 | +: 0/3/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
| 513 | PG1375 | hypothetical protein | PG1378 | A/G-specific adenine glycosylase | -><- | 1456804 | 1457804 | 1001 | 34.7% | 0 | 0 | 0 | +: 0/6/0 | -: 2/6/5 | 11 | 0 | 0 | 0 | Result | |
| 514 | PG1382 | hypothetical protein | PG1383 | amino acid exporter, putative | ->-> | 1462611 | 1462808 | 198 | 42.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 515 | PG1383 | amino acid exporter, putative | PG1385 | TPR domain protein | -><- | 1463448 | 1465222 | 1775 | 46.4% | 1 | 0 | 0 | +: 1/3/0 | -: 0/7/0 | 1 | 0 | 0 | 0 | Result | |
| 516 | PG1386 | DNA gyrase, A subunit | PG1387 | hypothetical protein | <-<- | 1469039 | 1469221 | 183 | 41% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 517 | PG1389 | DNA-binding protein, histone-like family | PG1391 | hypothetical protein | <--> | 1471419 | 1471809 | 391 | 39.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 13 | 0 | 0 | 0 | Result | |
| 518 | PG1396 | cell shape-determining protein MreB | PG1397 | bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase | <-<- | 1478817 | 1478918 | 102 | 45.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 519 | PG1397 | bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase | PG1398 | hypothetical protein | <--> | 1480446 | 1480833 | 388 | 44.8% | 0 | 0 | 1 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 520 | PG1398 | hypothetical protein | PG1401 | beta-eliminating lyase | -><- | 1481008 | 1483488 | 2481 | 46.6% | 1 | 42 | 1 | +: 0/5/0 | -: 2/10/15 | 7 | 0 | 0 | 0 | Result | |
| 521 | PG1401 | beta-eliminating lyase | PG1402 | AP endonuclease domain protein | <-<- | 1484869 | 1485120 | 252 | 38.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 522 | PG1402 | AP endonuclease domain protein | PG1403 | rhomboid family protein | <-<- | 1486054 | 1486262 | 209 | 45.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 523 | PG1405 | hypothetical protein | PG1407 | nitroimidazole resistance protein, putative | <-<- | 1490760 | 1491201 | 442 | 42.5% | 0 | 0 | 4 | +: 0/0/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
| 524 | PG1407 | nitroimidazole resistance protein, putative | PG1408 | heavy metal efflux pump, CzcD family | <--> | 1491739 | 1492000 | 262 | 38.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 525 | PG1411 | potassium uptake protein TrkA, putative | PG1414 | hypothetical protein | <--> | 1495257 | 1497148 | 1892 | 42.1% | 0 | 0 | 0 | +: 0/7/0 | -: 1/4/0 | 19 | 0 | 0 | 0 | Result | |
| 526 | PG1414 | hypothetical protein | PG1416 | enoyl-(acyl-carrier-protein) reductase II | ->-> | 1499765 | 1500196 | 432 | 38.4% | 0 | 0 | 0 | +: 1/3/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 527 | PG1416 | enoyl-(acyl-carrier-protein) reductase II | PG1417 | fumarate hydratase class I, anaerobic | ->-> | 1501139 | 1501434 | 296 | 46.3% | 0 | 0 | 2 | +: 0/3/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 528 | PG1417 | fumarate hydratase class I, anaerobic | PG1418 | DNA polymerase III, gamma and tau subunits | ->-> | 1503082 | 1503203 | 122 | 45.9% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 531 | PG1421 | ferredoxin, 4Fe-4S | PG1422 | D-alanyl-D-alanine carboxypeptidase | <-<- | 1507135 | 1507469 | 335 | 34.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 532 | PG1424 | peptidylarginine deiminase | PG1426 | hypothetical protein | <-<- | 1510898 | 1511241 | 344 | 36.6% | 0 | 0 | 0 | +: 1/1/1 | -: 0/0/0 | 3 | 0 | 0 | 0 | Result | |
| 533 | PG1426 | hypothetical protein | PG1427 | thiol protease/hemagglutinin PrtT precursor, putative | <-<- | 1511401 | 1511954 | 554 | 41.7% | 0 | 0 | 0 | +: 0/5/0 | -: 0/2/0 | 19 | 0 | 0 | 0 | Result | |
| 534 | PG1427 | thiol protease/hemagglutinin PrtT precursor, putative | PG1428 | riboflavin synthase subunit beta | <-<- | 1514487 | 1514626 | 140 | 39.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 535 | PG1430 | TPR domain protein | PG1431 | DNA-binding response regulator, LuxR family | <-<- | 1515891 | 1516075 | 185 | 38.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 536 | PG1432 | sensor histidine kinase | PG1433 | hydrolase | <--> | 1518690 | 1518970 | 281 | 38.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 539 | PG1435 | integrase | PG1436 | ATPase, putative | ->-> | 1521670 | 1521795 | 126 | 24.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 540 | PG1436 | ATPase, putative | PG1439 | hypothetical protein | -><- | 1523815 | 1524674 | 860 | 42.9% | 0 | 0 | 0 | +: 1/3/0 | -: 0/7/0 | 3 | 3 | 1 | 860 | Result | tataggtgtgtaagtagaactgtttcagactacaataaaagtagtttaacacaattctgtttacattctattcctcacattctattatatgttttcgcatcgaatcattcgtatcgttttcttcggcaaaggtagtttcgttgtactgcgggcaacaaggtcaagcgacaagccgttagggcaacaatctccacacttcattcttcaggtagtattcttgccctaaaccttgttgtcctagccacctaacctttttattgcctcgaaacgaaaacgaccgacccgacggaaagacgcataaaaaaaggtcggatatgcgagaagcaggtaaaaagaaaatggaaactcaactccctctcctctggaatccgcataaaatcaaaaaaaaatcagacaagatgaaacagagatacaaaatatcaatttgggtggcacttgcactctcaggctctctcctttggggcggaagcgtctggctttagctggcagggatatgtgtggaaaatttcctcattcggctgctccttaccatcgctttggctatcgcagtgtacattctgacttatgccctcgttatggttgcactttatgcccctatttcatgtataaagaatgaacccaattggaacgtaaattgggctttctccactcaccccgaagtaaggacgggacggataactgttcaagataaacagacggagtaaagcggtcggcggatttgccgaccgctcctctctttcgtgagcatcgggcggacaaagaaaggagcaaagaaaccccaatgaaaaacacttcgttacttttgacagtgagttgagacagctcaaaagtaacaaaaagccaaaattagagatataaaa |
| 541 | PG1442 | hypothetical protein | PG1444 | hypothetical protein | <--> | 1528121 | 1528885 | 765 | 39.9% | 0 | 0 | 0 | +: 1/1/0 | -: 0/1/0 | 2 | 3 | 1 | 765 | Result | acttacttaattttattgttatacaattcactgttcatttctttgccggtatatttacctgcaaagatgaatacatccactatctaagatatgcccgataatggggttgtaccagcagggctacatcctttcgttcataccctttttgtggagatgttcattgatgtccatcaatacaatcgttcgattgtatctgctttcacacatttccacgttcaagtgaaagaatcaaggacgtgttcttcgatataccccctcgcttatatcgctcatcgaatcgtgatatcatcgaagacacattcctccaccgacatattcgacggtgcaaatatatggctcggtgatgctgtaatcagcgtgatttactttagtgcgtacttgtggcttcgatttggatagttgtggcttcgtatgaggtaagggatttaggcacaacgcttagtaactttgcagtaagcgataagtcggtatttcatggctttgaaaacatacatttcgagagaataacatatcgttcttcggaacgaatttatttgcgtcagtgcaaatagcaaggtatgtcttgcgttacccgaaattatttcggtaactcaaaacccttgctcctgcagagggcagaacacctccgaagtcggtgttcttggatagaagttttcgttgtcttgattggctattttatcgtgaacgctctctaatggatttcaattatgtttagcacgttctatttccagaagagagaattacaaaccattaaaatccaaagta |
