Origin IGS:
ttcaataatgattattggattgtatgacttaagacggatcgacaatcgacccaatctctcttgggtaatttttcgggataaatataagtatttaaagtctgaaaaaagacatttacgtacaaataatgagtggatatggggaggtgatcggattttaactgcccgtctttatgggaatgactcaggagctatgcttatggctaatacaatgccctatacaaactgctattaaaaaagcccgggcatcatctccgttgggcctgtttacgtgccaaaatttttgcatttgttgctcctgaagac
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
gtcttcaggagcaacaaatgcaaaaattttggcacgtaaacaggcccaacggagatgatgcccgggcttttttaatagcagtttgtatagggcattgtattagccataagcatagctcctgagtcattcccataaagacgggcagttaaaatccgatcacctccccatatccactcattatttgtacgtaaatgtcttttttcagactttaaatacttatatttatcccgaaaaattacccaagagagattgggtcgattgtcgatccgtcttaagtcatacaatccaataatcattattgaa

Mask Tandem Repeat Region ================================================
ttcaataatgattattggattgtatgacttaagacggatcgacaatcgacccaatctctcttgggtaatttttcgggataaatataagtatttaaagtctgaaaaaagacatttacgtacaaataatgagtggatatggggaggtgatcggattttaactgcccgtctttatgggaatgactcaggagctatgcttatggctaatacaatgccctatacaaactgctattaaaaaagcccgggcatcatctccgttgggcctgtttacgtgccaaaatttttgcatttgttgctcctgaagac

Find is-nt database================================================
Query_seq: PG1798:PG1799|PG1798:PG1799:immunoreactive 46 kDa antigen PG99:hypothetical protein:<-->:1894336..1894638 303
ttcaataatgattattggattgtatgacttaagacggatcgacaatcgacccaatctctcttgggtaatttttcgggataaatataagtatttaaagtctgaaaaaagacatttacgtacaaataatgagtggatatggggaggtgatcggattttaactgcccgtctttatgggaatgactcaggagctatgcttatggctaatacaatgccctatacaaactgctattaaaaaagcccgggcatcatctccgttgggcctgtttacgtgccaaaatttttgcatttgttgctcctgaagac
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: PG1798:PG1799|PG1798:PG1799:immunoreactive 46 kDa antigen PG99:hypothetical protein:<-->:1894336..1894638 303
ttcaataatgattattggattgtatgacttaagacggatcgacaatcgacccaatctctcttgggtaatttttcgggataaatataagtatttaaagtctgaaaaaagacatttacgtacaaataatgagtggatatggggaggtgatcggattttaactgcccgtctttatgggaatgactcaggagctatgcttatggctaatacaatgccctatacaaactgctattaaaaaagcccgggcatcatctccgttgggcctgtttacgtgccaaaatttttgcatttgttgctcctgaagac
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: PG1798:PG1799|PG1798:PG1799:immunoreactive 46 kDa antigen PG99:hypothetical protein:<-->:1894336..1894638 303
ttcaataatgattattggattgtatgacttaagacggatcgacaatcgacccaatctctcttgggtaatttttcgggataaatataagtatttaaagtctgaaaaaagacatttacgtacaaataatgagtggatatggggaggtgatcggattttaactgcccgtctttatgggaatgactcaggagctatgcttatggctaatacaatgccctatacaaactgctattaaaaaagcccgggcatcatctccgttgggcctgtttacgtgccaaaatttttgcatttgttgctcctgaagac
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

