Origin IGS:
ctggatagccctgtttggattgatcttcttttacaaatataacatggtaaaactgaatttttcctgaaatagcatgctctccctttgcagtcccgggatgtgcagatattttacgcctgtgttttggggacgaggtgcaaattcggtggcacttttttatatctttgtcccgagacgatttgctcgaatctcagcaaacgaagtctttcaatcacttaaaaacagatagtt
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
aactatctgtttttaagtgattgaaagacttcgtttgctgagattcgagcaaatcgtctcgggacaaagatataaaaaagtgccaccgaatttgcacctcgtccccaaaacacaggcgtaaaatatctgcacatcccgggactgcaaagggagagcatgctatttcaggaaaaattcagttttaccatgttatatttgtaaaagaagatcaatccaaacagggctatccag

Mask Tandem Repeat Region ================================================
ctggatagccctgtttggattgatcttcttttacaaatataacatggtaaaactgaatttttcctgaaatagcatgctctccctttgcagtcccgggatgtgcagatattttacgcctgtgttttggggacgaggtgcaaattcggtggcacttttttatatctttgtcccgagacgatttgctcgaatctcagcaaacgaagtctttcaatcacttaaaaacagatagtt

Find is-nt database================================================
Query_seq: PG0720:PG0721|PG0720:PG0721:DNA-binding response regulator:NLP/P60 family protein:<-->:773756..773986 231
ctggatagccctgtttggattgatcttcttttacaaatataacatggtaaaactgaatttttcctgaaatagcatgctctccctttgcagtcccgggatgtgcagatattttacgcctgtgttttggggacgaggtgcaaattcggtggcacttttttatatctttgtcccgagacgatttgctcgaatctcagcaaacgaagtctttcaatcacttaaaaacagatagtt
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: PG0720:PG0721|PG0720:PG0721:DNA-binding response regulator:NLP/P60 family protein:<-->:773756..773986 231
ctggatagccctgtttggattgatcttcttttacaaatataacatggtaaaactgaatttttcctgaaatagcatgctctccctttgcagtcccgggatgtgcagatattttacgcctgtgttttggggacgaggtgcaaattcggtggcacttttttatatctttgtcccgagacgatttgctcgaatctcagcaaacgaagtctttcaatcacttaaaaacagatagtt
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: PG0720:PG0721|PG0720:PG0721:DNA-binding response regulator:NLP/P60 family protein:<-->:773756..773986 231
ctggatagccctgtttggattgatcttcttttacaaatataacatggtaaaactgaatttttcctgaaatagcatgctctccctttgcagtcccgggatgtgcagatattttacgcctgtgttttggggacgaggtgcaaattcggtggcacttttttatatctttgtcccgagacgatttgctcgaatctcagcaaacgaagtctttcaatcacttaaaaacagatagtt
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

ctggatagccctgtttggattgatcttcttttacaaatataacatggtaaaactgaatttttcctgaaatagcatgctctccctttgcagtcccgggatgtgcagatattttacgcctgtgttttggggacgaggtgcaaattcggtggcacttttttatatctttgtcccgagacgatttgctcgaatctcagcaaacgaagtctttcaatcacttaaaaacagatagtt
Predict ORF larger than 30AA ================================================
Protein_Len: 44	Strand: +	Start: 85	End: 216
.................................................................................... M  Q  S  R  D  V  Q  I  F  Y  A  C  V  L  G  T  R  C  K  F  G  G  T  F  L  Y  L  C  P  E  T  I  C  S  N  L  S  K  R  S  L  S  I  T ...............
Protein_Len: 52	Strand: +	Start: 74	End: 226
......................................................................... M  L  S  L  C  S  P  G  M  C  R  Y  F  T  P  V  F  W  G  R  G  A  N  S  V  A  L  F  Y  I  F  V  P  R  R  F  A  R  I  S  A  N  E  V  F  Q  S  L  K  N  R  * .....
Protein_Len: 58	Strand: +	Start: 57	End: 230
........................................................ M  F  P  E  I  A  C  S  P  F  A  V  P  G  C  A  D  I  L  R  L  C  F  G  D  E  V  Q  I  R  W  H  F  F  I  S  L  S  R  D  D  L  L  E  S  Q  Q  T  K  S  F  N  H  L  K  T  D  S .
Protein_Len: 34	Strand: -	Start: 114	End: 215
................................................................................................................. A  Q  T  K  P  V  L  H  L  N  P  P  V  K  K  Y  R  Q  G  S  V  I  Q  E  F  R  L  L  R  L  R  E  I  M ................
Protein_Len: 35	Strand: -	Start: 3	End: 107
.. S  L  G  T  Q  I  S  R  R  K  C  I  Y  C  P  L  V  S  N  K  R  F  Y  C  A  R  G  K  C  D  R  S  T  C  M ............................................................................................................................
Protein_Len: 53	Strand: -	Start: 2	End: 160
. P  Y  G  Q  K  S  Q  D  E  K  V  F  I  V  H  Y  F  Q  I  K  G  S  I  A  H  E  G  K  A  T  G  P  H  A  S  I  K  R  R  H  K  P  S  S  T  C  I  R  H  C  K  K  M .......................................................................