| 542 | PG1444 | hypothetical protein | PG1446 | MATE efflux family protein | -><- | 1529303 | 1529997 | 695 | 40.9% | 0 | 0 | 11 | +: 0/2/0 | -: 0/1/0 | 2 | 2 | 456 | 695 | Result | tacattttttcccctctccgtccattgaatctcccctttgcaaaggttgcaggcaaaagcgtgtataacggagggtccgaaacaatgagactaaatctctttctgcatcacatagggcaataatcttcagaataaagttgtctgacgctttttgtatctgtccttttgtagagcataaagagattattgtcttaaagtcttcagtttgagtaagtcttagcataatcatatcttttatgt |
| 543 | PG1446 | MATE efflux family protein | PG1447 | transcriptional regulator, AraC family | <-<- | 1531318 | 1531452 | 135 | 37% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 1 | 1 | 135 | Result | catacttccttcttgcaaaatattcacagcgttgttcatccttataatctgtatcttcttaagtaaataaattctgctgcaaaggtacagggggatacaggtcgtcacaatagacaaacaacggtgataatagca |
| 546 | PG1450 | hypothetical protein | PG1451 | hypothetical protein | <--> | 1534705 | 1534836 | 132 | 25.8% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 2 | 2 | 1 | 132 | Result | agcgaacttttttcttgttgatattcagtaaaactaacaatatagtgtgtatcatacatttttgtatgtacttgtgtattgtagtgcaaaggtataattttgcagtgatttcaacaatttaaaatacatttt |
| 547 | PG1451 | hypothetical protein | PG1452 | lipoprotein, putative | -><- | 1535245 | 1535369 | 125 | 33.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 2 | 1 | 1 | 125 | Result | tgaaagagaatccttttgagattgccattatacgctgaaaaaagagaatatgaagtaggtagtggcaataaatccattagaaaaagcagacagtagaaattacttttcttactgcctgcttttct |
| 548 | PG1454 | integrase | PG1457 | hypothetical protein | <--> | 1538197 | 1538789 | 593 | 39% | 0 | 35 | 0 | +: 0/0/0 | -: 0/0/0 | 2 | 1 | 1 | 119 | Result | acgctttaactttatgggcaaaattacccgttatcaaagcgttctctgatacgcaaaatattgataaacagataaaaagaaaccgtatgagaaaaattcttccaataatcattacctca |
| 549 | PG1459 | hypothetical protein | PG1460 | hypothetical protein | <--> | 1539860 | 1540099 | 240 | 50% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 550 | PG1463 | hypothetical protein | PG1465 | hypothetical protein | ->-> | 1541532 | 1542121 | 590 | 43.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 2 | 102 | 590 | Result | tttcgggagtatcttttccgtctccaaatctttcatctgttgtcttcgatcccggactgccgataatgcaatgtatcacagtccgtattgaaggctgacgatgtgcaaaaagacctcggcagaaagtcaggtcgtccttacacgaatgttaggtcgaccttacgggccgtttaggtcgtccttacagaccgtttacgtcgaccttacagaccgtttaggtcgacctaactgaacgattaggtcgacctaaaacaaacaacaggtcgtcccgacacatcaaaatcccttcgtgcgatgggtcgcaatccggcagagagccaatgccaaacagattattaaaggttgaattttgaggatatgagttactgattgacgaatcgacaaaccctaagaaatagggattccgggctgtgaaaatagccactattggcgattgcaaacgatattctacttgtatatttttgcgaactcaaataataagaaaaaggt |
| 551 | PG1467 | methlytransferase, UbiE/COQ5 family | PG1469 | type I restriction-modification system, M subunit, putative | -><- | 1543962 | 1545079 | 1118 | 35.5% | 0 | 0 | 1 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 552 | PG1469 | type I restriction-modification system, M subunit, putative | PG1470 | hypothetical protein | <--> | 1548089 | 1548260 | 172 | 33.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 553 | PG1470 | hypothetical protein | PG1471 | hypothetical protein | ->-> | 1548492 | 1548670 | 179 | 38% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 554 | PG1483 | conjugative transposon protein TraE | PG1484 | hypothetical protein | <-<- | 1559176 | 1559364 | 189 | 46% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 555 | PG1486 | conjugative transposon protein TraA | PG1487 | hypothetical protein | <--> | 1561257 | 1561607 | 351 | 43.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 556 | PG1490 | TraG family protein | PG1491 | hypothetical protein | ->-> | 1565565 | 1565880 | 316 | 38.9% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 557 | PG1493 | hypothetical protein | PG1494 | hypothetical protein | ->-> | 1569599 | 1569980 | 382 | 45.3% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 558 | PG1496 | hypothetical protein | PG1497 | DNA-binding protein, histone-like family | ->-> | 1573758 | 1574224 | 467 | 48.4% | 0 | 0 | 0 | +: 0/2/0 | -: 0/4/0 | 3 | 2 | 117 | 272 | Result | gcacactacgagggaataaaccgcatacgtcgaccctgacagaaagtcaggtcgacataaccggccgtttaggtcgaccttacggagcaaataggtcgtccttacagagcgtttaggtcgacctaaaacggacggaaggtcgacctaaccggagcg |
| 559 | PG1497 | DNA-binding protein, histone-like family | PG1498 | hypothetical protein | ->-> | 1574696 | 1574795 | 100 | 35% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 560 | PG1501 | transcriptional regulator, tetR family | PG1503 | LytB-related protein | <--> | 1579190 | 1580364 | 1175 | 32.8% | 0 | 0 | 3 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 561 | PG1505 | radical SAM domain protein | PG1507 | hypothetical protein | ->-> | 1583262 | 1583759 | 498 | 29.9% | 0 | 0 | 0 | +: 1/1/1 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 562 | PG1510 | hypothetical protein | PG1511 | hypothetical protein | <--> | 1587627 | 1587748 | 122 | 40.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
| 563 | PG1516 | hypothetical protein | PG1519 | hypothetical protein | ->-> | 1593258 | 1595844 | 2587 | 39.7% | 0 | 250 | 0 | +: 0/4/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 564 | PG1519 | hypothetical protein | PG1521 | O-succinylbenzoic acid--CoA ligase | -><- | 1597486 | 1598143 | 658 | 39.5% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 3 | 1 | 535 | 646 | Result | ttttgccggggacgacgtatcgttccggttaggacgaccctccgtctgttttaggtcgacctgactttctgtcagggtcggcgtgtgtggtttattgtctcgtaatgtgcag |
| 565 | PG1526 | hypothetical protein | PG1527 | hypothetical protein | <-<- | 1605462 | 1605656 | 195 | 24.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 1 | 1 | 195 | Result | gtgcctatttatatcggcaaatatactccaaataaatgaaaatattttttgcgataggatttattataatataaattccgatttgtcaatccgataatctttatttcgatagatatatatctataattttcttatttgtgtacgataatccaaataaacaaagatgtgcttttaaccgttttgtttctatttcat |
