Origin IGS:
agaattggattatggcttttcaacttttccgtactgcagaaaaaactttttccggccgggaacgattattttttttattgctgtgacctgtgccgtggatactacctcccacaaacgagtgttccggtaaagtatccgcctccgcaaaggcatcagtgcagcaccgaatcctttcgcatctgtgcataaacctgccgggcaaacaccctttcgagt
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
actcgaaagggtgtttgcccggcaggtttatgcacagatgcgaaaggattcggtgctgcactgatgcctttgcggaggcggatactttaccggaacactcgtttgtgggaggtagtatccacggcacaggtcacagcaataaaaaaaataatcgttcccggccggaaaaagttttttctgcagtacggaaaagttgaaaagccataatccaattct

Mask Tandem Repeat Region ================================================
agaattggattatggcttttcaacttttccgtactgcagaaaaaactttttccggccgggaacgattattttttttattgctgtgacctgtgccgtggatactacctcccacaaacgagtgttccggtaaagtatccgcctccgcaaaggcatcagtgcagcaccgaatcctttcgcatctgtgcataaacctgccgggcaaacaccctttcgagt

Find is-nt database================================================
Query_seq: PG0662:PG0664|PG0662:PG0664:hypothetical protein:oxidoreductase, Gfo/Idh/MocA family:->->:710217..710432 216
agaattggattatggcttttcaacttttccgtactgcagaaaaaactttttccggccgggaacgattattttttttattgctgtgacctgtgccgtggatactacctcccacaaacgagtgttccggtaaagtatccgcctccgcaaaggcatcagtgcagcaccgaatcctttcgcatctgtgcataaacctgccgggcaaacaccctttcgagt
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: PG0662:PG0664|PG0662:PG0664:hypothetical protein:oxidoreductase, Gfo/Idh/MocA family:->->:710217..710432 216
agaattggattatggcttttcaacttttccgtactgcagaaaaaactttttccggccgggaacgattattttttttattgctgtgacctgtgccgtggatactacctcccacaaacgagtgttccggtaaagtatccgcctccgcaaaggcatcagtgcagcaccgaatcctttcgcatctgtgcataaacctgccgggcaaacaccctttcgagt
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: PG0662:PG0664|PG0662:PG0664:hypothetical protein:oxidoreductase, Gfo/Idh/MocA family:->->:710217..710432 216
agaattggattatggcttttcaacttttccgtactgcagaaaaaactttttccggccgggaacgattattttttttattgctgtgacctgtgccgtggatactacctcccacaaacgagtgttccggtaaagtatccgcctccgcaaaggcatcagtgcagcaccgaatcctttcgcatctgtgcataaacctgccgggcaaacaccctttcgagt
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

agaattggattatggcttttcaacttttccgtactgcagaaaaaactttttccggccgggaacgattattttttttattgctgtgacctgtgccgtggatactacctcccacaaacgagtgttccggtaaagtatccgcctccgcaaaggcatcagtgcagcaccgaatcctttcgcatctgtgcataaacctgccgggcaaacaccctttcgagt
Predict ORF larger than 30AA ================================================
Protein_Len: 41	Strand: +	Start: 5	End: 127
.... M  D  Y  G  F  S  T  F  P  Y  C  R  K  N  F  F  R  P  G  T  I  I  F  F  I  A  V  T  C  A  V  D  T  T  S  H  K  R  V  F  R .........................................................................................
Protein_Len: 60	Strand: +	Start: 4	End: 186
... M  G  L  W  L  F  N  F  S  V  L  Q  K  K  L  F  P  A  G  N  D  Y  F  F  Y  C  C  D  L  C  R  G  Y  Y  L  P  Q  T  S  V  P  V  K  Y  P  P  P  Q  R  H  Q  C  S  T  E  S  F  R  I  C ..............................
Protein_Len: 42	Strand: +	Start: 90	End: 215
......................................................................................... M  P  W  I  L  P  P  T  N  E  C  S  G  K  V  S  A  S  A  K  A  S  V  Q  H  R  I  L  S  H  L  C  I  N  L  P  G  K  H  P  F  E .
Protein_Len: 60	Strand: -	Start: 23	End: 202
...................... S  K  R  V  A  S  F  V  K  E  P  R  S  R  N  N  K  K  N  S  H  G  T  G  H  I  S  G  G  V  F  S  H  E  P  L  T  D  A  E  A  F  A  D  T  C  C  R  I  R  E  C  R  H  M  F  R  G  P  M ..............
Protein_Len: 48	Strand: -	Start: 13	End: 156
............ P  K  E  V  K  G  Y  Q  L  F  F  K  K  R  G  P  V  I  I  K  K  I  A  T  V  Q  A  T  S  V  V  E  W  L  R  T  N  R  Y  L  I  R  R  R  L  P  M  M ............................................................