ttcaataatgattattggattgtatgacttaagacggatcgacaatcgacccaatctctcttgggtaatttttcgggataaatataagtatttaaagtctgaaaaaagacatttacgtacaaataatgagtggatatggggaggtgatcggattttaactgcccgtctttatgggaatgactcaggagctatgcttatggctaatacaatgccctatacaaactgctattaaaaaagcccgggcatcatctccgttgggcctgtttacgtgccaaaatttttgcatttgttgctcctgaagac
Predict ORF larger than 30AA ================================================
Protein_Len: 60	Strand: +	Start: 5	End: 229
.... M  M  I  I  G  L  Y  D  L  R  R  I  D  N  R  P  N  L  S  W  V  I  F  R  D  K  Y  K  Y  L  K  S  E  K  R  H  L  R  T  N  N  E  W  I  W  G  G  D  R  I  L  T  A  R  L  Y  G  N  D  S ..........................................................................
Protein_Len: 46	Strand: +	Start: 159	End: 296
.............................................................................................................................................................. M  P  V  F  M  G  M  T  Q  E  L  C  L  W  L  I  Q  C  P  I  Q  T  A  I  K  K  A  R  A  S  S  P  L  G  L  F  T  C  Q  N  F  C  I  C  C  S .......
Protein_Len: 34	Strand: -	Start: 185	End: 286
........................................................................................................................................................................................ S  S  H  K  H  S  I  C  H  G  I  C  V  A  I  L  F  A  R  A  D  D  G  N  P  R  N  V  H  W  F  K  Q  M .................
Protein_Len: 57	Strand: -	Start: 15	End: 185
.............. Q  I  T  H  S  L  V  S  R  C  D  V  W  D  R  K  P  L  K  E  P  Y  I  Y  T  N  L  T  Q  F  F  V  N  V  Y  L  Y  H  T  S  I  P  L  H  D  S  K  L  Q  G  D  K  H  S  H  S  M ......................................................................................................................
Protein_Len: 51	Strand: -	Start: 1	End: 153
 E  I  I  I  I  P  N  Y  S  K  L  R  I  S  L  R  G  L  R  E  Q  T  I  K  R  S  L  Y  L  Y  K  F  D  S  F  L  C  K  R  V  F  L  S  H  I  H  P  P  S  R  M ......................................................................................................................................................

ttcaataatgattattggattgtatgacttaagacggatcgacaatcgacccaatctctcttgggtaatttttcgggataaatataagtatttaaagtctgaaaaaagacatttacgtacaaataatgagtggatatggggaggtgatcggattttaactgcccgtctttatgggaatgactcaggagctatgcttatggctaatacaatgccctatacaaactgctattaaaaaagcccgggcatcatctccgttgggcctgtttacgtgccaaaatttttgcatttgttgctcctgaagac
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

ttcaataatgattattggattgtatgacttaagacggatcgacaatcgacccaatctctcttgggtaatttttcgggataaatataagtatttaaagtctgaaaaaagacatttacgtacaaataatgagtggatatggggaggtgatcggattttaactgcccgtctttatgggaatgactcaggagctatgcttatggctaatacaatgccctatacaaactgctattaaaaaagcccgggcatcatctccgttgggcctgtttacgtgccaaaatttttgcatttgttgctcctgaagac
Predict TransTerm conf > 70================================================
TransTerm Strand: +	Conf: 45	HP_score: -2.1	Tail_Score: -3.35542	Start: 48	End: 67	Full_Region: GACGGATCGACAATC GACCCAA TCTCTC TTGGGTA ATTTTTCGGGATAAA
...............................................GACCCAATCTCTCTTGGGTA............................................................................................................................................................................................................................................
TransTerm Strand: +	Conf: 54	HP_score: -4.7	Tail_Score: -3.24422	Start: 50	End: 65	Full_Region: CGGATCGACAATCGA CCCAA TCTCTC TTGGG TAATTTTTCGGGATA
.................................................CCCAATCTCTCTTGGG..............................................................................................................................................................................................................................................
TransTerm Strand: -	Conf: 49	HP_score: -4.7	Tail_Score: -2.6063	Start: 50	End: 65	Full_Region: tatcccgaaaaatta cccaa gagaga ttggg tcgattgtcgatccg
.................................................cccaagagagattggg..............................................................................................................................................................................................................................................