ctggatagccctgtttggattgatcttcttttacaaatataacatggtaaaactgaatttttcctgaaatagcatgctctccctttgcagtcccgggatgtgcagatattttacgcctgtgttttggggacgaggtgcaaattcggtggcacttttttatatctttgtcccgagacgatttgctcgaatctcagcaaacgaagtctttcaatcacttaaaaacagatagtt
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================
PromScan Matrix: RpoN	Strand: -	Score: 81	Start: 136	End: 152
.......................................................................................................................................GTGCCACCGAATTTGCA...............................................................................

ctggatagccctgtttggattgatcttcttttacaaatataacatggtaaaactgaatttttcctgaaatagcatgctctccctttgcagtcccgggatgtgcagatattttacgcctgtgttttggggacgaggtgcaaattcggtggcacttttttatatctttgtcccgagacgatttgctcgaatctcagcaaacgaagtctttcaatcacttaaaaacagatagtt
Predict TransTerm conf > 70================================================

Find igs database================================================
Query_seq: PG0720:PG0721|PG0720:PG0721:DNA-binding response regulator:NLP/P60 family protein:<-->:773756..773986 231
ctggatagccctgtttggattgatcttcttttacaaatataacatggtaaaactgaatttttcctgaaatagcatgctctccctttgcagtcccgggatgtgcagatattttacgcctgtgttttggggacgaggtgcaaattcggtggcacttttttatatctttgtcccgagacgatttgctcgaatctcagcaaacgaagtctttcaatcacttaaaaacagatagtt
Intra-Species Hit: Count: 1	Min: 1	Max: 231	Len: 231
Subject: NC_002950_PG0720_PG0721|DNA-binding response regulator:NLP/P60 family protein|NEGATIVE:POSITIVE|[773756,773986]|231
HSP  1	e-value: 1.0E-128	bit: 458.0	Len: 231	Query Start:1	Query End:231	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 231
ctggatagccctgtttggattgatcttcttttacaaatataacatggtaaaactgaatttttcctgaaatagcatgctctccctttgcagtcccgggatgtgcagatattttacgcctgtgttttggggacgaggtgcaaattcggtggcacttttttatatctttgtcccgagacgatttgctcgaatctcagcaaacgaagtctttcaatcacttaaaaacagatagtt
ctggatagccctgtttggattgatcttcttttacaaatataacatggtaaaactgaatttttcctgaaatagcatgctctccctttgcagtcccgggatgtgcagatattttacgcctgtgttttggggacgaggtgcaaattcggtggcacttttttatatctttgtcccgagacgatttgctcgaatctcagcaaacgaagtctttcaatcacttaaaaacagatagtt