| 566 | PG1528 | hypothetical protein | PG1529 | hypothetical protein | ->-> | 1607249 | 1607374 | 126 | 24.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 568 | PG1535 | transcriptional regulator, putative | PG1536 | cell division protein FtsX, putative | <--> | 1614582 | 1616501 | 1920 | 38.4% | 0 | 0 | 0 | +: 2/3/0 | -: 0/7/0 | 3 | 0 | 0 | 0 | Result | |
| 569 | PG1537 | hypothetical protein | PG1538 | undecaprenol kinase, putative | ->-> | 1617664 | 1617770 | 107 | 54.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 570 | PG1538 | undecaprenol kinase, putative | PG1540 | S-adenosylmethionine:tRNA ribosyltransferase-isomerase | ->-> | 1618614 | 1619416 | 803 | 50.9% | 0 | 1 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 571 | PG1544 | hypothetical protein | PG1545 | superoxide dismutase, Fe-Mn | ->-> | 1623503 | 1623639 | 137 | 31.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 573 | PG1549 | hypothetical protein | PG1551 | hmuY protein | <--> | 1628038 | 1628577 | 540 | 38.5% | 0 | 0 | 1 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 574 | PG1556 | hypothetical protein | PG1559 | aminomethyltransferase | -><- | 1637062 | 1637993 | 932 | 42.6% | 0 | 0 | 2 | +: 0/2/0 | -: 0/2/0 | 13 | 0 | 0 | 0 | Result | |
| 575 | PG1563 | glucose-1-phosphate thymidylyltransferase | PG1564 | hypothetical protein | <-<- | 1642557 | 1642670 | 114 | 32.5% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 576 | PG1566 | glutamyl-tRNA synthetase | PG1570 | rhodanese-like domain protein | <-<- | 1647492 | 1648671 | 1180 | 39.7% | 1 | 0 | 0 | +: 0/0/0 | -: 0/3/0 | 6 | 0 | 0 | 0 | Result | |
| 577 | PG1573 | transcriptional regulator, Crp family | PG1574 | hypothetical protein | <-<- | 1652259 | 1652550 | 292 | 43.2% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 2 | 0 | 0 | 0 | Result | |
| 578 | PG1574 | hypothetical protein | PG1576 | L-aspartate oxidase | <--> | 1652704 | 1653155 | 452 | 36.3% | 0 | 0 | 0 | +: 0/1/0 | -: 1/1/0 | 8 | 0 | 0 | 0 | Result | |
| 579 | PG1578 | quinolinate synthetase | PG1579 | ATPase, MoxR family | ->-> | 1656533 | 1656632 | 100 | 35% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 580 | PG1584 | batC protein | PG1585 | batD protein | ->-> | 1662215 | 1662394 | 180 | 39.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 581 | PG1589 | dihydropteroate synthase | PG1591 | hypothetical protein | <--> | 1667529 | 1668056 | 528 | 38.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 583 | PG1595 | ribulose-phosphate 3-epimerase | PG1596 | isoleucyl-tRNA synthetase, putative | <--> | 1674341 | 1674682 | 342 | 38% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 584 | PG1604 | immunoreactive 84 kDa antigen PG93 | PG1605 | aminopeptidase C | ->-> | 1685208 | 1685318 | 111 | 40.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 585 | PG1605 | aminopeptidase C | PG1606 | ion transporter | -><- | 1686663 | 1686992 | 330 | 39.7% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 586 | PG1606 | ion transporter | PG1608 | methylmalonyl-CoA decarboxylase, beta subunit | <-<- | 1687716 | 1688774 | 1059 | 39.8% | 0 | 0 | 0 | +: 1/8/4 | -: 0/4/0 | 2 | 0 | 0 | 0 | Result | |
| 587 | PG1613 | glyoxalase family protein | PG1614 | succinate dehydrogenase | <-<- | 1693659 | 1693889 | 231 | 38.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 588 | PG1617 | hypothetical protein | PG1618 | hypothetical protein | <--> | 1697846 | 1698042 | 197 | 49.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 591 | PG1625 | hypothetical protein | PG1626 | hypothetical protein | ->-> | 1708779 | 1708881 | 103 | 41.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 592 | PG1626 | hypothetical protein | PG1630 | hypothetical protein | ->-> | 1710547 | 1711911 | 1365 | 46.3% | 2 | 0 | 1 | +: 0/3/0 | -: 0/10/0 | 15 | 0 | 0 | 0 | Result | |
| 593 | PG1630 | hypothetical protein | PG1632 | aldose 1-epimerase | ->-> | 1712203 | 1712407 | 205 | 46.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 594 | PG1633 | galactokinase | PG1634 | hypothetical protein | -><- | 1714680 | 1714812 | 133 | 51.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 595 | PG1636 | FtsK/SpoIIIE family protein | PG1638 | thioredoxin family protein | <-<- | 1718551 | 1718753 | 203 | 47.8% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 596 | PG1638 | thioredoxin family protein | PG1639 | hypothetical protein | <-<- | 1719741 | 1719865 | 125 | 48% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 599 | PG1649 | hypothetical protein | PG1651 | TPR domain protein | <--> | 1730243 | 1730465 | 223 | 41.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 600 | PG1655 | hypothetical protein | PG1656 | methylmalonyl-CoA mutase, small subunit | ->-> | 1737445 | 1737598 | 154 | 33.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 603 | PG1660 | RNA polymerase sigma-70 factor, ECF subfamily | PG1661 | hypothetical protein | <--> | 1744359 | 1744607 | 249 | 41.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 607 | PG1669 | hypothetical protein | PG1670 | hypothetical protein | <-<- | 1755657 | 1755784 | 128 | 49.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 4 | 0 | 0 | 0 | Result | |
| 611 | PG1675 | hypothetical protein | PG1676 | phosphoenolpyruvate carboxykinase | -><- | 1760421 | 1760578 | 158 | 55.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 612 | PG1676 | phosphoenolpyruvate carboxykinase | PG1677 | phosphoglycerate kinase | <--> | 1762187 | 1762481 | 295 | 45.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 613 | PG1677 | phosphoglycerate kinase | PG1678 | hypothetical protein | -><- | 1763739 | 1763844 | 106 | 43.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 614 | PG1679 | hypothetical protein | PG1681 | glycogen debranching enzyme, archaeal type, putative | ->-> | 1765331 | 1766551 | 1221 | 48.2% | 0 | 64 | 0 | +: 0/6/0 | -: 1/2/2 | 1 | 0 | 0 | 0 | Result | |
