Origin IGS:
tcgccgacccgatccgtatagaataagaacctccgtgctaagagaaatttatcgtacggaggtatgctttttggcggaaatatatttactttgggatagaagagtagacccataaggagcttgaatacgatgcgatcgtatccgaagggcatgcgaaatatagatcgggaaaggtgcccgtattctttggttttgcgagcttcttttttgactttcccgtggagtttttcccctgatgtatggccgaagaggaagcattcgtgcctcttcagggcatagggacaaaatttttaagaatacaattatcagatttatcaca
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
tgtgataaatctgataattgtattcttaaaaattttgtccctatgccctgaagaggcacgaatgcttcctcttcggccatacatcaggggaaaaactccacgggaaagtcaaaaaagaagctcgcaaaaccaaagaatacgggcacctttcccgatctatatttcgcatgcccttcggatacgatcgcatcgtattcaagctccttatgggtctactcttctatcccaaagtaaatatatttccgccaaaaagcatacctccgtacgataaatttctcttagcacggaggttcttattctatacggatcgggtcggcga

Mask Tandem Repeat Region ================================================
tcgccgacccgatccgtatagaataagaacctccgtgctaagagaaatttatcgtacggaggtatgctttttggcggaaatatatttactttgggatagaagagtagacccataaggagcttgaatacgatgcgatcgtatccgaagggcatgcgaaatatagatcgggaaaggtgcccgtattctttggttttgcgagcttcttttttgactttcccgtggagtttttcccctgatgtatggccgaagaggaagcattcgtgcctcttcagggcatagggacaaaatttttaagaatacaattatcagatttatcaca

Find is-nt database================================================
Query_seq: PG1170:PG1171|PG1170:PG1171:SerB family protein:oxidoreductase, putative:->->:1250176..1250494 319
tcgccgacccgatccgtatagaataagaacctccgtgctaagagaaatttatcgtacggaggtatgctttttggcggaaatatatttactttgggatagaagagtagacccataaggagcttgaatacgatgcgatcgtatccgaagggcatgcgaaatatagatcgggaaaggtgcccgtattctttggttttgcgagcttcttttttgactttcccgtggagtttttcccctgatgtatggccgaagaggaagcattcgtgcctcttcagggcatagggacaaaatttttaagaatacaattatcagatttatcaca
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: PG1170:PG1171|PG1170:PG1171:SerB family protein:oxidoreductase, putative:->->:1250176..1250494 319
tcgccgacccgatccgtatagaataagaacctccgtgctaagagaaatttatcgtacggaggtatgctttttggcggaaatatatttactttgggatagaagagtagacccataaggagcttgaatacgatgcgatcgtatccgaagggcatgcgaaatatagatcgggaaaggtgcccgtattctttggttttgcgagcttcttttttgactttcccgtggagtttttcccctgatgtatggccgaagaggaagcattcgtgcctcttcagggcatagggacaaaatttttaagaatacaattatcagatttatcaca
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: PG1170:PG1171|PG1170:PG1171:SerB family protein:oxidoreductase, putative:->->:1250176..1250494 319
tcgccgacccgatccgtatagaataagaacctccgtgctaagagaaatttatcgtacggaggtatgctttttggcggaaatatatttactttgggatagaagagtagacccataaggagcttgaatacgatgcgatcgtatccgaagggcatgcgaaatatagatcgggaaaggtgcccgtattctttggttttgcgagcttcttttttgactttcccgtggagtttttcccctgatgtatggccgaagaggaagcattcgtgcctcttcagggcatagggacaaaatttttaagaatacaattatcagatttatcaca
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