agaattggattatggcttttcaacttttccgtactgcagaaaaaactttttccggccgggaacgattattttttttattgctgtgacctgtgccgtggatactacctcccacaaacgagtgttccggtaaagtatccgcctccgcaaaggcatcagtgcagcaccgaatcctttcgcatctgtgcataaacctgccgggcaaacaccctttcgagt
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

agaattggattatggcttttcaacttttccgtactgcagaaaaaactttttccggccgggaacgattattttttttattgctgtgacctgtgccgtggatactacctcccacaaacgagtgttccggtaaagtatccgcctccgcaaaggcatcagtgcagcaccgaatcctttcgcatctgtgcataaacctgccgggcaaacaccctttcgagt
Predict TransTerm conf > 70================================================

Find igs database================================================
Query_seq: PG0662:PG0664|PG0662:PG0664:hypothetical protein:oxidoreductase, Gfo/Idh/MocA family:->->:710217..710432 216
agaattggattatggcttttcaacttttccgtactgcagaaaaaactttttccggccgggaacgattattttttttattgctgtgacctgtgccgtggatactacctcccacaaacgagtgttccggtaaagtatccgcctccgcaaaggcatcagtgcagcaccgaatcctttcgcatctgtgcataaacctgccgggcaaacaccctttcgagt
Intra-Species Hit: Count: 1	Min: 1	Max: 216	Len: 216
Subject: NC_002950_PG0662_PG0664|hypothetical protein:oxidoreductase, Gfo/Idh/MocA family|POSITIVE:POSITIVE|[710217,710432]|216
HSP  1	e-value: 1.0E-105	bit: 381.0	Len: 216	Query Start:1	Query End:216	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 216
agaattggattatggcttttcaacttttccgtactgcagaaaaaactttttccggccgggaacgattannnnnnnnattgctgtgacctgtgccgtggatactacctcccacaaacgagtgttccggtaaagtatccgcctccgcaaaggcatcagtgcagcaccgaatcctttcgcatctgtgcataaacctgccgggcaaacaccctttcgagt
agaattggattatggcttttcaacttttccgtactgcagaaaaaactttttccggccgggaacgattattttttttattgctgtgacctgtgccgtggatactacctcccacaaacgagtgttccggtaaagtatccgcctccgcaaaggcatcagtgcagcaccgaatcctttcgcatctgtgcataaacctgccgggcaaacaccctttcgagt