| 615 | PG1684 | hypothetical protein | PG1685 | hypothetical protein | -><- | 1771544 | 1772305 | 762 | 44.2% | 0 | 0 | 1 | +: 0/4/0 | -: 0/2/0 | 14 | 0 | 0 | 0 | Result | |
| 616 | PG1685 | hypothetical protein | PG1687 | HIT family protein | <-<- | 1773089 | 1773901 | 813 | 40.8% | 0 | 0 | 17 | +: 0/2/0 | -: 0/4/0 | 1 | 0 | 0 | 0 | Result | |
| 617 | PG1688 | transcription elongation factor GreA | PG1690 | Sua5/YciO/YrdC/YwlC family protein | <-<- | 1774777 | 1775260 | 484 | 43.4% | 0 | 0 | 0 | +: 0/1/0 | -: 1/3/0 | 2 | 0 | 0 | 0 | Result | |
| 618 | PG1694 | hypothetical protein | PG1695 | hypothetical protein | <--> | 1779101 | 1779579 | 479 | 37.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 6 | 0 | 0 | 0 | Result | |
| 619 | PG1695 | hypothetical protein | PG1696 | type II DNA modification methyltransferase, putative | ->-> | 1779772 | 1780112 | 341 | 42.8% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 620 | PG1697 | type II restriction endonuclease, putative | PG1701 | glutamine amidotransferase, class II/dipeptidase | -><- | 1785135 | 1786234 | 1100 | 45.6% | 0 | 0 | 0 | +: 1/0/0 | -: 1/10/0 | 14 | 0 | 0 | 0 | Result | |
| 621 | PG1704 | thiol:disulfide interchange protein dsbD, putative | PG1706 | hypothetical protein | <-<- | 1792910 | 1793938 | 1029 | 50.6% | 0 | 4 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 624 | PG1714 | pyridoxamine-phosphate oxidase | PG1715 | hypothetical protein | <-<- | 1802583 | 1803482 | 900 | 42.6% | 0 | 0 | 3 | +: 0/0/0 | -: 0/2/0 | 14 | 0 | 0 | 0 | Result | |
| 625 | PG1715 | hypothetical protein | PG1718 | hypothetical protein | <-<- | 1806147 | 1806621 | 475 | 42.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 626 | PG1720 | hypothetical protein | PG1721 | ribonuclease R | ->-> | 1810285 | 1810423 | 139 | 49.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 627 | PG1721 | ribonuclease R | PG1722 | hypothetical protein | -><- | 1812533 | 1812722 | 190 | 51.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 629 | PG1728 | cytidine/deoxycytidylate deaminase family protein | PG1729 | thiol peroxidase | -><- | 1818237 | 1818431 | 195 | 42.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 630 | PG1730 | O-methyltransferase family protein | PG1731 | 3-dehydroquinate dehydratase | <-<- | 1819668 | 1819767 | 100 | 41% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 631 | PG1731 | 3-dehydroquinate dehydratase | PG1732 | integrase/recombinase XerD | <--> | 1820194 | 1820310 | 117 | 45.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 633 | PG1739 | hypothetical protein | PG1741 | aspartate ammonia-lyase | <-<- | 1825800 | 1825945 | 146 | 49.3% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 634 | PG1743 | 2-dehydro-3-deoxyphosphooctonate aldolase | PG1745 | phosphoribulokinase family protein | <-<- | 1828439 | 1829524 | 1086 | 38.6% | 0 | 0 | 0 | +: 0/2/0 | -: 1/5/5 | 1 | 0 | 0 | 0 | Result | |
| 636 | PG1748 | transketolase | PG1750 | alpha-1,3/4-fucosidase, putative | <--> | 1835020 | 1835462 | 443 | 41.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 2 | 0 | 0 | 0 | Result | |
| 637 | PG1750 | alpha-1,3/4-fucosidase, putative | PG1751 | aminotransferase, class V | ->-> | 1837284 | 1837419 | 136 | 46.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 638 | PG1754 | hypothetical protein | PG1755 | fructose-bisphosphate aldolase | -><- | 1842345 | 1842486 | 142 | 50% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 639 | PG1755 | fructose-bisphosphate aldolase | PG1757 | hypothetical protein | <-<- | 1843369 | 1844020 | 652 | 45.6% | 0 | 0 | 2 | +: 0/0/0 | -: 1/3/3 | 1 | 0 | 0 | 0 | Result | |
| 640 | PG1757 | hypothetical protein | PG1758 | ribosomal protein S15 | <--> | 1845053 | 1845324 | 272 | 41.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 641 | PG1758 | ribosomal protein S15 | PG1759 | adhesion protein, putative | ->-> | 1845595 | 1845709 | 115 | 42.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 642 | PG1761 | acetyltransferase, GNAT family | PG1762 | protein-export membrane protein SecD/protein-export membrane protein SecF | ->-> | 1847800 | 1848127 | 328 | 40.2% | 0 | 0 | 0 | +: 0/2/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 643 | PG1762 | protein-export membrane protein SecD/protein-export membrane protein SecF | PG1763 | ribonuclease III | -><- | 1850963 | 1851088 | 126 | 40.5% | 0 | 0 | 0 | +: 0/2/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 644 | PG1765 | acyl carrier protein | PG1766 | phosphoribosylglycinamide formyltransferase | <--> | 1853389 | 1853556 | 168 | 33.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 645 | PG1769 | hypothetical protein | PG1770 | hypothetical protein | ->-> | 1857071 | 1857423 | 353 | 37.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 2 | 0 | 0 | 0 | Result | |
| 646 | PG1774 | transcription-repair coupling factor | PG1775 | grpE protein | <--> | 1864638 | 1864983 | 346 | 39% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 647 | PG1779 | hypothetical protein | PG1780 | 8-amino-7-oxononanoate synthase | ->-> | 1868559 | 1868925 | 367 | 52.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 2 | 0 | 0 | 0 | Result | |
| 649 | PG1786 | hypothetical protein | PG1787 | hypothetical protein | -><- | 1875383 | 1875530 | 148 | 41.9% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 650 | PG1787 | hypothetical protein | PG1788 | cysteine peptidase, putative | <--> | 1875999 | 1876115 | 117 | 47.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 651 | PG1788 | cysteine peptidase, putative | PG1789 | peptidyl-dipeptidase Dcp | -><- | 1877388 | 1877506 | 119 | 44.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 652 | PG1791 | hypothetical protein | PG1792 | sodium/hydrogen antiporter | <--> | 1881257 | 1881761 | 505 | 42.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 2 | 0 | 0 | 0 | Result | |