tcgccgacccgatccgtatagaataagaacctccgtgctaagagaaatttatcgtacggaggtatgctttttggcggaaatatatttactttgggatagaagagtagacccataaggagcttgaatacgatgcgatcgtatccgaagggcatgcgaaatatagatcgggaaaggtgcccgtattctttggttttgcgagcttcttttttgactttcccgtggagtttttcccctgatgtatggccgaagaggaagcattcgtgcctcttcagggcatagggacaaaatttttaagaatacaattatcagatttatcaca
Predict ORF larger than 30AA ================================================
Protein_Len: 30	Strand: +	Start: 23	End: 112
...................... M  R  T  S  V  L  R  E  I  Y  R  T  E  V  C  F  L  A  E  I  Y  L  L  W  D  R  R  V  D  P ...............................................................................................................................................................................................................
Protein_Len: 33	Strand: +	Start: 135	End: 233
...................................................................................................................................... M  V  S  E  G  H  A  K  Y  R  S  G  K  V  P  V  F  F  G  F  A  S  F  F  F  D  F  P  V  E  F  F  P ......................................................................................
Protein_Len: 55	Strand: +	Start: 112	End: 276
............................................................................................................... M  R  S  L  N  T  M  R  S  Y  P  K  G  M  R  N  I  D  R  E  R  C  P  Y  S  L  V  L  R  A  S  F  L  T  F  P  W  S  F  S  P  D  V  W  P  K  R  K  H  S  C  L  F  R  A ...........................................
Protein_Len: 51	Strand: -	Start: 89	End: 241
........................................................................................ K  P  I  S  S  Y  V  W  L  S  S  S  Y  S  A  I  T  D  S  P  C  A  F  Y  L  D  P  F  T  G  T  N  K  P  K  A  L  K  K  K  S  K  G  T  S  N  K  G  Q  H  M ..............................................................................
Protein_Len: 60	Strand: -	Start: 52	End: 318
................................................... I  R  L  A  H  S  I  Y  I  P  F  P  A  R  I  R  Q  N  Q  S  S  R  K  Q  S  E  R  P  T  K  G  R  I  Y  P  R  L  P  L  M  R  A  E  E  P  C  L  S  L  I  K  L  F  V  I  I  L  N  I  M .
Protein_Len: 60	Strand: -	Start: 3	End: 272
.. P  Y  F  L  L  G  M  L  L  K  F  V  I  R  D  Y  G  F  P  M  R  F  I  S  R  S  L  H  G  Y  E  K  T  K  R  A  E  K  K  V  K  G  H  L  K  E  G  S  T  H  G  F  L  F  C  E  H  R  K  M ...............................................

tcgccgacccgatccgtatagaataagaacctccgtgctaagagaaatttatcgtacggaggtatgctttttggcggaaatatatttactttgggatagaagagtagacccataaggagcttgaatacgatgcgatcgtatccgaagggcatgcgaaatatagatcgggaaaggtgcccgtattctttggttttgcgagcttcttttttgactttcccgtggagtttttcccctgatgtatggccgaagaggaagcattcgtgcctcttcagggcatagggacaaaatttttaagaatacaattatcagatttatcaca
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

tcgccgacccgatccgtatagaataagaacctccgtgctaagagaaatttatcgtacggaggtatgctttttggcggaaatatatttactttgggatagaagagtagacccataaggagcttgaatacgatgcgatcgtatccgaagggcatgcgaaatatagatcgggaaaggtgcccgtattctttggttttgcgagcttcttttttgactttcccgtggagtttttcccctgatgtatggccgaagaggaagcattcgtgcctcttcagggcatagggacaaaatttttaagaatacaattatcagatttatcaca
Predict TransTerm conf > 70================================================

Find igs database================================================
Query_seq: PG1170:PG1171|PG1170:PG1171:SerB family protein:oxidoreductase, putative:->->:1250176..1250494 319
tcgccgacccgatccgtatagaataagaacctccgtgctaagagaaatttatcgtacggaggtatgctttttggcggaaatatatttactttgggatagaagagtagacccataaggagcttgaatacgatgcgatcgtatccgaagggcatgcgaaatatagatcgggaaaggtgcccgtattctttggttttgcgagcttcttttttgactttcccgtggagtttttcccctgatgtatggccgaagaggaagcattcgtgcctcttcagggcatagggacaaaatttttaagaatacaattatcagatttatcaca
Intra-Species Hit: Count: 1	Min: 1	Max: 319	Len: 319
Subject: NC_002950_PG1170_PG1171|SerB family protein:oxidoreductase, putative|POSITIVE:POSITIVE|[1250176,1250494]|319
HSP  1	e-value: 1.0E-180	bit: 632.0	Len: 319	Query Start:1	Query End:319	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 319
tcgccgacccgatccgtatagaataagaacctccgtgctaagagaaatttatcgtacggaggtatgctttttggcggaaatatatttactttgggatagaagagtagacccataaggagcttgaatacgatgcgatcgtatccgaagggcatgcgaaatatagatcgggaaaggtgcccgtattctttggttttgcgagcttcttttttgactttcccgtggagtttttcccctgatgtatggccgaagaggaagcattcgtgcctcttcagggcatagggacaaaatttttaagaatacaattatcagatttatcaca
tcgccgacccgatccgtatagaataagaacctccgtgctaagagaaatttatcgtacggaggtatgctttttggcggaaatatatttactttgggatagaagagtagacccataaggagcttgaatacgatgcgatcgtatccgaagggcatgcgaaatatagatcgggaaaggtgcccgtattctttggttttgcgagcttcttttttgactttcccgtggagtttttcccctgatgtatggccgaagaggaagcattcgtgcctcttcagggcatagggacaaaatttttaagaatacaattatcagatttatcaca