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
CUGGAUAGCCCUGUUUGGAUUGAUCUUCUUUUACAAAUAUAACAUGGUAAAACUGAAUUUUUCCUGAAAUAGCAUGCUCUCCCUUUGCAGUCCCGGGAUGUGCAGAUAUUUUACGCCUGUGUUUUGGGGACGAGGUGCAAAUUCGGUGGCACUUUUUUAUAUCUUUGUCCCGAGACGAUUUGCUCGAAUCUCAGCAAACGAAGUCUUUCAAUCACUUAAAAACAGAUAGUU
..........((((((.((((((.........((((((((((...(((...((((((((.....(((((((...(((.(((((...........)))).).)))..))))))).....(..(((((....)))))..).))))))))...)))...))))))..))))...(((((..((((((.(.....)))))))....)))))))))))......))))))...... (-54.20)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
AACUAUCUGUUUUUAAGUGAUUGAAAGACUUCGUUUGCUGAGAUUCGAGCAAAUCGUCUCGGGACAAAGAUAUAAAAAAGUGCCACCGAAUUUGCACCUCGUCCCCAAAACACAGGCGUAAAAUAUCUGCACAUCCCGGGACUGCAAAGGGAGAGCAUGCUAUUUCAGGAAAAAUUCAGUUUUACCAUGUUAUAUUUGUAAAAGAAGAUCAAUCCAAACAGGGCUAUCCAG
.....(((((((....(.((((((....((((.(((((...((((......))))(((((((((...((((((......((((..........))))..((((...........))))....)))))).....))))))))).))))).)))).(((...(((..((((.(((((...))))).)).))..)))..))).........))))))))))))))......... (-51.40)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
1029	120	71	211	162	NC_002950:PG0720|5end_DNA-binding_response_regulator_773665..773895_NEGATIVE
385	138	91	182	137	NC_002950:PG0684|5end_ABC_transporter,_permease_protein,_putative_737648..737878_POSITIVE
381	187	141	179	127	NC_002950:PG1961|5end_hypothetical_protein_2051153..2051383_NEGATIVE
368	129	81	53	11	NC_002950:PG1249|5end_1-acyl-sn-glycerol-3-phosphate_acetyltransferase,_putative_1327161..1327391_NEGATIVE
364	149	103	70	29	NC_002950:PG1852|5end_exonuclease_1951973..1952203_NEGATIVE
363	146	108	51	7	NC_002950:PG1305|5end_glycine_dehydrogenase_1386538..1386768_NEGATIVE
362	115	71	70	26	NC_002950:PG0671|5end_iron_compound_ABC_transporter,_permease_protein_721888..722118_POSITIVE
357	139	93	220	171	NC_002950:PG1968|5end_hypothetical_protein_2058564..2058794_NEGATIVE
356	138	93	126	82	NC_002950:PG0326|5end_hypothetical_protein_360974..361204_NEGATIVE
352	120	74	224	180	NC_002950:PG0657|5end_Maf-like_protein_707782..708012_NEGATIVE
351	153	114	197	157	NC_002950:PG0164|5end_hypothetical_protein_187395..187625_NEGATIVE
349	109	68	229	177	NC_002950:PG1312|5end_capA_protein,_putative_1390286..1390516_POSITIVE
348	129	87	113	64	NC_002950:PG0320|5end_hypothetical_protein_353409..353639_POSITIVE
345	115	71	62	22	NC_002950:PG0790|5end_GTP-binding_protein_Obg_842583..842813_NEGATIVE
343	190	145	223	173	NC_002950:PG1081|5end_acetate_kinase_1149627..1149857_NEGATIVE
339	150	102	229	182	NC_002950:PG1291|5end_hypothetical_protein_1371178..1371408_NEGATIVE
337	118	72	57	4	NC_002950:PG1255|5end_recombination_protein_RecR_1332751..1332981_NEGATIVE
335	138	94	219	163	NC_002950:PG0211|5end_cobalamin_biosynthesis_protein_CbiG/precorrin-4_C11-methyltransferase_247810..248040_NEGATIVE
334	128	82	170	120	NC_002950:PG1767|5end_lipoprotein,_putative_1853995..1854225_POSITIVE
334	121	87	198	165	NC_002950:PG0240|5end_hydrolase,_haloacid_dehalogenase-like_family_277093..277323_NEGATIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
368	130	83	101	50	NC_002950:PG0323|3end_hypothetical_protein_357059..357209_NEGATIVE
364	149	103	57	16	NC_002950:PG1853|3end_DNA_polymerase_III,_beta_subunit_1951986..1952136_NEGATIVE
363	146	108	46	2	NC_002950:PG1306|3end_metallo-beta-lactamase_family_protein_1386543..1386693_NEGATIVE
362	115	71	73	29	NC_002950:PG0670|3end_lipoprotein,_putative_721971..722121_POSITIVE
348	129	87	81	32	NC_002950:PG0319|3end_hypothetical_protein_353457..353607_POSITIVE
345	115	71	52	12	NC_002950:PG0791|3end_adenylate_kinase_842593..842743_NEGATIVE
337	118	72	60	7	NC_002950:PG1256|3end_ribonuclease,_Rne/Rng_family_1332748..1332898_NEGATIVE
325	135	94	59	1	NC_002950:PG0052|3end_sensor_histidine_kinase_64686..64836_POSITIVE
324	158	114	109	53	NC_002950:PG2207|3end_hypothetical_protein_2319142..2319292_NEGATIVE
324	151	114	52	9	NC_002950:PG2028|3end_ebsC_protein_2126616..2126766_POSITIVE
324	170	124	130	82	NC_002950:PG1473|3end_conjugative_transposon_protein_TraQ_1549761..1549911_NEGATIVE
324	133	91	150	110	NC_002950:PG0683|3end_ABC_transporter,_permease_protein,_putative_737701..737851_POSITIVE
318	96	58	106	68	NC_002950:PG2214|3end_hypothetical_protein_2325301..2325451_NEGATIVE
316	104	72	119	85	NC_002950:PG1743|3end_2-dehydro-3-deoxyphosphooctonate_aldolase_1827530..1827680_NEGATIVE
316	118	74	88	29	NC_002950:PG0172|3end_exonuclease_194355..194505_POSITIVE
315	119	71	108	58	NC_002950:PG0296|3end_phosphoribosylformylglycinamidine_synthase_331293..331443_NEGATIVE
313	129	88	136	92	NC_002950:PG1093|3end_hypothetical_protein_1158779..1158929_POSITIVE
311	120	74	122	84	NC_002950:PG1563|3end_glucose-1-phosphate_thymidylyltransferase_1641597..1641747_NEGATIVE
310	107	61	70	13	NC_002950:PG0605|3end_hypothetical_protein_661165..661315_NEGATIVE
309	146	101	49	9	NC_002950:PG1852|3end_exonuclease_1951194..1951344_NEGATIVE