| 653 | PG1794 | DNA polymerase type I | PG1795 | hypothetical protein | -><- | 1888899 | 1889044 | 146 | 41.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 654 | PG1795 | hypothetical protein | PG1797 | DNA-binding response regulator/sensor histidine kinase | <--> | 1889867 | 1890152 | 286 | 34.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 655 | PG1798 | immunoreactive 46 kDa antigen PG99 | PG1799 | hypothetical protein | <--> | 1894336 | 1894638 | 303 | 38.6% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 656 | PG1799 | hypothetical protein | PG1801 | v-type ATPase, subunit E, putative | ->-> | 1894849 | 1895085 | 237 | 37.1% | 0 | 0 | 0 | +: 1/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 657 | PG1807 | v-type ATPase, subunit K | PG1808 | guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase | -><- | 1902686 | 1903044 | 359 | 44% | 0 | 0 | 0 | +: 0/2/0 | -: 0/5/0 | 1 | 0 | 0 | 0 | Result | |
| 658 | PG1808 | guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase | PG1809 | 2-oxoglutarate oxidoreductase, gamma subunit | <-<- | 1905334 | 1905580 | 247 | 40.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 659 | PG1811 | hypothetical protein | PG1812 | 2-oxoglutarate ferredoxin oxidoreductase | -><- | 1907036 | 1907135 | 100 | 42% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 660 | PG1813 | ferredoxin, 4Fe-4S | PG1814 | DNA primase | <-<- | 1908465 | 1908695 | 231 | 38.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 661 | PG1816 | NAD(P)H dehydrogenase, quinone family, putative | PG1817 | hypothetical protein | <-<- | 1912042 | 1912309 | 268 | 38.4% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 664 | PG1823 | hypothetical protein | PG1824 | phosphopyruvate hydratase | -><- | 1918111 | 1918242 | 132 | 43.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 665 | PG1827 | RNA polymerase sigma-70 factor, ECF subfamily | PG1828 | lipoprotein, putative | -><- | 1920796 | 1921013 | 218 | 43.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 666 | PG1828 | lipoprotein, putative | PG1829 | long-chain-fatty-acid--CoA ligase, putative | <-<- | 1921227 | 1921396 | 170 | 42.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 667 | PG1829 | long-chain-fatty-acid--CoA ligase, putative | PG1831 | ATP-dependent DNA helicase RecQ | <-<- | 1923071 | 1923544 | 474 | 45.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 668 | PG1831 | ATP-dependent DNA helicase RecQ | PG1834 | glycogen synthase-related protein | <--> | 1925513 | 1926294 | 782 | 46.2% | 0 | 0 | 0 | +: 0/5/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 669 | PG1834 | glycogen synthase-related protein | PG1835 | lipoprotein, putative | ->-> | 1927111 | 1927212 | 102 | 44.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 670 | PG1835 | lipoprotein, putative | PG1836 | nucleoside permease NupG | ->-> | 1928581 | 1928682 | 102 | 43.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 671 | PG1836 | nucleoside permease NupG | PG1837 | hemagglutinin protein HagA | ->-> | 1929919 | 1930476 | 558 | 42.5% | 0 | 0 | 1 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 672 | PG1837 | hemagglutinin protein HagA | PG1840 | hypothetical protein | ->-> | 1936795 | 1937241 | 447 | 56.6% | 0 | 0 | 0 | +: 0/3/0 | -: 0/1/0 | 7 | 0 | 0 | 0 | Result | |
| 673 | PG1842 | acetyltransferase, GNAT family | PG1846 | hypothetical protein | ->-> | 1939374 | 1946176 | 6803 | 46.1% | 1 | 0 | 20 | +: 4/9/16 | -: 1/7/5 | 1 | 0 | 0 | 0 | Result | |
| 674 | PG1853 | DNA polymerase III, beta subunit | PG1854 | 5-formyltetrahydrofolate cyclo-ligase family protein | <-<- | 1953210 | 1953414 | 205 | 46.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 675 | PG1857 | hypothetical protein | PG1858 | flavodoxin | <-<- | 1956464 | 1956627 | 164 | 45.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 676 | PG1858 | flavodoxin | PG1859 | glycerate kinase family protein | <-<- | 1957126 | 1957263 | 138 | 39.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 677 | PG1859 | glycerate kinase family protein | PG1860 | hypothetical protein | <-<- | 1958425 | 1958663 | 239 | 38.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 678 | PG1860 | hypothetical protein | PG1861 | hypothetical protein | <-<- | 1959849 | 1959976 | 128 | 31.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 679 | PG1864 | leucine-rich protein | PG1866 | hypothetical protein | <--> | 1964400 | 1964670 | 271 | 39.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 680 | PG1866 | hypothetical protein | PG1868 | hypothetical protein | -><- | 1964797 | 1965187 | 391 | 38.9% | 0 | 0 | 0 | +: 0/7/0 | -: 0/3/0 | 7 | 0 | 0 | 0 | Result | |
| 681 | PG1872 | urocanate hydratase | PG1874 | hypothetical protein | <-<- | 1969002 | 1969342 | 341 | 45.2% | 0 | 0 | 0 | +: 0/1/0 | -: 1/2/2 | 1 | 0 | 0 | 0 | Result | |
| 682 | PG1877 | Na+/H+ antiporter | PG1878 | cysteinyl-tRNA synthetase | <--> | 1972938 | 1973067 | 130 | 30.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 683 | PG1881 | hypothetical protein | PG1884 | alpha-L-fucosidase precursor, putative | -><- | 1978107 | 1979057 | 951 | 50.1% | 0 | 0 | 0 | +: 0/0/0 | -: 1/2/0 | 7 | 0 | 0 | 0 | Result | |
| 684 | PG1885 | polyphosphate kinase | PG1886 | GTP-binding protein HflX | <-<- | 1983243 | 1983405 | 163 | 40.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 685 | PG1888 | hypothetical protein | PG1889 | hypothetical protein | ->-> | 1986351 | 1986490 | 140 | 40.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 686 | PG1889 | hypothetical protein | PG1890 | lipoprotein, putative | ->-> | 1987151 | 1987704 | 554 | 36.8% | 0 | 0 | 0 | +: 0/7/0 | -: 0/4/0 | 1 | 0 | 0 | 0 | Result | |
| 687 | PG1891 | hypothetical protein | PG1892 | hypothetical protein | ->-> | 1988506 | 1989564 | 1059 | 47.3% | 0 | 0 | 143 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 688 | PG1892 | hypothetical protein | PG1893 | hypothetical protein | ->-> | 1989952 | 1991099 | 1148 | 32.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/8/0 | 1 | 0 | 0 | 0 | Result | |