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UCGCCGACCCGAUCCGUAUAGAAUAAGAACCUCCGUGCUAAGAGAAAUUUAUCGUACGGAGGUAUGCUUUUUGGCGGAAAUAUAUUUACUUUGGGAUAGAAGAGUAGACCCAUAAGGAGCUUGAAUACGAUGCGAUCGUAUCCGAAGGGCAUGCGAAAUAUAGAUCGGGAAAGGUGCCCGUAUUCUUUGGUUUUGCGAGCUUCUUUUUUGACUUUCCCGUGGAGUUUUUCCCCUGAUGUAUGGCCGAAGAGGAAGCAUUCGUGCCUCUUCAGGGCAUAGGGACAAAAUUUUUAAGAAUACAAUUAUCAGAUUUAUCACA
.((((..((((((((((((.........((((((((((..(((....)))...))))))))))..((((((((..((.......((((((((........))))))))))..))))))))....)))))......((((((((....)).))))))......)))))))...))))...((((((((.((((((((..((((((((((((.((.((..(.((((...)))))..)).....)).))))))))))))....((((((.....))))))...).)))))))...))))))))................... (-100.21)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UGUGAUAAAUCUGAUAAUUGUAUUCUUAAAAAUUUUGUCCCUAUGCCCUGAAGAGGCACGAAUGCUUCCUCUUCGGCCAUACAUCAGGGGAAAAACUCCACGGGAAAGUCAAAAAAGAAGCUCGCAAAACCAAAGAAUACGGGCACCUUUCCCGAUCUAUAUUUCGCAUGCCCUUCGGAUACGAUCGCAUCGUAUUCAAGCUCCUUAUGGGUCUACUCUUCUAUCCCAAAGUAAAUAUAUUUCCGCCAAAAAGCAUACCUCCGUACGAUAAAUUUCUCUUAGCACGGAGGUUCUUAUUCUAUACGGAUCGGGUCGGCGA
................................((((..(((((((..(((((((((...........))))))))).....))).))))..)))).....((((((((((......)).(((((...............)))))..)))))))).........((((..((((...(((((((((...)))))))))......(((.((((.............)))))))..........((((...........((((((((.(...............).))))))))............))))..))))..)))) (-77.74)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
375	277	242	41	1	NC_002950:PG0346|5end_GTP-binding_protein_380659..380889_POSITIVE
373	280	231	201	131	NC_002950:PG0756|5end_hypothetical_protein_805673..805903_NEGATIVE
364	180	131	57	8	NC_002950:PG0271|5end_single-stranded_binding_protein_303842..304072_POSITIVE
357	168	128	211	169	NC_002950:PG1927|5end_50S_ribosomal_protein_L24_2019557..2019787_NEGATIVE
356	281	242	55	9	NC_002950:PG2214|5end_hypothetical_protein_2326575..2326805_NEGATIVE
356	180	131	123	73	NC_002950:PG0651|5end_HDIG_domain_protein_703622..703852_NEGATIVE
355	279	233	192	134	NC_002950:PG1022|5end_hypothetical_protein_1083537..1083767_POSITIVE
353	280	232	205	152	NC_002950:PG1779|5end_hypothetical_protein_1867924..1868154_POSITIVE
352	269	225	138	83	NC_002950:PG1173|5end_YkgG_family_protein_1252435..1252665_POSITIVE
348	256	217	231	190	NC_002950:PG0635|5end_ribosomal_protein_L11_methyltransferase_687773..688003_NEGATIVE
347	260	211	223	171	NC_002950:PG2173|5end_outer_membrane_lipoprotein_Omp28_2280813..2281043_NEGATIVE
347	219	171	159	109	NC_002950:PG1949|5end_malate_dehydrogenase_2039188..2039418_NEGATIVE
347	273	231	205	156	NC_002950:PG1829|5end_long-chain-fatty-acid--CoA_ligase,_putative_1922980..1923210_NEGATIVE