Find igs database================================================
Query_seq: PG1798:PG1799|PG1798:PG1799:immunoreactive 46 kDa antigen PG99:hypothetical protein:<-->:1894336..1894638 303
ttcaataatgattattggattgtatgacttaagacggatcgacaatcgacccaatctctcttgggtaatttttcgggataaatataagtatttaaagtctgaaaaaagacatttacgtacaaataatgagtggatatggggaggtgatcggattttaactgcccgtctttatgggaatgactcaggagctatgcttatggctaatacaatgccctatacaaactgctattaaaaaagcccgggcatcatctccgttgggcctgtttacgtgccaaaatttttgcatttgttgctcctgaagac
Intra-Species Hit: Count: 1	Min: 1	Max: 303	Len: 303
Subject: NC_002950_PG1798_PG1799|immunoreactive 46 kDa antigen PG99:hypothetical protein|NEGATIVE:POSITIVE|[1894336,1894638]|303
HSP  1	e-value: 1.0E-171	bit: 601.0	Len: 303	Query Start:1	Query End:303	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 303
ttcaataatgattattggattgtatgacttaagacggatcgacaatcgacccaatctctcttgggtaatttttcgggataaatataagtatttaaagtctgaaaaaagacatttacgtacaaataatgagtggatatggggaggtgatcggattttaactgcccgtctttatgggaatgactcaggagctatgcttatggctaatacaatgccctatacaaactgctattaaaaaagcccgggcatcatctccgttgggcctgtttacgtgccaaaatttttgcatttgttgctcctgaagac
ttcaataatgattattggattgtatgacttaagacggatcgacaatcgacccaatctctcttgggtaatttttcgggataaatataagtatttaaagtctgaaaaaagacatttacgtacaaataatgagtggatatggggaggtgatcggattttaactgcccgtctttatgggaatgactcaggagctatgcttatggctaatacaatgccctatacaaactgctattaaaaaagcccgggcatcatctccgttgggcctgtttacgtgccaaaatttttgcatttgttgctcctgaagac