| 689 | PG1893 | hypothetical protein | PG1894 | hypothetical protein | ->-> | 1991874 | 1992416 | 543 | 34.3% | 0 | 0 | 0 | +: 0/2/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 690 | PG1894 | hypothetical protein | PG1895 | hypothetical protein | ->-> | 1992996 | 1993601 | 606 | 37.6% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 691 | PG1895 | hypothetical protein | PG1896 | S-adenosylmethionine synthetase | ->-> | 1994301 | 1994725 | 425 | 40% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 692 | PG1896 | S-adenosylmethionine synthetase | PG1897 | thiamin pyrophosphokinase catalytic domain protein | -><- | 1996016 | 1996142 | 127 | 45.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 693 | PG1903 | hypothetical protein | PG1904 | hypothetical protein | <-<- | 2004312 | 2004521 | 210 | 40% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 696 | PG1908 | hypothetical protein | PG1910 | ribosomal protein L17 | -><- | 2008781 | 2010371 | 1591 | 45.8% | 1 | 0 | 0 | +: 0/5/0 | -: 1/4/1 | 1 | 0 | 0 | 0 | Result | |
| 697 | PG1912 | 30S ribosomal protein S4 | PG1913 | 30S ribosomal protein S11 | <-<- | 2012471 | 2012629 | 159 | 39.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 698 | PG1933 | ribosomal protein L22 | PG1934 | 30S ribosomal protein S19 | <-<- | 2022058 | 2022165 | 108 | 38% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 699 | PG1941 | 30S ribosomal protein S7 | PG1942 | 30S ribosomal protein S12 | <-<- | 2027800 | 2028035 | 236 | 47.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 700 | PG1942 | 30S ribosomal protein S12 | PG1943 | hypothetical protein | <-<- | 2028441 | 2029063 | 623 | 44.6% | 0 | 0 | 3 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 701 | PG1943 | hypothetical protein | PG1944 | 3-phosphoshikimate 1-carboxyvinyltransferase | <--> | 2030351 | 2030555 | 205 | 47.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 702 | PG1948 | lipoprotein, putative | PG1949 | malate dehydrogenase | -><- | 2038001 | 2038273 | 273 | 46.2% | 0 | 0 | 0 | +: 0/1/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 703 | PG1949 | malate dehydrogenase | PG1950 | hypothetical protein | <--> | 2039279 | 2039739 | 461 | 42.3% | 0 | 0 | 3 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 704 | PG1950 | hypothetical protein | PG1951 | glutaminyl-tRNA synthetase | ->-> | 2040901 | 2041281 | 381 | 44.6% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 705 | PG1954 | NAD dependent epimerase/reductase-related protein | PG1956 | 4-hydroxybutyrate CoA-transferase | -><- | 2045673 | 2046304 | 632 | 48.7% | 0 | 0 | 0 | +: 0/2/0 | -: 0/4/0 | 7 | 0 | 0 | 0 | Result | |
| 706 | PG1956 | 4-hydroxybutyrate CoA-transferase | PG1959 | ribosomal protein L33 | <-<- | 2047601 | 2048306 | 706 | 39.9% | 0 | 0 | 4 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 707 | PG1960 | ribosomal protein L28 | PG1961 | hypothetical protein | <-<- | 2048754 | 2048975 | 222 | 39.2% | 0 | 0 | 0 | +: 0/0/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 708 | PG1961 | hypothetical protein | PG1963 | Sua5/YciO/YrdC/YwlC family protein | <--> | 2051244 | 2052477 | 1234 | 49.7% | 0 | 0 | 5 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 709 | PG1964 | bacterial sugar transferase | PG1966 | hypothetical protein | -><- | 2054457 | 2056207 | 1751 | 53.9% | 0 | 8 | 14 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 710 | PG1966 | hypothetical protein | PG1967 | TPR domain protein | <--> | 2057015 | 2057307 | 293 | 48.8% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 711 | PG1967 | TPR domain protein | PG1968 | hypothetical protein | -><- | 2058196 | 2058549 | 354 | 39% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 712 | PG1970 | hypothetical protein | PG1972 | hemagglutinin protein HagB | <--> | 2059874 | 2060141 | 268 | 52.2% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 713 | PG1972 | hemagglutinin protein HagB | PG1974 | hypothetical protein | -><- | 2061264 | 2062053 | 790 | 42.4% | 0 | 0 | 0 | +: 0/2/0 | -: 1/2/0 | 1 | 0 | 0 | 0 | Result | |
| 714 | PG1974 | hypothetical protein | PG1975 | hemagglutinin protein HagC | <--> | 2063146 | 2063357 | 212 | 41% | 0 | 0 | 0 | +: 0/1/0 | -: 1/0/0 | 1 | 0 | 0 | 0 | Result | |
| 715 | PG1975 | hemagglutinin protein HagC | PG1977 | hypothetical protein | -><- | 2064411 | 2064776 | 366 | 50.5% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 716 | PG1979 | hypothetical protein | PG1980 | hypothetical protein | -><- | 2067580 | 2067849 | 270 | 37% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 717 | PG1980 | hypothetical protein | PG1981 | CRISPR-associated protein Cas2 | <-<- | 2068021 | 2069304 | 1284 | 39% | 0 | 0 | 0 | +: 0/5/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 718 | PG1989 | hypothetical protein | PG1992 | glucose-inhibited division protein A | <--> | 2079192 | 2081549 | 2358 | 42.9% | 0 | 0 | 5 | +: 1/1/1 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 719 | PG1997 | hypothetical protein | PG1998 | polyprenyl synthetase | -><- | 2087133 | 2087240 | 108 | 41.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 720 | PG1998 | polyprenyl synthetase | PG1999 | hypothetical protein | <-<- | 2088120 | 2088272 | 153 | 38.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 721 | PG2003 | deoxyguanosinetriphosphate triphosphohydrolase | PG2004 | hypothetical protein | <-<- | 2093082 | 2093224 | 143 | 45.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 722 | PG2004 | hypothetical protein | PG2006 | hypothetical protein | <--> | 2094218 | 2094726 | 509 | 37.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 723 | PG2006 | hypothetical protein | PG2008 | TonB-dependent receptor, putative | ->-> | 2095087 | 2095382 | 296 | 42.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 724 | PG2008 | TonB-dependent receptor, putative | PG2009 | DNA repair protein RecO, putative | ->-> | 2097885 | 2098453 | 569 | 36.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 725 | PG2009 | DNA repair protein RecO, putative | PG2010 | phosphomannomutase, putative | ->-> | 2099192 | 2099359 | 168 | 41.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 726 | PG2010 | phosphomannomutase, putative | PG2013 | CRISPR-associated protein Cas2 | -><- | 2101013 | 2104315 | 3303 | 41% | 1 | 0 | 0 | +: 1/8/8 | -: 1/5/0 | 1 | 0 | 0 | 0 | Result | |