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
AGAAUUGGAUUAUGGCUUUUCAACUUUUCCGUACUGCAGAAAAAACUUUUUCCGGCCGGGAACGAUUAUUUUUUUUAUUGCUGUGACCUGUGCCGUGGAUACUACCUCCCACAAACGAGUGUUCCGGUAAAGUAUCCGCCUCCGCAAAGGCAUCAGUGCAGCACCGAAUCCUUUCGCAUCUGUGCAUAAACCUGCCGGGCAAACACCCUUUCGAGU
.(((..((................(((((.(.....).))))).......((((((.((....................((((((.(((.(((.((((((((((((...(((......)))....)))..)))))))))....))).))))).))))...((((((((....)))).....)))).....)).))))))......))..))).... (-56.00)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
ACUCGAAAGGGUGUUUGCCCGGCAGGUUUAUGCACAGAUGCGAAAGGAUUCGGUGCUGCACUGAUGCCUUUGCGGAGGCGGAUACUUUACCGGAACACUCGUUUGUGGGAGGUAGUAUCCACGGCACAGGUCACAGCAAUAAAAAAAAUAAUCGUUCCCGGCCGGAAAAAGUUUUUUCUGCAGUACGGAAAAGUUGAAAAGCCAUAAUCCAAUUCU
((((....)))).(((((.(.(((......)))...)..))))).((((((.(((((((.(((.(((((.(((.(....(((((((..(((....(((......)))...)))))))))).).))).))).)))))......(((((((.....((((.....))))...)))))))..))))))).))...(((....)))....))))...... (-61.60)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
689	70	21	92	43	NC_002950:PG0722|5end_hypothetical_protein_774891..775121_NEGATIVE
438	167	121	170	123	NC_002950:PG1398|5end_hypothetical_protein_1480694..1480924_POSITIVE
401	199	151	170	130	NC_002950:PG0086|5end_ATP-dependent_RNA_helicase,_DEAD/DEAH_box_family_102359..102589_NEGATIVE
390	170	121	69	1	NC_002950:PG0028|5end_2C-methyl-D-erythritol_2,4-cyclodiphosphate_synthase_33863..34093_POSITIVE
382	167	124	157	112	NC_002950:PG0746|5end_sensor_histidine_kinase_793903..794133_NEGATIVE
379	186	141	195	141	NC_002950:PG0242|5end_conserved_hypothetical_protein_TIGR00096_278960..279190_NEGATIVE
373	159	114	199	145	NC_002950:PG0795|5end_hypothetical_protein_848813..849043_POSITIVE
371	200	151	211	168	NC_002950:PG1075|5end_coenzyme_A_transferase,_beta_subunit_1142778..1143008_POSITIVE
366	180	137	153	109	NC_002950:PG1582|5end_batA_protein_1659321..1659551_POSITIVE
366	100	51	231	181	NC_002950:PG1024|5end_hypothetical_protein_1086698..1086928_POSITIVE
365	163	121	220	163	NC_002950:PG0704|5end_phosphoglycerate_mutase_family_protein_758928..759158_POSITIVE
364	169	122	100	39	NC_002950:PG1970|5end_hypothetical_protein_2059783..2060013_NEGATIVE
356	176	132	202	140	NC_002950:PG2028|5end_ebsC_protein_2126027..2126257_POSITIVE
349	139	91	174	118	NC_002950:PG0248|5end_translation_initation_factor_SUI1,_putative_281842..282072_NEGATIVE
346	167	121	60	9	NC_002950:PG0695|5end_immunoreactive_43_kDa_antigen_PG32_752067..752297_NEGATIVE
346	167	122	217	159	NC_002950:PG0093|5end_HlyD_family_secretion_protein_109638..109868_NEGATIVE
344	138	94	67	19	NC_002950:PG0073|5end_orotidine_5'-monophosphate_decarboxylase_88070..88300_NEGATIVE
342	99	52	231	184	NC_002950:PG1952|5end_DedA_family_protein_2042870..2043100_POSITIVE
341	129	81	57	13	NC_002950:PG2174|5end_hypothetical_protein_2282578..2282808_NEGATIVE
339	95	51	229	189	NC_002950:PG0718|5end_hypothetical_protein_771573..771803_NEGATIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
389	99	51	111	66	NC_002950:PG0719|3end_sensor_histidine_kinase_771696..771846_NEGATIVE
386	176	136	69	8	NC_002950:PG0027|3end_hypothetical_protein_33936..34086_POSITIVE
349	139	91	77	21	NC_002950:PG0249|3end_oxaloacetate_decarboxylase,_putative_281939..282089_NEGATIVE
348	154	114	150	103	NC_002950:PG0794|3end_penicillin-binding_protein_1A,_putative_848851..849001_POSITIVE
345	207	162	63	19	NC_002950:PG1105|3end_RNA_polymerase_sigma-54_factor_1175716..1175866_NEGATIVE
344	138	94	50	2	NC_002950:PG0074|3end_peptide_chain_release_factor_1_88087..88237_NEGATIVE
340	167	124	120	57	NC_002950:PG1391|3end_hypothetical_protein_1472961..1473111_POSITIVE
339	88	44	123	67	NC_002950:PG2216|3end_hypothetical_protein_2329530..2329680_POSITIVE
338	176	136	133	101	NC_002950:PG2040|3end_DNA-binding_protein,_histone-like_family_2138398..2138548_NEGATIVE
338	158	116	67	12	NC_002950:PG0844|3end_hypothetical_protein_905461..905611_POSITIVE
336	60	17	80	33	NC_002950:PG0164|3end_hypothetical_protein_187081..187231_NEGATIVE
334	204	161	123	68	NC_002950:PG1370|3end_lysyl-tRNA_synthetase_1450493..1450643_NEGATIVE
334	200	151	106	66	NC_002950:PG0267|3end_arginyl-tRNA_synthetase_300973..301123_POSITIVE
332	200	152	147	101	NC_002950:PG1753|3end_selenide,_water_dikinase_1839741..1839891_POSITIVE
332	157	113	148	99	NC_002950:PG0094|3end_outer_membrane_efflux_protein,_putative_109688..109838_NEGATIVE
331	198	151	144	89	NC_002950:PG2086|3end_hypothetical_protein_2187070..2187220_POSITIVE
331	160	118	62	3	NC_002950:PG0053|3end_hypothetical_protein_64967..65117_NEGATIVE
329	180	135	67	5	NC_002950:PG1345|3end_glycosyl_transferase,_group_1_family_protein_1426791..1426941_POSITIVE
329	168	124	138	101	NC_002950:PG0361|3end_hypothetical_protein_395481..395631_POSITIVE
328	166	122	115	65	NC_002950:PG1978|3end_hypothetical_protein_2066723..2066873_NEGATIVE