347	222	181	187	134	NC_002950:PG0594|5end_RNA_polymerase_sigma-70_factor_652048..652278_POSITIVE
346	280	232	231	185	NC_002950:PG1682|5end_glycosyl_transferase,_group_1_family_protein_1768385..1768615_POSITIVE
344	270	221	156	96	NC_002950:PG1035|5end_hypothetical_protein_1096875..1097105_POSITIVE
341	273	233	228	184	NC_002950:PG1484|5end_hypothetical_protein_1559979..1560209_NEGATIVE
339	220	174	45	6	NC_002950:PG2060|5end_thymidylate_synthase_2157573..2157803_POSITIVE
337	66	32	198	167	NC_002950:PG1887|5end_rhodanese-like_domain_protein_1984565..1984795_POSITIVE
332	200	154	196	152	NC_002950:PG2199|5end_ABC_transporter,_ATP-binding_protein,_putative_2306723..2306953_NEGATIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
373	280	231	151	81	NC_002950:PG0757|3end_hypothetical_protein_805723..805873_NEGATIVE
353	280	232	123	70	NC_002950:PG1778|3end_hypothetical_protein_1867922..1868072_POSITIVE
343	275	231	97	57	NC_002950:PG0605|3end_hypothetical_protein_661165..661315_NEGATIVE
340	180	131	138	83	NC_002950:PG0445|3end_peptidase_T_486549..486699_POSITIVE
332	275	233	107	46	NC_002950:PG2159|3end_protoporphyrinogen_oxidase_2265874..2266024_POSITIVE
332	205	162	59	8	NC_002950:PG1579|3end_ATPase,_MoxR_family_1657568..1657718_POSITIVE
332	266	224	48	1	NC_002950:PG0340|3end_hypothetical_protein_376436..376586_POSITIVE
330	280	231	148	98	NC_002950:PG0674|3end_indolepyruvate_ferredoxin_oxidoreductase,_beta_subunit_724209..724359_NEGATIVE
329	275	231	99	28	NC_002950:PG0378|3end_elongation_factor_Ts_408808..408958_POSITIVE
328	260	217	77	22	NC_002950:PG0752|3end_uracil_phosphoribosyltransferase_798397..798547_POSITIVE
328	203	165	115	78	NC_002950:PG0522|3end_tRNA_delta(2)-isopentenylpyrophosphate_transferase_565993..566143_NEGATIVE
326	180	131	131	80	NC_002950:PG0896|3end_beta-galactosidase_960382..960532_POSITIVE
325	63	29	62	28	NC_002950:PG1170|3end_SerB_family_protein_1250115..1250265_POSITIVE
325	260	214	148	94	NC_002950:PG1012|3end_tRNA-i(6)A37_modification_enzyme_MiaB_1070089..1070239_NEGATIVE
320	190	143	137	92	NC_002950:PG0558|3end_purine_nucleoside_phosphorylase_615510..615660_NEGATIVE
319	79	31	88	32	NC_002950:PG0767|3end_4-alpha-glucanotransferase_818557..818707_NEGATIVE
318	180	131	110	44	NC_002950:PG2003|3end_deoxyguanosinetriphosphate_triphosphohydrolase_2091648..2091798_NEGATIVE
317	169	121	79	30	NC_002950:PG2027|3end_hypothetical_protein_2126098..2126248_POSITIVE
315	284	246	118	78	NC_002950:PG1793|3end_1,4-alpha-glucan_branching_enzyme_1886008..1886158_POSITIVE
313	210	162	67	19	NC_002950:PG0471|3end_hypothetical_protein_513432..513582_POSITIVE