| 727 | PG2020 | CRISPR-associated TM1814 family protein | PG2021 | hypothetical protein | <-<- | 2112364 | 2113010 | 647 | 41.3% | 0 | 0 | 4 | +: 0/3/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 728 | PG2022 | hypothetical protein | PG2023 | methionyl-tRNA formyltransferase | <-<- | 2117490 | 2117654 | 165 | 44.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 731 | PG2024 | hemagglutinin protein HagE | PG2026 | phosphoglycerate mutase family protein | <--> | 2124294 | 2125071 | 778 | 40.2% | 0 | 0 | 4 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 732 | PG2029 | hypothetical protein | PG2030 | hypothetical protein | ->-> | 2129263 | 2129886 | 624 | 39.7% | 0 | 0 | 0 | +: 0/3/0 | -: 0/4/0 | 2 | 0 | 0 | 0 | Result | |
| 733 | PG2033 | glutamate synthase, small subunit | PG2034 | oxidoreductase, FAD-binding, putative | <-<- | 2134894 | 2134999 | 106 | 47.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 734 | PG2034 | oxidoreductase, FAD-binding, putative | PG2035 | tRNA (guanine-N(1)-)-methyltransferase | <--> | 2135792 | 2135991 | 200 | 47.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 735 | PG2038 | N-acetylmuramoyl-L-alanine amidase, putative | PG2040 | DNA-binding protein, histone-like family | <-<- | 2138298 | 2138487 | 190 | 40.5% | 0 | 0 | 0 | +: 1/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 736 | PG2040 | DNA-binding protein, histone-like family | PG2041 | hypothetical protein | <-<- | 2138965 | 2139324 | 360 | 46.7% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 737 | PG2041 | hypothetical protein | PG2042 | thioredoxin family protein | <-<- | 2140057 | 2140188 | 132 | 37.9% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 738 | PG2042 | thioredoxin family protein | PG2043 | conserved hypothetical protein TIGR00486 | <--> | 2141200 | 2142357 | 1158 | 45.6% | 0 | 13 | 0 | +: 0/3/0 | -: 1/2/2 | 1 | 0 | 0 | 0 | Result | |
| 739 | PG2044 | hypothetical protein | PG2046 | hypothetical protein | ->-> | 2144226 | 2144488 | 263 | 49.8% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 740 | PG2049 | hypothetical protein | PG2050 | hypothetical protein | <-<- | 2148995 | 2149248 | 254 | 45.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 741 | PG2050 | hypothetical protein | PG2052 | dihydrodipicolinate synthase | <--> | 2149525 | 2149775 | 251 | 33.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 742 | PG2053 | dithiobiotin synthetase | PG2054 | lipoprotein PG3 | -><- | 2151328 | 2151432 | 105 | 44.8% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 749 | PG2073 | hypothetical protein | PG2074 | hypothetical protein | <-<- | 2174465 | 2174592 | 128 | 49.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 4 | 0 | 0 | 0 | Result | |
| 751 | PG2078 | hypothetical protein | PG2079 | hypothetical protein | <-<- | 2178691 | 2178979 | 289 | 41.9% | 0 | 0 | 0 | +: 0/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 752 | PG2081 | biotin synthetase | PG2082 | POT family protein | <-<- | 2181752 | 2181932 | 181 | 50.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 753 | PG2083 | hypothetical protein | PG2085 | tryptophanyl-tRNA synthetase | <--> | 2184598 | 2185671 | 1074 | 39.9% | 0 | 0 | 0 | +: 1/3/3 | -: 1/5/0 | 10 | 0 | 0 | 0 | Result | |
| 754 | PG2089 | hypothetical protein | PG2090 | cation efflux family protein | ->-> | 2189965 | 2190369 | 405 | 45.2% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 755 | PG2092 | hypothetical protein | PG2094 | hypothetical protein | <-<- | 2193001 | 2193410 | 410 | 44.4% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 5 | 0 | 0 | 0 | Result | |
| 756 | PG2094 | hypothetical protein | PG2095 | lipoprotein, putative | <-<- | 2197959 | 2198379 | 421 | 41.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 757 | PG2096 | hypothetical protein | PG2097 | ribose-phosphate pyrophosphokinase | <-<- | 2205506 | 2205610 | 105 | 46.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 758 | PG2099 | ATP-dependent RNA helicase, DEAD/DEAH box family | PG2100 | immunoreactive 63 kDa antigen PG102 | <-<- | 2208023 | 2208616 | 594 | 48.8% | 0 | 0 | 3 | +: 0/1/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 759 | PG2101 | hypothetical protein | PG2102 | immunoreactive 61 kDa antigen PG91 | <-<- | 2211364 | 2211513 | 150 | 54.7% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 760 | PG2102 | immunoreactive 61 kDa antigen PG91 | PG2103 | hypothetical protein | <-<- | 2213137 | 2213315 | 179 | 38.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 761 | PG2103 | hypothetical protein | PG2104 | hypothetical protein | <-<- | 2213451 | 2213574 | 124 | 33.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 763 | PG2105 | lipoprotein, putative | PG2106 | hypothetical protein | ->-> | 2214640 | 2214833 | 194 | 36.1% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 764 | PG2106 | hypothetical protein | PG2107 | thiamine biosynthesis protein ThiH | -><- | 2215518 | 2215635 | 118 | 46.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 765 | PG2112 | hypothetical protein | PG2114 | hypothetical protein | -><- | 2222724 | 2224071 | 1348 | 45% | 0 | 0 | 0 | +: 0/4/0 | -: 1/3/0 | 1 | 0 | 0 | 0 | Result | |
| 766 | PG2114 | hypothetical protein | PG2116 | hypothetical protein | <--> | 2224249 | 2224774 | 526 | 44.7% | 0 | 12 | 2 | +: 0/0/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 767 | PG2116 | hypothetical protein | PG2117 | 30S ribosomal protein S16 | -><- | 2224928 | 2225324 | 397 | 40.1% | 0 | 0 | 0 | +: 1/1/0 | -: 1/1/1 | 4 | 0 | 0 | 0 | Result | |