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UUCAAUAAUGAUUAUUGGAUUGUAUGACUUAAGACGGAUCGACAAUCGACCCAAUCUCUCUUGGGUAAUUUUUCGGGAUAAAUAUAAGUAUUUAAAGUCUGAAAAAAGACAUUUACGUACAAAUAAUGAGUGGAUAUGGGGAGGUGAUCGGAUUUUAACUGCCCGUCUUUAUGGGAAUGACUCAGGAGCUAUGCUUAUGGCUAAUACAAUGCCCUAUACAAACUGCUAUUAAAAAAGCCCGGGCAUCAUCUCCGUUGGGCCUGUUUACGUGCCAAAAUUUUUGCAUUUGUUGCUCCUGAAGAC
..(((((.....)))))((((((.(((((......)).))))))))).((((((......))))))...(((((((((.........((((.((((((((......)))).)))).))))...(((..((((.......((((((((............((((((....((((((.((........((((((....))))))......))..))))))......(((........))).))))))))))))))....(((.((....)).)))..........))))..))).))))))))). (-76.44)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
GUCUUCAGGAGCAACAAAUGCAAAAAUUUUGGCACGUAAACAGGCCCAACGGAGAUGAUGCCCGGGCUUUUUUAAUAGCAGUUUGUAUAGGGCAUUGUAUUAGCCAUAAGCAUAGCUCCUGAGUCAUUCCCAUAAAGACGGGCAGUUAAAAUCCGAUCACCUCCCCAUAUCCACUCAUUAUUUGUACGUAAAUGUCUUUUUUCAGACUUUAAAUACUUAUAUUUAUCCCGAAAAAUUACCCAAGAGAGAUUGGGUCGAUUGUCGAUCCGUCUUAAGUCAUACAAUCCAAUAAUCAUUAUUGAA
...(((((((((.....(((((((.......((...((((.((((((...((........)).)))))).))))...))..)))))))..(((.........))).........)))))))))...........((((((((....................................(((..(((..((((.((((......))))))))..)))..))).......(((..((((((((((......)))))).)))).))).)))))))).............(((((.....))))).. (-67.80)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
920	80	31	171	122	NC_002950:PG1798|5end_immunoreactive_46_kDa_antigen_PG99_1894245..1894475_NEGATIVE
401	274	232	90	32	NC_002950:PG1270|5end_hypothetical_protein_1350207..1350437_NEGATIVE
368	176	136	61	2	NC_002950:PG0992|5end_threonyl-tRNA_synthetase_1054104..1054334_NEGATIVE
357	274	236	231	186	NC_002950:PG0290|5end_hypothetical_protein_323904..324134_POSITIVE
346	165	126	221	173	NC_002950:PG0125|5end_hypothetical_protein_146786..147016_NEGATIVE
338	298	254	40	1	NC_002950:PG0143|5end_hydrolase,_carbon-nitrogen_family_166625..166855_NEGATIVE
336	189	141	190	130	NC_002950:PG0684|5end_ABC_transporter,_permease_protein,_putative_737648..737878_POSITIVE
332	269	235	169	135	NC_002950:PG2097|5end_ribose-phosphate_pyrophosphokinase_2206462..2206692_NEGATIVE
331	274	237	154	121	NC_002950:PG0636|5end_MATE_efflux_family_protein_689071..689301_NEGATIVE
328	200	160	84	45	NC_002950:PG0908|5end_G/U_mismatch-specific_DNA_glycosylase,_putative_971721..971951_NEGATIVE
327	276	239	190	142	NC_002950:PG1310|5end_exsB_protein_1389084..1389314_POSITIVE
327	269	223	221	178	NC_002950:PG0149|5end_hypothetical_protein_172203..172433_NEGATIVE
323	273	235	211	156	NC_002950:PG0364|5end_hypothetical_protein_399615..399845_NEGATIVE
321	168	128	183	144	NC_002950:PG0615|5end_GTP-binding_protein_TypA_667033..667263_POSITIVE
319	276	237	214	170	NC_002950:PG2209|5end_hypothetical_protein_2320928..2321158_NEGATIVE
319	262	222	44	2	NC_002950:PG0034|5end_thioredoxin_42549..42779_NEGATIVE
318	300	251	222	169	NC_002950:PG2205|5end_2-dehydropantoate_2-reductase_2316121..2316351_POSITIVE
317	269	221	118	50	NC_002950:PG0337|5end_hypothetical_protein_371529..371759_NEGATIVE
312	300	251	185	141	NC_002950:PG1659|5end_hypothetical_protein_1743747..1743977_NEGATIVE
311	189	141	76	5	NC_002950:PG1164|5end_hypothetical_protein_1247514..1247744_NEGATIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
401	274	232	83	25	NC_002950:PG1271|3end_acetylornithine_aminotransferase,_putative_1350214..1350364_NEGATIVE
395	296	251	136	96	NC_002950:PG1655|3end_hypothetical_protein_1737384..1737534_POSITIVE
345	169	127	56	6	NC_002950:PG1742|3end_hypothetical_protein_1827506..1827656_POSITIVE
328	200	160	67	28	NC_002950:PG0909|3end_hypothetical_protein_971738..971888_NEGATIVE
311	189	141	79	8	NC_002950:PG1165|3end_hypothetical_protein_1247511..1247661_NEGATIVE
310	262	225	77	36	NC_002950:PG1361|3end_dipeptidyl_aminopeptidase_IV,_putative_1439910..1440060_NEGATIVE
310	298	253	132	79	NC_002950:PG0594|3end_RNA_polymerase_sigma-70_factor_652991..653141_POSITIVE
308	273	236	50	15	NC_002950:PG0317|3end_peptidase,_M49_family_349771..349921_NEGATIVE
306	189	142	46	1	NC_002950:PG0017|3end_sensor_histidine_kinase_19724..19874_POSITIVE
301	202	161	72	21	NC_002950:PG1755|3end_fructose-bisphosphate_aldolase_1842397..1842547_NEGATIVE
298	199	151	62	15	NC_002950:PG1864|3end_leucine-rich_protein_1960509..1960659_NEGATIVE
298	275	231	86	32	NC_002950:PG0310|3end_nitroreductase_family_protein_345020..345170_NEGATIVE
297	186	141	146	94	NC_002950:PG1949|3end_malate_dehydrogenase_2038184..2038334_NEGATIVE
295	203	163	145	104	NC_002950:PG1922|3end_ribosomal_protein_L18_2017027..2017177_NEGATIVE
295	260	211	138	81	NC_002950:PG1389|3end_DNA-binding_protein,_histone-like_family_1470870..1471020_NEGATIVE
290	261	221	145	97	NC_002950:PG1375|3end_hypothetical_protein_1456743..1456893_POSITIVE
289	269	224	77	30	NC_002950:PG1171|3end_oxidoreductase,_putative_1251175..1251325_POSITIVE
289	202	161	103	51	NC_002950:PG0246|3end_hypothetical_protein_281050..281200_NEGATIVE
288	273	233	83	35	NC_002950:PG0770|3end_hypothetical_protein_824159..824309_NEGATIVE
287	270	239	55	21	NC_002950:PG1760|3end_ABC_transporter,_ATP-binding_protein_1847216..1847366_POSITIVE