| 768 | PG2117 | 30S ribosomal protein S16 | PG2119 | oxidoreductase, Gfo/Idh/MocA family | <--> | 2225904 | 2226686 | 783 | 45.7% | 0 | 0 | 0 | +: 0/4/0 | -: 0/1/0 | 1 | 3 | 416 | 559 | Result | ctaatctactattcttcgattacgcagcgagagcgtagttattttcgccaattaaacttttgatgtctgagattatagtgcaagccacccacgcactacatgcttacataccgcttcatcacgctgtcaaagccggtcagcccc |
| 769 | PG2119 | oxidoreductase, Gfo/Idh/MocA family | PG2120 | metallo-beta-lactamase superfamily protein | -><- | 2227659 | 2227772 | 114 | 43% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 770 | PG2121 | L-asparaginase | PG2123 | hypothetical protein | <--> | 2229715 | 2230030 | 316 | 45.3% | 1 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 771 | PG2124 | glyceraldehyde 3-phosphate dehydrogenase, type I | PG2125 | transcriptional regulator, AraC family | -><- | 2231325 | 2231465 | 141 | 50.4% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 772 | PG2125 | transcriptional regulator, AraC family | PG2126 | conserved hypothetical protein TIGR00044 | <-<- | 2232345 | 2232527 | 183 | 47% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 775 | PG2132 | fimbrilin | PG2133 | lipoprotein, putative | ->-> | 2239004 | 2239141 | 138 | 40.6% | 0 | 0 | 0 | +: 0/3/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 776 | PG2136 | hypothetical protein | PG2139 | hypothetical protein | ->-> | 2245165 | 2245787 | 623 | 46.7% | 0 | 0 | 0 | +: 0/4/0 | -: 0/2/0 | 1 | 0 | 0 | 0 | Result | |
| 777 | PG2140 | ribosomal protein L32 | PG2141 | 3-oxoacyl-(acyl carrier protein) synthase | ->-> | 2246460 | 2246638 | 179 | 46.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 778 | PG2146 | hypothetical protein | PG2147 | xanthine phosphoribosyltransferase | -><- | 2254711 | 2254908 | 198 | 47.5% | 0 | 0 | 0 | +: 0/3/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 779 | PG2148 | xanthine/uracil permease family protein | PG2149 | hypothetical protein | <-<- | 2256865 | 2257025 | 161 | 41% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 780 | PG2150 | LysM domain protein | PG2152 | DNA-binding protein, histone-like family | <--> | 2259263 | 2259889 | 627 | 40.7% | 0 | 0 | 7 | +: 0/0/0 | -: 0/5/0 | 1 | 0 | 0 | 0 | Result | |
| 783 | PG2156 | conserved hypothetical protein TIGR00046 | PG2157 | glutamine cyclotransferase-related protein | <--> | 2262736 | 2263082 | 347 | 40.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 784 | PG2159 | protoporphyrinogen oxidase | PG2161 | transcriptional regulator, AraC family | -><- | 2265935 | 2266806 | 872 | 43.9% | 0 | 0 | 4 | +: 0/1/0 | -: 1/0/0 | 14 | 0 | 0 | 0 | Result | |
| 785 | PG2165 | glycyl-tRNA synthetase | PG2166 | hypothetical protein | <--> | 2271760 | 2271948 | 189 | 34.9% | 0 | 0 | 0 | +: 0/1/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 786 | PG2166 | hypothetical protein | PG2167 | immunoreactive 53 kDa antigen PG123 | -><- | 2272060 | 2272193 | 134 | 41% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 787 | PG2168 | hypothetical protein | PG2170 | sugar transporter | <-<- | 2274248 | 2276774 | 2527 | 44.5% | 1 | 0 | 1 | +: 1/3/1 | -: 0/7/0 | 5 | 0 | 0 | 0 | Result | |
| 788 | PG2171 | D-isomer specific 2-hydroxyacid dehydrogenase family protein | PG2172 | hypothetical protein | <-<- | 2279063 | 2279280 | 218 | 43.6% | 0 | 0 | 0 | +: 0/1/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 791 | PG2182 | Na(+)-translocating NADH-quinone reductase subunit A | PG2185 | transporter, putative | <-<- | 2291246 | 2292022 | 777 | 43.2% | 0 | 0 | 0 | +: 0/1/0 | -: 0/3/0 | 1 | 0 | 0 | 0 | Result | |
| 792 | PG2186 | transcriptional regulator, putative | PG2187 | 1,4-dihydroxy-2-naphthoate octaprenyltransferase | <-<- | 2293710 | 2293845 | 136 | 35.3% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 793 | PG2190 | cell-division ATP-binding protein | PG2192 | peptidase, M23/M37 family | <--> | 2298000 | 2298380 | 381 | 38.8% | 0 | 0 | 0 | +: 0/0/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 796 | PG2197 | hypothetical protein | PG2199 | ABC transporter, ATP-binding protein, putative | -><- | 2303543 | 2304875 | 1333 | 45.9% | 0 | 0 | 12 | +: 1/2/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| 797 | PG2201 | peptide deformylase | PG2202 | Holliday junction resolvase-like protein | <-<- | 2309503 | 2309606 | 104 | 46.2% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 798 | PG2202 | Holliday junction resolvase-like protein | PG2204 | hypothetical protein | <--> | 2310024 | 2310520 | 497 | 43.5% | 0 | 0 | 1 | +: 0/7/0 | -: 0/4/0 | 1 | 0 | 0 | 0 | Result | |
| 799 | PG2205 | 2-dehydropantoate 2-reductase | PG2206 | ABC transporter, ATP-binding protein | -><- | 2317206 | 2317339 | 134 | 51.5% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 800 | PG2206 | ABC transporter, ATP-binding protein | PG2207 | hypothetical protein | <-<- | 2318957 | 2319231 | 275 | 45.1% | 0 | 0 | 0 | +: 0/0/0 | -: 0/4/0 | 1 | 0 | 0 | 0 | Result | |
| 801 | PG2207 | hypothetical protein | PG2208 | hypothetical protein | <-<- | 2320252 | 2320421 | 170 | 43.5% | 0 | 0 | 0 | +: 0/1/0 | -: 1/1/0 | 1 | 0 | 0 | 0 | Result | |
| 804 | PG2213 | nitrite reductase-related protein | PG2214 | hypothetical protein | <-<- | 2325121 | 2325390 | 270 | 40% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 805 | PG2216 | hypothetical protein | PG2217 | 1-deoxy-D-xylulose-5-phosphate synthase | ->-> | 2329591 | 2329762 | 172 | 41.9% | 0 | 0 | 0 | +: 0/2/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 808 | PG2220 | hypothetical protein | PG2221 | MiaB-like tRNA modifying enzyme | ->-> | 2335429 | 2335565 | 137 | 41.6% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 809 | PG2223 | glycosyl transferase, group 2 family protein | PG2224 | hypothetical protein | ->-> | 2338822 | 2339002 | 181 | 37% | 0 | 0 | 0 | +: 0/0/0 | -: 0/0/0 | 1 | 0 | 0 | 0 | Result | |
| 810 | PG2227 | hypothetical protein | PG0001 | chromosomal replication initiation protein | ->-> | 2342805 | 2343476 | 672 | 40.3% | 0 | 0 | 4 | +: 0/1/0 | -: 0/1/0 | 1 | 0 | 0 | 0 | Result | |
| Total: | 18 | 29 | 0/84 | 649 | 23 | ||||||||||||||